ID: 1111810114

View in Genome Browser
Species Human (GRCh38)
Location 13:93089077-93089099
Sequence GTGTACACCCACTACTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111810114_1111810118 9 Left 1111810114 13:93089077-93089099 CCAATATAGTAGTGGGTGTACAC No data
Right 1111810118 13:93089109-93089131 GACATTTCTACAAATATTCAGGG No data
1111810114_1111810117 8 Left 1111810114 13:93089077-93089099 CCAATATAGTAGTGGGTGTACAC No data
Right 1111810117 13:93089108-93089130 TGACATTTCTACAAATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111810114 Original CRISPR GTGTACACCCACTACTATAT TGG (reversed) Intergenic
No off target data available for this crispr