ID: 1111828309

View in Genome Browser
Species Human (GRCh38)
Location 13:93296300-93296322
Sequence CACTGTCACTGTCTTTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 373}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111828304_1111828309 -2 Left 1111828304 13:93296279-93296301 CCTCCTTCTTCCCTCTAGTACCA 0: 1
1: 0
2: 2
3: 35
4: 322
Right 1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG 0: 1
1: 0
2: 5
3: 62
4: 373
1111828301_1111828309 19 Left 1111828301 13:93296258-93296280 CCTCTGGAATTCCTCTGAAACCC 0: 1
1: 0
2: 2
3: 19
4: 167
Right 1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG 0: 1
1: 0
2: 5
3: 62
4: 373
1111828302_1111828309 8 Left 1111828302 13:93296269-93296291 CCTCTGAAACCCTCCTTCTTCCC 0: 1
1: 0
2: 7
3: 44
4: 544
Right 1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG 0: 1
1: 0
2: 5
3: 62
4: 373
1111828303_1111828309 -1 Left 1111828303 13:93296278-93296300 CCCTCCTTCTTCCCTCTAGTACC 0: 1
1: 0
2: 5
3: 64
4: 648
Right 1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG 0: 1
1: 0
2: 5
3: 62
4: 373
1111828305_1111828309 -5 Left 1111828305 13:93296282-93296304 CCTTCTTCCCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 30
4: 235
Right 1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG 0: 1
1: 0
2: 5
3: 62
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111828309 Original CRISPR CACTGTCACTGTCTTTGTTT AGG Intronic
900730655 1:4257094-4257116 CACTGTGTCTGTCTTTTTTTAGG + Intergenic
902723547 1:18320660-18320682 CTCTCTCACTGTCTGTCTTTTGG - Intronic
904452539 1:30623633-30623655 CAGTCTCACTGTCTTTCTTTAGG + Intergenic
905033137 1:34900860-34900882 CATTGTCATTGTCTTAATTTAGG - Intronic
906929833 1:50158708-50158730 CACTGTGACAGTCTATGATTTGG - Intronic
907843991 1:58187123-58187145 CACCATCACTGACTATGTTTGGG - Intronic
908411747 1:63872934-63872956 CCCTCTCACTGTCCTTCTTTGGG - Intronic
909343118 1:74553860-74553882 CACTGTCAATTTCCTGGTTTTGG - Intergenic
910111668 1:83690079-83690101 CCCTGTGACAGTCTTTATTTTGG - Intergenic
910382317 1:86641511-86641533 CACTGCCACTGCCTTTATTTGGG - Intergenic
910775413 1:90869755-90869777 CACTGCGCCTGGCTTTGTTTGGG + Intergenic
911272891 1:95825194-95825216 TGCTGCCACTGGCTTTGTTTAGG + Intergenic
911300761 1:96170412-96170434 CACTGTCTATGTGCTTGTTTAGG + Intergenic
911340586 1:96632060-96632082 GACTCTGACTGTCTTTGTTCTGG + Intergenic
911775423 1:101804973-101804995 GACTCTCACTGTCTTTCTTTTGG - Intronic
912729677 1:112091124-112091146 CACTGCCACTGCCTTTGCTTAGG + Intergenic
913290329 1:117266144-117266166 CACTGTCTGTGTCATTGTTATGG - Intergenic
913465559 1:119139402-119139424 TACTCTCATTGGCTTTGTTTTGG + Intronic
917233978 1:172870615-172870637 CAATGTCAGTTTCTTAGTTTTGG + Intergenic
917371032 1:174294688-174294710 CACTGCCACTGCCTTTCTTGAGG - Intronic
917600997 1:176573588-176573610 CTCTGTCTCTCTCTCTGTTTTGG + Intronic
918776197 1:188634222-188634244 TACTGTCACTATCTTGGTCTAGG + Intergenic
