ID: 1111825425

View in Genome Browser
Species Human (GRCh38)
Location 13:93261734-93261756
Sequence CTTATCTGTTTGTCCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111825425_1111825427 -8 Left 1111825425 13:93261734-93261756 CCAGGGTTGGACAAACAGATAAG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1111825427 13:93261749-93261771 CAGATAAGCTTCTTAACTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 124
1111825425_1111825428 18 Left 1111825425 13:93261734-93261756 CCAGGGTTGGACAAACAGATAAG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1111825428 13:93261775-93261797 TAACTGTCTCTTCACTTTTGAGG 0: 1
1: 0
2: 1
3: 32
4: 340
1111825425_1111825429 29 Left 1111825425 13:93261734-93261756 CCAGGGTTGGACAAACAGATAAG 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1111825429 13:93261786-93261808 TCACTTTTGAGGTGTCAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111825425 Original CRISPR CTTATCTGTTTGTCCAACCC TGG (reversed) Intronic
900488697 1:2935658-2935680 CTTATCTGTCTGTAGAGCCCAGG - Intergenic
906431118 1:45756550-45756572 GTTCTCTGTTAGTCCAAACCTGG + Intergenic
912742987 1:112219025-112219047 CTTGTCTGTGGTTCCAACCCAGG + Intergenic
917717545 1:177753546-177753568 CCTATCTGGCTGTGCAACCCTGG - Intergenic
918426487 1:184415403-184415425 ATTATCTGTTAGTAAAACCCAGG - Intronic
920675665 1:208037089-208037111 CTTATCTGTAAGTACAATCCTGG + Intronic
1063595787 10:7434498-7434520 CTTGTCTGTTTGTGAAAGCCAGG + Intergenic
1063599449 10:7467029-7467051 GGTATCTGTTAGCCCAACCCAGG + Intergenic
1064781528 10:18844435-18844457 TTTATCTGTCTGTATAACCCTGG + Intergenic
1064890339 10:20164471-20164493 CTTATCTGTGTGACCAAGACAGG - Exonic
1065604521 10:27403764-27403786 ATTATCTTTTTATCCATCCCTGG + Intronic
1067787583 10:49261754-49261776 CTTATCACTTTGGCCAGCCCAGG + Intergenic
1068587449 10:58815041-58815063 CTCATCTGTTTATACAGCCCAGG - Intronic
1070603704 10:77883569-77883591 CTTATGTTTTTTTCTAACCCAGG - Intronic
1072479535 10:95797348-95797370 CTGATCTGTATTTCCAGCCCAGG - Intronic
1073842579 10:107514701-107514723 CTTATCAGTTTTTGTAACCCTGG + Intergenic
1074527120 10:114272355-114272377 ATTATCTGCTTTCCCAACCCAGG + Intronic
1076001645 10:126917656-126917678 CTTATCCCTTTGTTCCACCCCGG + Intronic
1078858208 11:15223814-15223836 CTAATCTGTTTTTCCAGTCCTGG + Intronic
1079054191 11:17191267-17191289 CCTTTCTGGTTGGCCAACCCTGG - Intronic
1079103375 11:17555452-17555474 CTTTTCTCTTTATCCTACCCAGG - Intronic
1079626277 11:22620387-22620409 CATATCTGTTTCTCCAAAACAGG + Intergenic
1083784640 11:64936894-64936916 CTGATCTATTTGTCCAACTCTGG + Intergenic
1083946738 11:65927790-65927812 CTTTTCTGTTTTTTCAACACAGG - Intergenic
1085301544 11:75461869-75461891 CTTATCTGTCAGTAGAACCCTGG + Intronic
1094322036 12:29194792-29194814 CTTCTCTTTCTGTCCAACACTGG - Intronic
1099687795 12:85911223-85911245 TTTATATGTTTGTCCACTCCTGG - Intergenic
1102441468 12:112967100-112967122 CTTATCTTTCTGTCTAACCGAGG - Intronic
1104539584 12:129651045-129651067 CTTATCTATTTATCAATCCCGGG + Intronic
1105606286 13:21929163-21929185 CTTATCTGGTTGTAGGACCCAGG + Intergenic
1108767222 13:53646697-53646719 CTCATCTGATTGTCCAAATCAGG + Intergenic
1111739471 13:92184907-92184929 GTTGTGTGTTTGCCCAACCCTGG - Intronic
