ID: 1111813227

View in Genome Browser
Species Human (GRCh38)
Location 13:93118552-93118574
Sequence GGTGATTTGCAGCCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111813225_1111813227 -3 Left 1111813225 13:93118532-93118554 CCAAAGCACTAAATGAGTTTGGT No data
Right 1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111813227 Original CRISPR GGTGATTTGCAGCCTGTGGA AGG Intergenic
No off target data available for this crispr