ID: 1111822776

View in Genome Browser
Species Human (GRCh38)
Location 13:93233772-93233794
Sequence ACTCACTGACCAGTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111822776_1111822785 1 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822785 13:93233796-93233818 GGGAGAGGGGTGTGGGAGACTGG 0: 1
1: 0
2: 8
3: 159
4: 1187
1111822776_1111822787 8 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822787 13:93233803-93233825 GGGTGTGGGAGACTGGAGAAGGG 0: 1
1: 0
2: 3
3: 102
4: 1027
1111822776_1111822784 -6 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822784 13:93233789-93233811 GTGAGTGGGGAGAGGGGTGTGGG 0: 1
1: 0
2: 16
3: 153
4: 1421
1111822776_1111822788 9 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822788 13:93233804-93233826 GGTGTGGGAGACTGGAGAAGGGG 0: 1
1: 1
2: 5
3: 60
4: 596
1111822776_1111822789 10 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822789 13:93233805-93233827 GTGTGGGAGACTGGAGAAGGGGG 0: 1
1: 0
2: 7
3: 69
4: 1036
1111822776_1111822790 18 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822790 13:93233813-93233835 GACTGGAGAAGGGGGCCCAAAGG 0: 1
1: 0
2: 1
3: 19
4: 220
1111822776_1111822783 -7 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822783 13:93233788-93233810 AGTGAGTGGGGAGAGGGGTGTGG 0: 1
1: 1
2: 17
3: 232
4: 2152
1111822776_1111822791 23 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822791 13:93233818-93233840 GAGAAGGGGGCCCAAAGGTCAGG 0: 1
1: 0
2: 3
3: 13
4: 189
1111822776_1111822786 7 Left 1111822776 13:93233772-93233794 CCTGGGGAGACTGGTCAGTGAGT 0: 1
1: 0
2: 4
3: 34
4: 192
Right 1111822786 13:93233802-93233824 GGGGTGTGGGAGACTGGAGAAGG 0: 1
1: 0
2: 9
3: 103
4: 1215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111822776 Original CRISPR ACTCACTGACCAGTCTCCCC AGG (reversed) Intronic
900132431 1:1092770-1092792 ACAAACTGACCAGGCTGCCCAGG + Intronic
900706829 1:4086180-4086202 TCTCACTGAGCATTCTCCCTGGG + Intergenic
902519824 1:17009957-17009979 AGCCACAGCCCAGTCTCCCCAGG + Intronic
902640690 1:17764385-17764407 ACTTTATGACCAGTCCCCCCTGG - Intronic
902871469 1:19316089-19316111 ACTCACTGTCCAGGGTGCCCGGG + Intronic
903312865 1:22473672-22473694 GCTCACTGACCAGTTCCCTCAGG + Intronic
903555920 1:24193308-24193330 ACTCCCTTACCCCTCTCCCCCGG - Intergenic
904756846 1:32772590-32772612 ACTCACACACCATTCTCCTCTGG - Intronic
904869427 1:33607460-33607482 AAGCTCTGACCACTCTCCCCAGG - Intronic
906116325 1:43359447-43359469 ACAGTCTGACCAGGCTCCCCAGG - Intronic
906128751 1:43443330-43443352 GCTCACTGCCCTGTTTCCCCAGG + Exonic
906942341 1:50266137-50266159 AGTCACTGACCAGTGGCCTCAGG + Intergenic
907299488 1:53477691-53477713 TCTCCCTGACTGGTCTCCCCTGG - Intergenic
909744288 1:79073912-79073934 ACTCACACACCAATCTCCTCTGG + Intergenic
910065357 1:83144296-83144318 ACTCACTGACCATTTTCCCGAGG + Intergenic
910573943 1:88737391-88737413 ACTCAGTGACAAGTCTGCCATGG - Intronic
910927157 1:92409395-92409417 ACACACTGACCTTTCTCCTCTGG - Intergenic