919654178 1:200181247-200181269 CACTTTCACTGTCTAGTTTTTGG - Intergenic
919663431 1:200269986-200270008 CACTGCCTCTGTCCTTGTTGAGG - Intergenic
920831229 1:209467432-209467454 GATTGCCACTCTCTTTGTTTAGG - Intergenic
921207488 1:212860904-212860926 TAATGCCACTGTCTTGGTTTGGG + Intronic
921220150 1:212967916-212967938 CACTGGCACTGTCTTAGTTCAGG - Intronic
921659721 1:217787156-217787178 TACTATCACTGTCTTAATTTAGG + Intronic
922067595 1:222158918-222158940 GACTTTCACTGTCCTTGCTTTGG - Intergenic
922567204 1:226608543-226608565 CACCGTGATTGGCTTTGTTTGGG + Exonic
923772114 1:236946637-236946659 CACAGACACTGTCCTTGTTCAGG - Intergenic
1064209908 10:13352921-13352943 CAAGGTCACTGTCTTAGTTTGGG + Intergenic
1067157422 10:43793847-43793869 TACAGTCACTGGCTTTGTTTAGG + Intergenic
1067376173 10:45729306-45729328 CACTCACACTGCCTTTGTTGTGG + Intronic
1067883873 10:50069991-50070013 CACTCACACTGCCTTTGTTGTGG + Intronic
1067945891 10:50687678-50687700 CACTGTCCCTGTCCTTGTCTTGG + Intergenic
1068513570 10:57997263-57997285 CACTCTCACGGTCCTTATTTTGG - Intergenic
1068544176 10:58327519-58327541 CACCGTCACTTTCTTTCTTGGGG - Intergenic
1070171998 10:73940053-73940075 CACTTTCAGTAACTTTGTTTTGG + Intergenic
1070399960 10:76044800-76044822 CTATTTCTCTGTCTTTGTTTGGG + Intronic
1070867407 10:79714554-79714576 CACTGTCCCTGTCCTTGTCTTGG + Intronic
1070881199 10:79852678-79852700 CACTGTCCCTGTCCTTGTCTTGG + Intergenic
1071232277 10:83602304-83602326 CAGTCTCTCTGCCTTTGTTTTGG + Intergenic
1071634321 10:87236777-87236799 TACTGTCCCTGTCCTTGTCTTGG + Intronic
1071647772 10:87368994-87369016 CACTGTCCCTGTCCTTGTCTTGG + Intronic
1071843897 10:89502081-89502103 AACTGTCACTGTCTCAGTTAGGG + Intronic
1072061984 10:91822048-91822070 TACTGCCACTGCCTTAGTTTGGG - Intronic
1073751719 10:106536003-106536025 CCCTGTCATTTTCTTTCTTTGGG - Intergenic
1074038924 10:109768923-109768945 CTATGTCACTGTCTTTTTATTGG - Intergenic
1076532195 10:131152448-131152470 CTATATCACTGTCTATGTTTTGG + Intronic
1076577660 10:131480852-131480874 CACTGTCATTTTCCTTGTTTAGG + Intergenic
1076767255 10:132643275-132643297 TACTGCCACTGTCTTTCTCTGGG + Intronic
1077594361 11:3518991-3519013 CACTGTCATTATCTTTGCCTAGG + Intergenic
1078313245 11:10267403-10267425 CACAGTCACTGCCATAGTTTAGG - Intronic
1079485897 11:20935742-20935764 CCCAGACACTGTCTTTGTTCAGG - Intronic
1080681334 11:34479101-34479123 CACTGTCACTATTTTTGTCAAGG + Exonic
1081298656 11:41423710-41423732 CCCTGCCACTGTCTTAGTCTGGG - Intronic
1083460264 11:62806438-62806460 CTCTGTGACTGGCTTTGATTTGG + Intergenic
1084250208 11:67892259-67892281 CACTGTCATTATCTTTGCCTAGG + Intergenic
1084822582 11:71703087-71703109 CACTGTCATTATCTTTGCCTAGG - Intergenic
1085170337 11:74444404-74444426 CACTGACACTATCTCTTTTTTGG + Intergenic
1086076539 11:82859379-82859401 CATTTGCACTGGCTTTGTTTAGG + Intronic
1086212175 11:84333672-84333694 CACTATGGCTGTCTTTTTTTTGG - Intronic
