ID: 1111813505

View in Genome Browser
Species Human (GRCh38)
Location 13:93121042-93121064
Sequence TGATCCAAAACCCATGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111813505_1111813509 17 Left 1111813505 13:93121042-93121064 CCAAAAGCATGGGTTTTGGATCA No data
Right 1111813509 13:93121082-93121104 GATAGATCTGCAACTTGAGGGGG No data
1111813505_1111813508 16 Left 1111813505 13:93121042-93121064 CCAAAAGCATGGGTTTTGGATCA No data
Right 1111813508 13:93121081-93121103 TGATAGATCTGCAACTTGAGGGG No data
1111813505_1111813507 15 Left 1111813505 13:93121042-93121064 CCAAAAGCATGGGTTTTGGATCA No data
Right 1111813507 13:93121080-93121102 GTGATAGATCTGCAACTTGAGGG No data
1111813505_1111813506 14 Left 1111813505 13:93121042-93121064 CCAAAAGCATGGGTTTTGGATCA No data
Right 1111813506 13:93121079-93121101 TGTGATAGATCTGCAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111813505 Original CRISPR TGATCCAAAACCCATGCTTT TGG (reversed) Intergenic
No off target data available for this crispr