910958612 1:92736087-92736109 ACTCTCTGAACAGTCTCCTTTGG - Intronic
912344961 1:108955626-108955648 ACTCACAAACCAGTCTTCCCTGG - Intronic
913063552 1:115229512-115229534 ACTCACACACCAGTCTACTCTGG - Intergenic
915015006 1:152724703-152724725 AATCTCTGTCCAGTTTCCCCGGG - Intergenic
915553840 1:156650370-156650392 ACTCACTGTCCTGTCTTGCCTGG + Intronic
915925223 1:160012278-160012300 ACTCACCCACCAATCTCTCCTGG + Intergenic
917545310 1:175960889-175960911 ACTCACACACCAGTCTCTTCTGG - Intronic
918683346 1:187383185-187383207 ACTCCCTAACCACACTCCCCAGG + Intergenic
921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG + Exonic
922316532 1:224447482-224447504 ACTCACACACCAGTCTCCTGTGG + Intronic
922548210 1:226474245-226474267 ACTCACACGCCAGTCTCCTCTGG + Intergenic
923391906 1:233520699-233520721 ACTCACATGCCAGTCTCCTCTGG - Intergenic
923510713 1:234649898-234649920 ACTCACATGCCAGTCTCCTCTGG + Intergenic
1063205581 10:3827399-3827421 AATCACTGCCCTGTGTCCCCAGG - Intergenic
1066378999 10:34885467-34885489 ACTCCCTTACCTGTCTCCCCAGG - Intergenic
1066653568 10:37680710-37680732 ACTCTCTGTCCAGTCTGGCCTGG + Intergenic
1067158817 10:43805391-43805413 CCCCATTGATCAGTCTCCCCTGG - Intergenic
1069760098 10:70804168-70804190 GCTCACTCACCTGTTTCCCCTGG + Intergenic
1071200947 10:83220301-83220323 ACCCAGTGACCAGTGTCCCCAGG + Intergenic
1072920057 10:99569272-99569294 ACACACAGAGCAGTCTCCCCAGG + Intergenic
1073099972 10:101001187-101001209 ACTTACTGACAAGTCTGTCCAGG + Exonic
1075316998 10:121460818-121460840 ACTCATTGTCCTGTATCCCCAGG + Intergenic
1075593787 10:123712375-123712397 ACTCACACACCAATCTCCTCTGG + Intronic
1075636045 10:124031032-124031054 ACTCACAGCCCAGTCCCTCCTGG + Intronic
1076478046 10:130766307-130766329 CCTCACTGATCACTCTCCACAGG - Intergenic
1076738107 10:132467690-132467712 ACCTGCTGCCCAGTCTCCCCAGG + Intergenic
1078731528 11:13979487-13979509 ACTCTCTTACTAGTTTCCCCTGG - Intronic
1085012471 11:73150752-73150774 ACTCACTCACAAACCTCCCCCGG - Intergenic
1085975301 11:81645795-81645817 CCTCACTCACCTTTCTCCCCAGG - Intergenic
1086002728 11:82000977-82000999 ACCCAGTGACCAGGGTCCCCTGG + Intergenic
1089816713 11:121182795-121182817 ACTCACCCACCAGTCACCACTGG - Intronic
1091103789 11:132899702-132899724 ACTCACATGCCAGTCTCCTCTGG - Intronic
1091203594 11:133801503-133801525 ACTCACACTCCAGTCTCCTCTGG - Intergenic
1091284757 11:134402440-134402462 ACTCCCTGCCCCGTCTCCCCAGG + Intronic
1091308939 11:134559399-134559421 ACCCTCTGACAACTCTCCCCGGG - Intergenic
1092814053 12:12297483-12297505 ACTCACACACCAGTCTCCTCTGG + Intergenic
1094513469 12:31111182-31111204 AGTACCTGACCAGTATCCCCCGG + Intergenic
1094733177 12:33201088-33201110 ACTGACAGGTCAGTCTCCCCTGG + Intergenic
1095643263 12:44509839-44509861 CCTCACAGAACAGTCTACCCTGG - Intronic
1095732471 12:45521094-45521116 ACTCACATACCAATCTCCTCTGG + Intergenic
1096380624 12:51154961-51154983 ACTCACACACCAGTCTTCTCTGG - Intronic
1097529936 12:60785966-60785988 ACTCAATTATCAGTCTCCTCTGG + Intergenic