1086670881 11:89546141-89546163 CACTGTCACTGCCTTAGTTCAGG + Intergenic
1087083261 11:94192531-94192553 CCTTGTCAGTGTCTTTCTTTTGG + Intergenic
1087251423 11:95904572-95904594 CTCCGTCACTATCTTGGTTTTGG - Intronic
1087620932 11:100540876-100540898 CACTGCCACTGTATTAGTTCAGG + Intergenic
1088170416 11:106990103-106990125 CACTATCTATGTCTTAGTTTGGG - Intronic
1089070537 11:115696238-115696260 GGCTGTCTCTGTCTTTGTTAAGG + Intergenic
1089331884 11:117695116-117695138 TACTGTCACTGCTTTTCTTTAGG - Intronic
1089595966 11:119580395-119580417 CACTGTGTCTGCCTCTGTTTGGG - Intergenic
1089798151 11:120999974-120999996 CACTGTTGCCATCTTTGTTTAGG + Intergenic
1090200690 11:124853371-124853393 CATTGTGACTGTCTTAGTTCAGG - Intergenic
1090433993 11:126671021-126671043 CACTGTCCCTTTATTTGTGTGGG - Intronic
1091356095 11:134938725-134938747 CACTGTCACTATTATTGTTAAGG - Intergenic
1091647027 12:2281286-2281308 CATTGTTACTATTTTTGTTTAGG + Intronic
1091947997 12:4566123-4566145 CACTGTCAGTGCCTTGGTTGAGG + Intronic
1092420534 12:8327771-8327793 CACTGTCATTATCTTTGCCTAGG + Intergenic
1093701713 12:22229199-22229221 CACTGCCATTGTCTTTGTTCAGG - Intronic
1094250053 12:28349424-28349446 CACTGTCAGTGTCTTTGAGCAGG + Intronic
1095501891 12:42848544-42848566 CACTTCCACTGTCAATGTTTGGG + Intergenic
1095510671 12:42948567-42948589 CACTGTCCTTGTCTTAGTTCAGG + Intergenic
1096366638 12:51033817-51033839 CATGGTCACTGTTTTTGGTTTGG - Intergenic
1097011102 12:55953954-55953976 CACTTTCAATGTATGTGTTTTGG - Exonic
1097012967 12:55966369-55966391 CCCCGACACTGTCTCTGTTTTGG - Intronic
1097875041 12:64635460-64635482 CACTGTCAATGTCTGTGTAAGGG + Intronic
1097989219 12:65817643-65817665 CACTGTCACTGCCTTAGTTAGGG - Intergenic
1098149866 12:67535608-67535630 CTCTGTCACTTCCTTGGTTTGGG - Intergenic
1098308859 12:69128033-69128055 CAATGTCAGTTTCTTAGTTTTGG + Intergenic
1098351793 12:69570309-69570331 GACTGTCACCTTCTTTTTTTAGG + Exonic
1099431901 12:82596496-82596518 CAGTGGCACAGTCTTTGTTCAGG + Intergenic
1101583087 12:106061279-106061301 GACTGTGATTGGCTTTGTTTGGG - Intergenic
1101987508 12:109459025-109459047 CTCTTTTCCTGTCTTTGTTTTGG - Intronic
1102977909 12:117219897-117219919 TACTTTCTCTGTCATTGTTTGGG + Intronic
1103355937 12:120320281-120320303 CACTGTCCCTGGCTTAGTTCTGG + Intergenic
1104153432 12:126107189-126107211 CACTGTCATCCTCTCTGTTTTGG - Intergenic
1106073067 13:26432014-26432036 CACTCTCACTGCCTTTACTTGGG - Intergenic
1106953266 13:34907868-34907890 CACTGCCATGGTCTTGGTTTAGG + Intergenic
1107165157 13:37275214-37275236 CAGTCTGACTGTCTCTGTTTAGG + Intergenic
1108789568 13:53951363-53951385 CATTGTTAATGTCTTGGTTTTGG + Intergenic
1110037953 13:70712724-70712746 CACTTTCACATTCTTTTTTTGGG + Intergenic
1110310025 13:74038132-74038154 CAATGTCAATTTCTTAGTTTTGG + Intronic
1110340072 13:74379429-74379451 CACTATCACGGTCTTATTTTAGG + Intergenic
1111137688 13:84070024-84070046 CATTGTCTCTCTCTTTGTTATGG - Intergenic
