ID: 1111811143

View in Genome Browser
Species Human (GRCh38)
Location 13:93095910-93095932
Sequence GTGTATACCCACTATTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111811143_1111811146 8 Left 1111811143 13:93095910-93095932 CCAATATAATAGTGGGTATACAC No data
Right 1111811146 13:93095941-93095963 TGAGATTTCTATGAATGTTCAGG No data
1111811143_1111811147 9 Left 1111811143 13:93095910-93095932 CCAATATAATAGTGGGTATACAC No data
Right 1111811147 13:93095942-93095964 GAGATTTCTATGAATGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111811143 Original CRISPR GTGTATACCCACTATTATAT TGG (reversed) Intergenic
No off target data available for this crispr