1097838302 12:64296030-64296052 ACTCACATGCCAGTCTCCTCTGG - Intronic
1101293820 12:103400248-103400270 GCTCACAGACCAGTGCCCCCTGG - Intronic
1103557427 12:121775018-121775040 GCTCACCCACCAGACTCCCCTGG - Intronic
1103703311 12:122858979-122859001 CCTCACTGGCTTGTCTCCCCTGG + Intronic
1104263368 12:127206025-127206047 ACTCACACACCAGTCTCCTCTGG + Intergenic
1105751518 13:23425596-23425618 ACTCCCTGCCCGCTCTCCCCAGG - Intronic
1106080582 13:26497264-26497286 AGTCATTGCCCAGTGTCCCCTGG - Intergenic
1106180100 13:27362783-27362805 ACTCACTGATCAGACGTCCCAGG + Intergenic
1110815509 13:79856467-79856489 ACTCACATATCAGTCTCCCCTGG - Intergenic
1111822776 13:93233772-93233794 ACTCACTGACCAGTCTCCCCAGG - Intronic
1112349735 13:98622917-98622939 ACTCCTTCACCAGTTTCCCCTGG + Intergenic
1115972334 14:38959665-38959687 ACTGACTCACTTGTCTCCCCAGG - Intergenic
1116778799 14:49212852-49212874 ACTCACATGCCAGTCTCCTCTGG - Intergenic
1117244518 14:53870915-53870937 ACACACACACCAGTCACCCCAGG + Intergenic
1118770182 14:68937788-68937810 ACAAACTCACCAGCCTCCCCAGG + Intronic
1119857020 14:77908416-77908438 ACCCACTGGCCAGTATTCCCTGG - Intronic
1120622178 14:86777344-86777366 ACTTACACACCAGTCTCCTCTGG - Intergenic
1120683652 14:87511774-87511796 ATTCACAGACCAGTCTCTTCTGG + Intergenic
1120828306 14:88974985-88975007 GCCCACTGACCAGTGTCCCTTGG + Intergenic
1121596173 14:95164680-95164702 ACTCACATGCCAGTCTCCTCTGG + Intergenic
1122127894 14:99588949-99588971 AGTCTCTGACCAGTCTCCCCAGG - Intronic
1123965926 15:25457720-25457742 ACTCCATTACCAGTTTCCCCTGG - Intergenic
1124384235 15:29193244-29193266 ACTCACACACCAATCTCCTCTGG - Intronic
1124454272 15:29826546-29826568 AAACACTGACAAGTCTACCCTGG + Intronic
1127586840 15:60386329-60386351 ATTCACACATCAGTCTCCCCAGG - Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128766253 15:70252955-70252977 CCTCCCTGCCCACTCTCCCCAGG + Intergenic
1128785708 15:70395388-70395410 ACTCAGTGCCCACTCTCACCGGG + Intergenic
1129151344 15:73689896-73689918 ACTCACTTGCCAGGCTCCCTAGG - Intronic
1129169348 15:73798278-73798300 GCTCCCTGATCAGGCTCCCCAGG - Intergenic
1132310853 15:100856893-100856915 GATCACTGCCCAGTCTCCTCAGG - Intergenic
1132482856 16:175241-175263 GCTCCCTGCCCTGTCTCCCCAGG - Intergenic
1132886376 16:2184076-2184098 ACTCACGGGCCAGGCTCACCGGG - Intronic
1132948590 16:2547148-2547170 GCTCACTAACCTGCCTCCCCAGG - Intronic
1132965997 16:2654978-2655000 GCTCACTAACCTGCCTCCCCAGG + Intergenic
1132969400 16:2678274-2678296 ACGCACGGAAGAGTCTCCCCAGG - Intergenic
1134203625 16:12219712-12219734 ACGCACAGACCAGTTTCCTCTGG + Intronic
1134787239 16:16955771-16955793 ACTCCCTTACCAGTTTCTCCTGG - Intergenic
1135514989 16:23124500-23124522 ACTCACTGACGAGTATGTCCCGG - Intronic
1136086592 16:27889763-27889785 ATTCCCTTACCAGTCTCCCCAGG + Intronic
1139500833 16:67363536-67363558 ACTCACTGACCAGACTTCAAAGG - Intronic
1140332118 16:74068515-74068537 ACTCACACACCAGTCTCCTCCGG - Intergenic
1141428884 16:83960744-83960766 ACTCACGTGCCAGGCTCCCCCGG - Exonic