1111207663 13:85033936-85033958 CACTGCCTCTGTCTGTGCTTTGG - Intergenic
1111828309 13:93296300-93296322 CACTGTCACTGTCTTTGTTTAGG + Intronic
1112053257 13:95665362-95665384 CAGTGTCATTGTTTTTGCTTAGG + Intergenic
1113328841 13:109309737-109309759 AACTGTGGCTGTCTGTGTTTTGG + Intergenic
1113362228 13:109642149-109642171 CCCTGTCTCTGACTTTGGTTGGG + Intergenic
1113819977 13:113206563-113206585 CAATGTCACTGTATCTCTTTGGG - Intronic
1113877723 13:113605077-113605099 CATCGTCACTGTCTTTTTTAGGG + Intronic
1114629668 14:24151058-24151080 CACTGTCACCATCTTAGTTCAGG + Intronic
1115113949 14:29857205-29857227 CATTGTTATTGTCATTGTTTTGG + Intronic
1115160161 14:30384795-30384817 CAATGTCACTGTCTTAATTCAGG - Intergenic
1115803831 14:37028768-37028790 CTCTGTCACTCTCTTTCATTGGG - Intronic
1116197519 14:41748462-41748484 CACTGTCAGTTGCTATGTTTGGG - Intronic
1116431046 14:44845539-44845561 CACTGCCACCGTCCTAGTTTAGG - Intergenic
1116852104 14:49919012-49919034 TACTGCCACTCTCTTAGTTTAGG + Intergenic
1117495132 14:56295127-56295149 CACTGAGACTGTCTTTGTTGAGG + Intronic
1118559260 14:67061009-67061031 CTCTGTTACTGTTTTAGTTTAGG + Intronic
1119015447 14:71048134-71048156 CACAGTGACTATCTTTGTTTAGG - Intronic
1119472915 14:74910399-74910421 CACTATCAGTGTCTGTGGTTTGG + Intronic
1119482154 14:74964714-74964736 CACGGTCACTGTCTTGATTCAGG - Intergenic
1120058286 14:79951242-79951264 CACTGTAACTGTAATTTTTTGGG - Intergenic
1120394150 14:83946048-83946070 CAGTGTCAATTTGTTTGTTTTGG + Intergenic
1120581570 14:86256746-86256768 TATTGTCACTGTAGTTGTTTAGG - Intergenic
1122095416 14:99366890-99366912 CACTGTAACTTTCTTTTTTCAGG + Intergenic
1122538452 14:102482601-102482623 CTCTGTGTCTGTGTTTGTTTGGG + Intronic
1123762851 15:23446325-23446347 AACTGTCAATGTCTGTGTTAAGG + Intronic
1124563016 15:30792352-30792374 CACTGTCAGTGTCTATGTTAAGG - Intergenic
1124960283 15:34388868-34388890 CACTGTCAATGTCTATGGTAAGG + Intronic
1124976912 15:34535089-34535111 CACTGTCAATGTCTATGGTAAGG + Intronic
1127157465 15:56143133-56143155 CACTGACAAAGTATTTGTTTTGG + Intronic
1128882121 15:71253404-71253426 CATTGTCACTTTTTTTTTTTTGG + Intronic
1129001407 15:72337980-72338002 CACTGCCACCATCTTTGTTTAGG - Intronic
1129108031 15:73322586-73322608 CACCCCCTCTGTCTTTGTTTGGG - Exonic
1129625308 15:77191811-77191833 CACTGCCACTATATTAGTTTGGG - Intronic
1130260173 15:82348519-82348541 CACTGTCAATGTCTATGTTAAGG + Intronic
1130268558 15:82430914-82430936 CACTGTCAATGTCTATGTTAAGG - Intronic
1130281060 15:82520488-82520510 CACTGTCAATGTCTATGTTGAGG - Intergenic
1130472431 15:84236669-84236691 CACTGTCAATGTCTATGTTAAGG - Intronic
1130479922 15:84351240-84351262 CACTGTCAATGTCTATGTTAAGG - Intergenic
1130491848 15:84436889-84436911 CACTGTCAATGTCTATGTTAAGG + Intergenic
1130503462 15:84515929-84515951 CACTGTCAATGTCTATGTTAAGG + Intergenic
1130594728 15:85241305-85241327 CACTGTCAATGTCTATGTTGAGG - Intergenic
