ID: 1111828305

View in Genome Browser
Species Human (GRCh38)
Location 13:93296282-93296304
Sequence CAGTGGTACTAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111828305_1111828310 22 Left 1111828305 13:93296282-93296304 CCTTCTTCCCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 30
4: 235
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332
1111828305_1111828311 29 Left 1111828305 13:93296282-93296304 CCTTCTTCCCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 30
4: 235
Right 1111828311 13:93296334-93296356 ATTTTCTCTCAGTTGGATTATGG 0: 1
1: 0
2: 2
3: 25
4: 260
1111828305_1111828309 -5 Left 1111828305 13:93296282-93296304 CCTTCTTCCCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 30
4: 235
Right 1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG 0: 1
1: 0
2: 5
3: 62
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111828305 Original CRISPR CAGTGGTACTAGAGGGAAGA AGG (reversed) Intronic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909213008 1:72848119-72848141 AAGTGTTACTAGAGAGGAGAGGG + Intergenic
910530046 1:88225524-88225546 AAATGGTACTAGAGGGATAAAGG - Intergenic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG + Intronic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
922138356 1:222854988-222855010 CAGTACTACTAGTGGGAATAGGG + Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG + Intronic
1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG + Intergenic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071880099 10:89888062-89888084 CTGTGATGCTAGAGGCAAGACGG - Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078474159 11:11616681-11616703 CAGTGGTACTAGAGACAAATAGG - Intronic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1083157815 11:60836117-60836139 AAGAGGTACAACAGGGAAGAGGG - Intergenic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085916884 11:80900833-80900855 CATTTGTCCTAGAAGGAAGAAGG + Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1090937257 11:131354169-131354191 CAGTGTTACGGGAGAGAAGAGGG - Intergenic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1095833549 12:46613063-46613085 CAGGGTTAGTAGAGGGAACATGG - Intergenic
1099228857 12:80000328-80000350 TAGTGGTACTTGATGGAAAAGGG - Intergenic
1100161667 12:91867777-91867799 CAGTGGTTCTAGAATCAAGAAGG - Intergenic
1101089326 12:101268664-101268686 CAGTGGTACTAGAGTGAGTGGGG - Intergenic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1109305059 13:60629434-60629456 CTAGGGTACTAGAAGGAAGATGG - Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1114539520 14:23444295-23444317 TAGGGATACTAGAGGCAAGAGGG - Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1130168892 15:81491513-81491535 CGGTGGTATTAGAGAGAAGGTGG + Intergenic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137715856 16:50597976-50597998 CACTGGCAGTAGAGGGAGGAGGG + Intronic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139154570 16:64424920-64424942 CAATTGTACCAGAAGGAAGAGGG - Intergenic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149772735 17:59333481-59333503 CCATGCTCCTAGAGGGAAGAAGG - Intronic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1153748236 18:8202347-8202369 AAGTGGTGCTAGAAAGAAGAGGG + Intronic
1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG + Intergenic
1154281228 18:13005021-13005043 TTGTGGTACTAGAGGCAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1160774029 19:846597-846619 CTGTGGTCCTAGAGGGGAGTGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1168181771 19:54666603-54666625 CAGTGGCACTAATGGGAACAGGG + Intronic
1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG + Exonic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
925442640 2:3901530-3901552 AAGTGGTACTAGAGGAAAACAGG - Intergenic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933171128 2:79127263-79127285 AAGTGTTACTAGAGGAAAGGAGG - Intergenic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
942828477 2:180209847-180209869 CATTGGTACTATAGTGAAGGTGG + Intergenic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG + Intergenic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1179030401 21:37714975-37714997 CAGAGGTACGTGAGGAAAGACGG - Exonic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1181944351 22:26504380-26504402 CAGTGGAACTAAATGGAAGGGGG - Intronic
1181950602 22:26550931-26550953 GAGTGGTTCAAGAGGGAAAAAGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
954696890 3:52432339-52432361 GAGTGATGCAAGAGGGAAGAAGG + Intergenic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
961026519 3:123563144-123563166 CAGTGGTACTGGTGGGGACATGG + Intronic
964808679 3:160639339-160639361 CATTGGTACTAGATAGAAGCAGG - Intergenic
965814856 3:172625800-172625822 CAATGGCACTTCAGGGAAGAAGG + Intergenic
966325733 3:178751668-178751690 CAAAGGTACAATAGGGAAGAGGG + Intronic
966653623 3:182328176-182328198 CACTGGTCTTAAAGGGAAGATGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968838972 4:2986792-2986814 CAATAGTACTAAAGGAAAGATGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG + Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG + Intergenic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997231288 5:132245220-132245242 CATTGTTACTTGAGGGAATAGGG - Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000748235 5:165062143-165062165 CAGTGGATCTAGAGCGAACAGGG - Intergenic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG + Intergenic
1012226999 6:96716212-96716234 CAGTGGTACTCTGGGGAATAGGG + Intergenic
1012729532 6:102864111-102864133 AAGTACTACTAGAGGGGAGAAGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014627155 6:123740598-123740620 CAGGGGTACAACAGGGAATAGGG - Intergenic
1015284679 6:131472070-131472092 CATTGATACTAGAAGTAAGATGG + Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021736484 7:23643043-23643065 CAATGGTACTAGTGGGAATTTGG + Exonic
1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG + Intergenic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032755132 7:134882962-134882984 GAGTGGTACTATTTGGAAGAAGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG + Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG + Intergenic
1043113301 8:76215821-76215843 CAGCTGTACTCCAGGGAAGATGG - Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1057421634 9:94917654-94917676 CAGTGATACTATAGGGCAGTGGG - Intronic
1057680236 9:97174423-97174445 TATGTGTACTAGAGGGAAGAGGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1060980196 9:127787156-127787178 AAGTTGTACTAGAGCTAAGATGG - Intronic
1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG + Intronic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195252081 X:103058872-103058894 CAGTGCTATTAGAGGAAACATGG - Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG + Intergenic
1202140177 Y:21713463-21713485 CAGTGGTGCTAGAGGAATTAAGG - Intergenic