1143771670 17:9173100-9173122 ACTTAGAGACCAGTCTCCCTGGG + Intronic
1143882949 17:10043721-10043743 TCTCACTCACCAGACTGCCCAGG - Intronic
1147495283 17:40909518-40909540 ACTCACAAACCAGTTTCACCCGG - Intergenic
1148629389 17:49095191-49095213 ACTCACACACCAGTCTCCTCTGG - Intergenic
1151969543 17:77450693-77450715 ACTCACTGGCCAGGTCCCCCAGG + Intronic
1152564630 17:81094692-81094714 ACCCACTGACCAGGCCTCCCAGG - Intronic
1153659098 18:7310625-7310647 GTTCACTGACCAGTCTCCTCTGG + Intergenic
1156188844 18:34695506-34695528 ACTCTCTGACCCGTCTCCACTGG - Intronic
1157347799 18:46855660-46855682 ATTCTCAGAACAGTCTCCCCAGG + Intronic
1157775745 18:50394619-50394641 ATAGACAGACCAGTCTCCCCAGG - Intergenic
1158447271 18:57532316-57532338 ACTCACTGCTCACTCTTCCCAGG + Intergenic
1159422597 18:68242679-68242701 ACTCACACATCAGTCTCCTCAGG - Intergenic
1160809529 19:1007421-1007443 ACACACTGTCCAGGGTCCCCTGG - Intronic
1161474351 19:4475804-4475826 AGTCATTGCCCAGTGTCCCCTGG + Intronic
1163008791 19:14412098-14412120 ATTCACTGAAGTGTCTCCCCAGG + Intronic
1163582066 19:18144952-18144974 ACTCCCTCACAGGTCTCCCCTGG - Intronic
1165124308 19:33583124-33583146 ACTCACATACCAGTCTCCTCTGG + Intergenic
1166697068 19:44858089-44858111 ATTCACTGTACAGTCTCCCTGGG + Intronic
1166863073 19:45820887-45820909 ACTCACTGAGCACTCTGCGCTGG - Intronic
926133879 2:10323148-10323170 ACTCTCTGACCTGGCTCCCCCGG + Intronic
927208377 2:20624190-20624212 AGGCAATGACCTGTCTCCCCAGG + Intronic
932209005 2:69911700-69911722 AATCTCTGCCCAGTCTCCTCTGG - Intronic
933184891 2:79267989-79268011 ACTCACTGACCGGGTTCCTCAGG + Intronic
936398609 2:112149237-112149259 ACTCACTGCCCAATGCCCCCAGG - Intronic
936903800 2:117513750-117513772 ACTCACTGAACCTTCTCACCTGG - Intergenic
937200808 2:120203597-120203619 AGGCACTGACCCGCCTCCCCTGG + Intergenic
938370836 2:130767472-130767494 AGGCACTGACCAGCGTCCCCTGG - Exonic
939934888 2:148279072-148279094 ACTCACATGCCAGTCTCCTCTGG + Intronic
944664958 2:201952237-201952259 ACTGAGGGACCAGTCTTCCCTGG + Intergenic
946118853 2:217491024-217491046 ACTCACTGCCCAGTTGTCCCAGG + Intronic
946389903 2:219408979-219409001 ACTCACTGTCTAATGTCCCCTGG - Intergenic
947955984 2:234192086-234192108 TCCCACTGCCCTGTCTCCCCTGG + Intergenic
948393798 2:237630381-237630403 CCTGACTCTCCAGTCTCCCCAGG - Intronic
949067502 2:242002119-242002141 ACTCAGGGACAAGCCTCCCCTGG - Intergenic
1173374380 20:42470435-42470457 ACTCCCCTCCCAGTCTCCCCTGG + Intronic
1173434408 20:43019677-43019699 ACTCACACATCAGTCTCTCCTGG - Intronic
1174110303 20:48193990-48194012 AGCCACTGCCCAGTCTCCTCTGG - Intergenic
1175636971 20:60592874-60592896 ACTCACACACCAGTCTCCTCTGG - Intergenic
1178884393 21:36473846-36473868 CCTCCCTCACCAGTCTCCTCTGG - Intronic
1179382834 21:40915276-40915298 ACTCACACACCAGTCTCCTCTGG - Intergenic
1180884446 22:19230834-19230856 ACTCACATGCCAGTCTCCTCTGG - Intronic
1181556726 22:23675566-23675588 ACACATTGACCAGCCTCCCAGGG - Intergenic
1182562293 22:31170046-31170068 ACTCACTGGCCATTCTGTCCTGG + Intronic