1132753245 16:1468769-1468791 CACCGACACTCTCTTGGTTTTGG + Intronic
1133639129 16:7699951-7699973 CATTGTCAGTGTCTTGGTATTGG + Intronic
1134043649 16:11086096-11086118 TACTGTTATTGCCTTTGTTTTGG + Intronic
1135243190 16:20828985-20829007 CACTGCCATTTTCTTTTTTTAGG - Intronic
1135594679 16:23732699-23732721 TACTGTTATTGTTTTTGTTTTGG - Intergenic
1135805771 16:25541201-25541223 TACTGTCACTGCCTTTTTTTAGG - Intergenic
1136184051 16:28574715-28574737 CACCTTCACTTTCTTTGTTATGG + Intronic
1136870138 16:33799501-33799523 TTTTGTCACTGTCTTGGTTTTGG - Intergenic
1137751663 16:50866023-50866045 CACTGACACTTTTTTTTTTTTGG + Intergenic
1137838706 16:51619759-51619781 CGCTGTGACTGTTTTTGTCTTGG - Intergenic
1137985356 16:53102841-53102863 CCCTGTCTCTTTCTTTTTTTGGG + Intronic
1138559011 16:57788894-57788916 CACTGCCACTGTCTTGCTGTGGG - Intronic
1139754771 16:69133107-69133129 CACTGTCACTACCTCAGTTTAGG + Intronic
1139810586 16:69613225-69613247 CACTGCCACTGCCTTGGTTCAGG + Intronic
1140294777 16:73698107-73698129 CAATGTCAATTTCTTAGTTTTGG + Intergenic
1140294885 16:73699182-73699204 CAATGTCAATTTCTTAGTTTTGG + Intergenic
1140498357 16:75410088-75410110 CACTATCAGTTTTTTTGTTTTGG - Intronic
1140690515 16:77478977-77478999 CACTCCCATTGTCTTTGTTTGGG + Intergenic
1141048620 16:80739971-80739993 CAATGTCACTGTCTTTGCTAGGG + Intronic
1141301335 16:82818691-82818713 CACCGTCACTGCCTTTTTTTTGG - Intronic
1203102033 16_KI270728v1_random:1316553-1316575 TTTTGTCACTGTCTTGGTTTTGG + Intergenic
1144323619 17:14155839-14155861 CACTGTCACAGCCCTTGTTCAGG + Intronic
1146609212 17:34289730-34289752 CTCTGTCACTGTGTTACTTTTGG + Intergenic
1146949670 17:36897173-36897195 CTCTGTGTCTGTCTTTGTGTTGG + Intergenic
1147195196 17:38761844-38761866 CACTGCCACTGTCTTTGCTCAGG - Intronic
1148221003 17:45861875-45861897 CAGTGTTAATTTCTTTGTTTTGG + Intergenic
1148374414 17:47129458-47129480 CAATGACAATGGCTTTGTTTAGG + Exonic
1148608419 17:48947380-48947402 TATTGCCACTGTCTTTGTTCTGG - Intergenic
1149345853 17:55734567-55734589 CACTGTCAGTATATGTGTTTAGG - Intergenic
1150842158 17:68618784-68618806 CACTTTCAGAGTCTTTGTTCAGG + Intergenic
1150975181 17:70077919-70077941 AAATGTAACTGTCTTTGTATAGG - Intronic
1151011678 17:70505536-70505558 CTCTGTCACTGTTTTTGCATGGG - Intergenic
1153367796 18:4277780-4277802 CACTGTCACTTTATGTATTTTGG + Intronic
1153740706 18:8124363-8124385 CAGTGACACTGTCTTTTTTAAGG + Intronic
1153889849 18:9502816-9502838 CACTGTTACTCTGTTTTTTTTGG - Intronic
1155754892 18:29479996-29480018 CACTGTCACTGTTTTCTTTAAGG - Intergenic
1156475494 18:37403086-37403108 CACTCTCACTGTCTCAGATTAGG - Intronic
1156632298 18:38984739-38984761 CAATGTCAGTCTCTTTGCTTAGG - Intergenic
1158112831 18:53960729-53960751 CATTCTCACTGTCTGTGCTTGGG - Intergenic
1158122411 18:54063122-54063144 CACTGCCACTGCCCTTGTTGTGG + Intergenic
1158389181 18:57029985-57030007 CACTGGCACTCTCTGTGGTTTGG + Exonic
1158506732 18:58053098-58053120 ACCTGTCACTTTGTTTGTTTGGG + Intronic