1111816263 13:93157059-93157081 CTTGTCTGCTTTTCCCACCCAGG + Intergenic
1111825425 13:93261734-93261756 CTTATCTGTTTGTCCAACCCTGG - Intronic
1112139276 13:96620455-96620477 CTTCACTGTTTCTCGAACCCAGG - Intronic
1112820054 13:103322490-103322512 CTTATCTGTTTGTCCATTTATGG + Intergenic
1113434798 13:110282637-110282659 CATAACTGTGTGTCCTACCCTGG + Intronic
1119687056 14:76641424-76641446 CATATCTCTTTGTCCACGCCAGG + Intergenic
1122402259 14:101474441-101474463 GTTATTTAATTGTCCAACCCTGG - Intergenic
1123705351 15:22947286-22947308 CTTATGTGTTGTTCCAGCCCAGG - Exonic
1124246723 15:28077541-28077563 CTGCTCTGTATGTCCAGCCCTGG - Intronic
1125900954 15:43346601-43346623 CTTATGGCTTTGTCCAAACCTGG + Intronic
1125994166 15:44141358-44141380 TTGATCTGTTTGTCTACCCCTGG - Intronic
1126553233 15:49955628-49955650 CTTATCTGTTTGTCTATTCATGG - Intronic
1130371206 15:83285932-83285954 CTCACCTGTGTGTCCACCCCAGG - Intergenic
1132347760 15:101118770-101118792 CTTATCTGGTTGTCCTTCCTTGG + Intergenic
1133261846 16:4556017-4556039 CTTATCTCTTTGTAAAACCTGGG + Intergenic
1137594403 16:49714264-49714286 ATTATCTGTTTCCCCAACCAGGG + Intronic
1137977665 16:53044665-53044687 CTTACCTGTTTGGGTAACCCTGG - Intergenic
1139214331 16:65112564-65112586 CACTTCTGTTTGCCCAACCCAGG + Intronic
1141006892 16:80360772-80360794 CTTATCTGTTTCTCCATCACTGG + Intergenic
1149129575 17:53281949-53281971 CATATCTGATTGTCCAAACCTGG - Intergenic
1149683519 17:58521640-58521662 CTCATCTGTTTGTCAGATCCGGG - Exonic
1152442745 17:80318944-80318966 CTTACCTGTTTTTGCAAGCCAGG + Intronic
1156490459 18:37492931-37492953 CTTCTCTGTGTGTCCAGCCAAGG + Intronic
1160379355 18:78439724-78439746 CCAATCTGTCTGTCCAACACAGG + Intergenic
1160920326 19:1516536-1516558 ATTATCTGTTTGGCCAAGCATGG - Intergenic
1164078990 19:21846406-21846428 CTTTTCTGTTAGCACAACCCAGG + Intronic
1165351822 19:35279824-35279846 CTTGTGTGTTTGTCCATCTCAGG + Intergenic
1168688369 19:58362191-58362213 CGTATTTGTTTGTCCAGCCTAGG - Intronic
926737329 2:16083418-16083440 CTTGTGTTTTTGTCCTACCCTGG + Intergenic
930891993 2:56400750-56400772 CTTATCTGTATCTCCAATTCTGG + Intergenic
936667072 2:114609290-114609312 TTTATCTCTTTTTCCACCCCTGG - Intronic
939642915 2:144662463-144662485 ATTATCTGTATGTAAAACCCAGG + Intergenic
939720645 2:145646124-145646146 CTTATCTGTTTGTTCTATTCAGG + Intergenic
941487231 2:166097448-166097470 TTTATCTGATTTTCAAACCCTGG - Intronic
944979681 2:205102317-205102339 CTTATCTGTTTCTCTTACACAGG - Intronic
945326100 2:208484590-208484612 CATATCTGTTTTTCCAGACCTGG - Intronic
945378088 2:209103435-209103457 CTTATCTTTTTGTCAATACCAGG + Intergenic
946577943 2:221096630-221096652 CTAAACTGTTTGTCTAACCTGGG + Intergenic
1171330158 20:24330383-24330405 CTTACCTGTTTGTCAAGCCCAGG - Intergenic
1174128192 20:48323896-48323918 CTTAAGTGTTTGTCCATCTCTGG - Intergenic
1181681371 22:24497956-24497978 CTTGTCTGAGTGTGCAACCCTGG + Intronic
950992456 3:17454262-17454284 CTCATCTGATTGTCCAAGCTTGG - Intronic
952610239 3:35199978-35200000 CTTTTGTGTTTGTCCACCCCAGG + Intergenic
953747289 3:45584990-45585012 CTTCTCTGTTTTTCCAAATCTGG + Intronic
955619214 3:60843814-60843836 CTTCTCTTCTTGTCCAACGCAGG + Intronic
956568274 3:70664396-70664418 CCTTTCTGTTTGTCCAAGCTTGG + Intergenic