1183241307 22:36659988-36660010 ACTGACTGCCCAGCCTCCTCTGG + Intronic
1183474903 22:38030811-38030833 AACCACTGACCACGCTCCCCAGG - Intronic
949452347 3:4200301-4200323 ACTCACACACCAGTCTCCTCTGG - Intronic
951539836 3:23772042-23772064 ACCCACTGACCACCCTCCTCTGG - Intergenic
953180252 3:40588401-40588423 ACTCCCTTACCAATCTCCCAAGG - Intergenic
953999094 3:47542219-47542241 CCTCACAGACAAGCCTCCCCTGG + Intergenic
955406970 3:58631644-58631666 ACTCCCTTACCAGTGTCCCCAGG - Intergenic
956120878 3:65964729-65964751 TCTCCCTGACCAGAATCCCCAGG + Intronic
959861670 3:111222987-111223009 ACTCACATGCCAGTCTACCCTGG + Intronic
961595231 3:128010593-128010615 ACTCACGCACTCGTCTCCCCTGG - Intergenic
963061664 3:141231599-141231621 GCAGACTGACCAGTCTCTCCGGG + Intronic
964708426 3:159646038-159646060 ACTTTCTGACTAATCTCCCCTGG - Intronic
966113523 3:176432604-176432626 ACTCACACACCAGTCTTCTCTGG + Intergenic
968378940 4:71959-71981 ACTCAATGACCACCCTCCCAAGG - Intronic
968565091 4:1307880-1307902 ACTCACCCACCAGTCTCCTCTGG + Intronic
969237527 4:5876469-5876491 ACTAACTGACCAGTCTCTTCTGG + Intronic
969516130 4:7649148-7649170 ACTCACTTTAAAGTCTCCCCCGG - Intronic
970486080 4:16526116-16526138 ACTCACACACCATTCTCCTCTGG - Intronic
971012679 4:22456310-22456332 ACTCCCGCACCAATCTCCCCTGG - Intronic
974378648 4:61109334-61109356 ACTCACAGGCCAATCTCCTCTGG - Intergenic
974550475 4:63366248-63366270 ACTCACTCACTAATCTCCTCTGG - Intergenic
979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG + Intergenic
982112034 4:152065701-152065723 ACTCGCTCTTCAGTCTCCCCTGG - Intergenic
983768453 4:171517813-171517835 ACTCACACACCAGTCTCCTCTGG - Intergenic
984822868 4:183898322-183898344 TCCCACTGTCCAGTCTCCCAGGG - Intronic
986311714 5:6556190-6556212 ACTCACTCCCCAAACTCCCCAGG - Intergenic
986614742 5:9604770-9604792 ACTCACATGCCAGTCTCCTCTGG - Intergenic
995536403 5:113140995-113141017 ACTCACACACCAGTCTCCTCTGG - Intronic
995585140 5:113641117-113641139 ACTCACACACCAGTCTCCTCTGG - Intergenic
995654659 5:114411787-114411809 ACTCACACACCAGTCTCCTTTGG + Intronic
1005506164 6:26470550-26470572 ACTCACATACCAGTCTCCCCTGG - Intronic
1005564190 6:27073185-27073207 ACTCGCACACCAGTCTCCTCTGG - Intergenic
1006610681 6:35292532-35292554 CCTCACAGCCCAGTGTCCCCAGG + Exonic
1006627613 6:35408513-35408535 AGTCCCTGACCACTCGCCCCTGG - Intronic
1007221472 6:40282302-40282324 GCTCACTGACCAGAGTCTCCAGG + Intergenic
1007702883 6:43774727-43774749 ACTAAATGTCCACTCTCCCCTGG - Intronic
1007844166 6:44740102-44740124 ACTGGCAGACCAGTCTGCCCTGG - Intergenic
1012802630 6:103851622-103851644 ACTCCCTCACCAATCTCCTCTGG - Intergenic
1013702992 6:112796450-112796472 ACTCACTGAAGACCCTCCCCGGG - Intergenic
1014927637 6:127293135-127293157 ACTCACTGAACAGTCCTTCCTGG - Intronic
1018957288 6:168418761-168418783 CCTCCCTGCCCAGGCTCCCCAGG + Intergenic
1019213587 6:170425142-170425164 ACTCAGTGGGCAGTGTCCCCAGG + Intergenic
1019370412 7:660223-660245 CCTCCCTGCTCAGTCTCCCCGGG + Intronic