1159461371 18:68725584-68725606 CACTGTCACTGGCTTTGAAGTGG - Intronic
1159986063 18:74842273-74842295 CAATTTCACTTTCTTTGTGTTGG + Intronic
1163281642 19:16322003-16322025 CTCTCTCACTGTCTCTGTTTGGG - Intergenic
1164805223 19:31111123-31111145 CACTCTCTCTCTCTTTCTTTTGG + Intergenic
1165464731 19:35967068-35967090 CACAGATACTGTCTTGGTTTTGG - Intergenic
1165478661 19:36048036-36048058 CACTTTCACTGGCATTCTTTTGG - Intronic
1166589089 19:43980231-43980253 CACTGTTACTTTATTTGTATAGG + Intronic
1167079712 19:47270780-47270802 GTCTGTCCCTGTCTTTGTCTTGG + Intronic
1168435850 19:56316209-56316231 CAGTGCCACTGACTTTGCTTGGG + Intronic
925519927 2:4732592-4732614 CACTTTGACTGTCTTTTTTTAGG - Intergenic
926627678 2:15106691-15106713 ATGTGTCACTGTCTTAGTTTAGG + Intergenic
927844725 2:26465476-26465498 CACTGTCCCTCTCCTTGTTTTGG + Intronic
929245180 2:39694247-39694269 AACTGTCATTGTCTATGTATTGG + Intronic
930485165 2:52002299-52002321 TACTGTCACTGTCCTGATTTTGG - Intergenic
930723822 2:54663667-54663689 CCCTGGTTCTGTCTTTGTTTGGG + Intronic
930970722 2:57392256-57392278 CACTTTCACCATTTTTGTTTGGG + Intergenic
931055621 2:58466982-58467004 CAGTTTCACTTTCTTTGTTGTGG + Intergenic
931416239 2:62083832-62083854 TTCTGTCACTCCCTTTGTTTTGG - Intronic
931656576 2:64514428-64514450 CTCTGTCCCAGACTTTGTTTTGG - Intergenic
933184810 2:79267306-79267328 CTCTGCCAGTGTCTTTATTTTGG - Intronic
937232621 2:120406963-120406985 CCCTCTCACTCTCTGTGTTTAGG - Intergenic
937420540 2:121751263-121751285 CACTGTGCCTGGCCTTGTTTTGG - Intronic
937440906 2:121915015-121915037 CACTTTTACCGTCTTTCTTTGGG - Intergenic
939365509 2:141225297-141225319 CACTTTCATTGTCTTTTTATGGG - Intronic
939730434 2:145777998-145778020 CAGTGCCATTGTCTTTATTTGGG - Intergenic
940212551 2:151270296-151270318 GAATGTAACTGCCTTTGTTTTGG + Intergenic
941722902 2:168831050-168831072 TACTGTGACTGTCTTAGTTCAGG + Intronic
941941470 2:171043040-171043062 CACGGTCACTGTCTTAGTGTAGG - Intronic
943041130 2:182806896-182806918 CACTGATACTGTCTTTATTCAGG + Intergenic
943099430 2:183470832-183470854 CACCATCACTGTGATTGTTTTGG + Intergenic
943810829 2:192187175-192187197 CTCTTTCACTGTCTTGGTGTAGG + Intronic
945114056 2:206393637-206393659 CACTCTCTCTCTCTTTTTTTTGG - Intergenic
946528643 2:220547520-220547542 CACTGCCACTGTCTCAGCTTTGG + Intergenic
947113756 2:226747591-226747613 CAGAGTCTCTGTCTTAGTTTGGG - Intronic
947331353 2:229032790-229032812 CACTGCAAATGTCTGTGTTTGGG - Intronic
947581831 2:231324785-231324807 CACTGTACCTGTCTTCATTTTGG - Intronic
947755012 2:232555983-232556005 CACTGTCACTACTTTAGTTTAGG - Intronic
1168913953 20:1471329-1471351 CAGTGAAACTGTCTCTGTTTGGG + Intronic
1170463686 20:16602870-16602892 CACTCTCACTGTTTTTCTTTAGG + Intergenic
1170516756 20:17138020-17138042 CACTGAAACAGTCATTGTTTTGG + Intergenic
1171073748 20:22101943-22101965 CTCTGTCTCTGTCTTTATCTTGG - Intergenic
1171231944 20:23493786-23493808 CACTGTCCCTGTCTTTACATTGG + Intronic