961018400 3:123484492-123484514 CTTATTTGTTTTGACAACCCTGG + Intergenic
963687390 3:148454237-148454259 CTTTTCTGTTTTTCCCATCCTGG + Intergenic
966166178 3:177018860-177018882 ATTATCTGATTTTCCAACCTGGG - Intergenic
967769497 3:193319112-193319134 CTTACCTGTTTCTTCTACCCTGG - Intronic
969125311 4:4943537-4943559 ATTATCTTTTTATCAAACCCAGG + Intergenic
970645161 4:18111539-18111561 ATGATCTGTTTGTACAAGCCTGG + Intergenic
974218410 4:58931104-58931126 CTTAACTGTCTTTCCATCCCAGG - Intergenic
980510419 4:133779202-133779224 CATCTCTGTTTGTCCCATCCCGG - Intergenic
986780470 5:11060597-11060619 CTTGGCTGTTTATCCACCCCAGG - Intronic
988674403 5:33416942-33416964 CTTATTCGTTTATCTAACCCAGG - Intergenic
991150193 5:63359024-63359046 CATATCAGTTTGTCTGACCCAGG - Intergenic
991446069 5:66701460-66701482 CTTATCTGTATTTCAAGCCCAGG + Intronic
993154380 5:84203993-84204015 TTTACCTGTTTGTCCAACAGGGG + Intronic
993167301 5:84373700-84373722 CTTATGTGTTTTTCCCAACCTGG - Intronic
993569811 5:89523313-89523335 ATTATCTCTTTGTCCATCCTAGG - Intergenic
996155293 5:120091960-120091982 CTTATCTCTTTGTCTAAGTCAGG + Intergenic
996189839 5:120526539-120526561 CTCAACTGTGTGTCCAACCCTGG + Intronic
1000370965 5:160536240-160536262 CTTCTCTGCTAGCCCAACCCGGG - Intergenic
1002864501 6:1108990-1109012 CTTATTTGTTTTTGCAACCCAGG - Intergenic
1004198116 6:13524002-13524024 CTGGTCTGTTTGTCAAACACCGG - Intergenic
1004988148 6:21106271-21106293 CTGATCTGTATGTACAACCAAGG + Intronic
1011773115 6:90696589-90696611 CTTATCTGTTTGTTGTATCCTGG - Intergenic
1014057894 6:117037678-117037700 CTTCTCTGTTTTTCTAAACCAGG + Intergenic
1017619459 6:156280874-156280896 CTTTTGTGTTTGTCCAAGCATGG - Intergenic
1021272809 7:18612546-18612568 CTCATCTTCTTTTCCAACCCTGG - Intronic
1021758013 7:23874435-23874457 CATATCTGTTTGTCATAACCAGG - Intergenic
1031267890 7:119605523-119605545 CTTATCTGTTTCTGAAACACTGG - Intergenic
1032663942 7:134016240-134016262 CATATCTGTTTGTTCACTCCCGG - Intronic
1034549581 7:151811755-151811777 CTTACCTGTAGGTCCAACCTAGG + Intronic
1037981686 8:23258844-23258866 CTTCTCTGTGTGTCCCTCCCTGG - Intronic
1037984937 8:23284517-23284539 CTTAAGTGTCTTTCCAACCCAGG - Intronic
1038545880 8:28425262-28425284 CTGATTTGTTTGTCCCATCCAGG - Intronic
1040867034 8:52058359-52058381 CTTTTCTGCTTTTCCCACCCCGG - Intergenic
1041245927 8:55888433-55888455 CTAATCTTTTTGTCCATCACAGG + Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1042167033 8:65955958-65955980 CTTATCTGACTGTGCAACCATGG + Intergenic
1042611961 8:70609075-70609097 CTTATCGTTTTGCCCAAACCTGG + Intronic
1051398800 9:16657121-16657143 CCCACCTGTTTCTCCAACCCAGG - Intronic
1051558524 9:18412273-18412295 AATATCTGATTGTCCAACACTGG + Intergenic
1052870171 9:33498149-33498171 CTAATATGTTTTTCCAAGCCAGG - Intergenic
1056222187 9:84461060-84461082 CATGTCTCTTTATCCAACCCAGG - Intergenic
1062720930 9:138043637-138043659 CTTAGCTGCTTGCCCATCCCTGG + Intronic
1186961899 X:14745588-14745610 GTTATGTGTTTGTCCAACCAAGG - Intergenic
1193528644 X:82625605-82625627 CTTAACTGGTTGTCCAAGCTAGG - Intergenic
1196972662 X:121126377-121126399 CTTGTCTGTATTTCCAGCCCAGG + Intergenic
1198781404 X:140240266-140240288 CTTGTCTGTTTGCCCTACCTAGG + Intergenic