1020905422 7:14058269-14058291 CCTGACTCACGAGTCTCCCCAGG + Intergenic
1024456678 7:49615938-49615960 ATTCACACACCAGTCTCCACTGG + Intergenic
1026500333 7:70938272-70938294 ACTCTCTGAACAGAGTCCCCAGG + Intergenic
1026593433 7:71715029-71715051 ATGCTCTGAGCAGTCTCCCCAGG - Intergenic
1029737010 7:102470553-102470575 ACTCCCTCACCAGGCTCCCAGGG - Intronic
1031426410 7:121610723-121610745 ACTCCCTGACCAGTGTTTCCTGG + Intergenic
1034202818 7:149293189-149293211 ATTCACAGACCAAGCTCCCCTGG + Intronic
1034971699 7:155423595-155423617 ACACTCTGACCAGTCTCCTGGGG - Intergenic
1035120094 7:156559699-156559721 ACTCACTCCACACTCTCCCCTGG + Intergenic
1035847683 8:2882753-2882775 ACTCACAGGCCAGTCTCTTCTGG - Intergenic
1037450857 8:19014244-19014266 CCTCTCTGACCGGGCTCCCCCGG + Intronic
1037571899 8:20164964-20164986 GCTCACAGAACAGTCTCCCCAGG - Exonic
1037767191 8:21779482-21779504 ACCCGCTGCCCAGTCTCCCTTGG + Intronic
1037877361 8:22554596-22554618 ACTCACTCACCCGTGTCCCCCGG - Exonic
1041111933 8:54491259-54491281 ACTCTCTGAGCAGGCTCCCTGGG - Intergenic
1042823569 8:72957595-72957617 GCTCACTTGCCAGTCTCCTCTGG + Intergenic
1043928159 8:86061208-86061230 ACTCCCTTACCTGTCTCCCCAGG + Intronic
1047518550 8:125576443-125576465 AATCTCTGACCAGTCAGCCCCGG - Intergenic
1049592513 8:143469018-143469040 CCTCCCTGGCCAGGCTCCCCAGG + Intronic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1052709956 9:32042048-32042070 ACACACTGACCAGTCTCAGTAGG + Intergenic
1052969196 9:34366359-34366381 ACTCACTGATAAGCCTCCCCAGG - Intergenic
1053200200 9:36147063-36147085 ACTCACACACCAGTCTCCTCTGG + Intronic
1055595412 9:77860728-77860750 ACACACTGAACAGTCCCCACAGG + Intronic
1060177211 9:121505823-121505845 ACTCACTGCCCCTTCCCCCCAGG - Intergenic
1060747215 9:126145581-126145603 ACTCACTGACCAGGCTCTCTTGG - Intergenic
1060819165 9:126651619-126651641 ACTGCCTGACCCCTCTCCCCTGG + Intronic
1061950709 9:133934446-133934468 GCTCACAGGCCAGTCTCCTCTGG - Intronic
1185501460 X:599860-599882 ACTCACTGATGAGTCTCCGTTGG + Intergenic
1186758070 X:12694074-12694096 ACTCCCTTACTAGCCTCCCCTGG + Intronic
1187067889 X:15858390-15858412 AGACACTGACAAGTGTCCCCTGG - Intergenic
1188804947 X:34576663-34576685 GCTCCCTTACCAGTTTCCCCTGG - Intergenic
1189237038 X:39495076-39495098 ACTCCCTTACCAGTTTCCCCTGG - Intergenic
1189259617 X:39669156-39669178 ACCCCCTCACCAGTCTCCCCTGG + Intergenic
1189627273 X:42912546-42912568 ACTCCCTTACCAGTTTCTCCTGG - Intergenic
1190112718 X:47605077-47605099 ACTCACTGACCCAGCTCTCCTGG - Intronic
1190233824 X:48601302-48601324 GCTCTCTGACCAATCTACCCTGG - Intronic
1190280241 X:48924403-48924425 CCTCACTCACCAGACTCCACTGG + Intronic
1194531186 X:95051256-95051278 ACTCACAGACTACTCTCCCCTGG - Intergenic
1194804229 X:98307427-98307449 ACTCTCTTACCAGTTTCTCCTGG + Intergenic
1195091159 X:101460347-101460369 CCTCACCCACCAGGCTCCCCAGG - Intronic
1196734339 X:118971681-118971703 ACTCACTGACCAGACTCCACAGG - Intergenic
1199071347 X:143478945-143478967 AATCACTCCCCATTCTCCCCTGG + Intergenic