1171289184 20:23970881-23970903 CACTTTCACAGTCTTTATGTGGG + Intergenic
1172662821 20:36579061-36579083 CACTTTCACTGTCTGGGCTTCGG + Intronic
1175001602 20:55635100-55635122 CAATGTCACTCACTTTGATTGGG + Intergenic
1175277600 20:57782829-57782851 CACTCTCACTGTCTTTTCTGAGG + Intergenic
1175572007 20:60030594-60030616 CACTCTCACTGGCTCAGTTTGGG - Intronic
1177563553 21:22788085-22788107 CTCTCTCTCTGTCTTCGTTTTGG - Intergenic
1177640354 21:23836775-23836797 TACTGTCACTTTCTTTGTCCTGG + Intergenic
1179127981 21:38609020-38609042 CATTGTCAGTGTCTTTCTTGGGG + Intronic
1179944388 21:44661325-44661347 CACTGTCACTATTTTTGCTCTGG - Intronic
1181597771 22:23928306-23928328 CACACTCCCTGTTTTTGTTTTGG - Intergenic
1181806315 22:25376473-25376495 CACTGTCACAGACTGGGTTTGGG - Intronic
1183479263 22:38054065-38054087 CACTGCCACTGTCCCTGTTGAGG + Intergenic
950676139 3:14555431-14555453 CACTGTCACTGTCTCTCCCTGGG - Intergenic
951402141 3:22245975-22245997 CACTGTCACTGAGATTGGTTGGG - Intronic
951574764 3:24102250-24102272 CACTGGCACTATCATTGTTTGGG + Intergenic
952650637 3:35723004-35723026 CCCTGACACTCTCTTGGTTTGGG + Intronic
952815413 3:37442976-37442998 CCCTGTCACTGGATTTGATTCGG + Intergenic
952974248 3:38680718-38680740 CCCACTCACTGTCCTTGTTTTGG - Intergenic
953218121 3:40940265-40940287 CAATGTCACTTTCCTGGTTTTGG - Intergenic
953552913 3:43918234-43918256 CACTGGAACTTTCTTTGTATTGG + Intergenic
954173085 3:48821055-48821077 TACTGTTACAGTCTGTGTTTAGG - Intronic
955884051 3:63578683-63578705 CACTGTCTTTCTCTTTGGTTAGG - Intronic
956342336 3:68239545-68239567 CATGGTGACTGTTTTTGTTTGGG - Intronic
958724311 3:97885929-97885951 CACTGTCACAGCCCTTGGTTAGG - Intronic
959340971 3:105130513-105130535 GACTGTCAAAGTCTTTTTTTAGG + Intergenic
960884489 3:122380864-122380886 TACTGCCAGTGGCTTTGTTTAGG - Intronic
961195425 3:124997594-124997616 CTCTCTCTCTGTCTTTGCTTAGG - Intronic
962036967 3:131662271-131662293 CAAATTCACTGTCTTTGCTTTGG - Intronic
963852159 3:150219798-150219820 CACCATCACTGACTTTGTATCGG - Intergenic
963922781 3:150922038-150922060 CATTCTCTCTCTCTTTGTTTAGG + Intronic
964078863 3:152726627-152726649 CACTTTGGGTGTCTTTGTTTGGG + Intergenic
964448465 3:156785815-156785837 CAGTGCTACTGCCTTTGTTTTGG + Intergenic
965294456 3:166925727-166925749 CACTGTAACAGTCTCTGTGTAGG + Intergenic
966058623 3:175728295-175728317 GACTGTCACTGTCTTTCATTTGG - Intronic
966403023 3:179565841-179565863 TACTGTAACTGTCATTATTTTGG - Intronic
967290967 3:187919986-187920008 CTCTGTCACTGTCACTGCTTAGG - Intergenic
967302723 3:188031577-188031599 CACTGTCATTGTTTCTGTTTTGG - Intergenic
967808691 3:193737076-193737098 TACTGTCCCTCTCTTTCTTTTGG + Intergenic
968273501 3:197422813-197422835 CACTGTTACTTTTTTTTTTTTGG + Intergenic
969008395 4:4040441-4040463 CACTGTCATTATCTTTGCCTAGG + Intergenic
969745281 4:9065942-9065964 CACTGTCATTATCTTTGCGTAGG - Intergenic
970096520 4:12469451-12469473 CACTGTCATTCCCTTTGTATAGG + Intergenic
