ID: 1111820999

View in Genome Browser
Species Human (GRCh38)
Location 13:93214998-93215020
Sequence AAGACTCCCCTAGAAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111820995_1111820999 7 Left 1111820995 13:93214968-93214990 CCTAAATTTCTTGACAGGGCCCT No data
Right 1111820999 13:93214998-93215020 AAGACTCCCCTAGAAGCCAGAGG No data
1111820994_1111820999 8 Left 1111820994 13:93214967-93214989 CCCTAAATTTCTTGACAGGGCCC No data
Right 1111820999 13:93214998-93215020 AAGACTCCCCTAGAAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111820999 Original CRISPR AAGACTCCCCTAGAAGCCAG AGG Intergenic