ID: 1111813508

View in Genome Browser
Species Human (GRCh38)
Location 13:93121081-93121103
Sequence TGATAGATCTGCAACTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111813505_1111813508 16 Left 1111813505 13:93121042-93121064 CCAAAAGCATGGGTTTTGGATCA No data
Right 1111813508 13:93121081-93121103 TGATAGATCTGCAACTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111813508 Original CRISPR TGATAGATCTGCAACTTGAG GGG Intergenic
No off target data available for this crispr