970187759 4:13480059-13480081 TATTGTCACAGTCTTTCTTTAGG - Intronic
972613492 4:40676483-40676505 CATTCTCACTGTCTTTTTTTGGG + Intergenic
972723150 4:41721006-41721028 CCCTGTCACTGTGGTTGTTGAGG - Intergenic
973555207 4:52075370-52075392 CAATGGAACTGTTTTTGTTTTGG + Intronic
973686129 4:53371599-53371621 CACAGAGACTGTCTTAGTTTGGG + Intergenic
974435293 4:61849228-61849250 CAATGTCACTTTCTTTTATTAGG + Intronic
974581358 4:63806862-63806884 TACTGTTACTGTTTTTATTTTGG - Intergenic
975258903 4:72273012-72273034 CCCTCTCTCTTTCTTTGTTTCGG + Intergenic
977313133 4:95411857-95411879 CACTGCTACTGTCTTCGTTAAGG + Intronic
977319344 4:95491880-95491902 CGCTGTCACTGACATTGTTTGGG + Intronic
977907302 4:102492779-102492801 CATGGTCACTGTCTTTATTATGG + Intergenic
978250828 4:106629746-106629768 CACTGTGACTGTTTTTGCCTGGG + Intergenic
978927400 4:114264587-114264609 CACAGTATCTGTTTTTGTTTTGG - Intergenic
979523000 4:121689849-121689871 TTCTGTCCCTGCCTTTGTTTAGG - Intronic
980700392 4:136420145-136420167 CACTGTCACTGACTTTTTTACGG - Intergenic
982793815 4:159622103-159622125 CACTGCCACTGTCTTTGTTCAGG + Intergenic
982881934 4:160730881-160730903 CACTTTCAATGTATTTATTTTGG - Intergenic
983532056 4:168820975-168820997 CAATGTCTCTGTATTTCTTTGGG + Intronic
984286390 4:177734951-177734973 AACTGTCAATTTCTTTGATTTGG + Intronic
984871871 4:184332822-184332844 CACTGAGACTGTCTTTGTCAAGG - Intergenic
985147109 4:186904852-186904874 CACTGCCTCTGTCTTGTTTTCGG + Intergenic
985788862 5:1914768-1914790 CAATGTCACAGACCTTGTTTGGG + Intergenic
986124708 5:4874375-4874397 CAGTGTGACTTCCTTTGTTTGGG + Intergenic
987014334 5:13801795-13801817 CCTTCTCACTGTCTTTGTTCTGG + Intronic
987721908 5:21646823-21646845 CTTTGTCATTGTTTTTGTTTGGG + Intergenic
987844791 5:23269296-23269318 CACTGCCAATGTCTTGATTTTGG + Intergenic
989181571 5:38582749-38582771 CACTGGCACTGTCTTAGTTTCGG + Intronic
990312510 5:54553309-54553331 CACTGCCAGTGTCTTGGTGTGGG - Intergenic
990540643 5:56769572-56769594 GACAGTCACTACCTTTGTTTAGG + Intergenic
991453166 5:66774257-66774279 CACTGTTTCTGTCTTGGTCTTGG + Intronic
991689425 5:69212243-69212265 AACAGTCACAGTCTTGGTTTTGG + Intergenic
993169677 5:84402131-84402153 CACTTTCAGTGTGCTTGTTTTGG - Intergenic
993228124 5:85195754-85195776 CAATGTTACTGTATTTATTTTGG - Intergenic
993348867 5:86821483-86821505 CACTGCCAGTTTCTTGGTTTGGG + Intergenic
993415236 5:87620273-87620295 AACTGTGATTATCTTTGTTTGGG + Intergenic
993816118 5:92547605-92547627 CATTCTCAATATCTTTGTTTTGG - Intergenic
994336406 5:98571573-98571595 CACTGTCACTGTCCTAACTTGGG + Intergenic
994785825 5:104161352-104161374 GACTGTCAATATTTTTGTTTGGG - Intergenic
995165287 5:109032522-109032544 GACTGTCCCTGTCTTAGTTTGGG - Intronic
995551119 5:113282521-113282543 CTCTGTCTCTGTCTCTCTTTTGG - Intronic
997480959 5:134184252-134184274 CCCTGTCACTGCCTTAGCTTGGG - Intronic
998520075 5:142792366-142792388 GACTGTCTCTGTCTTTCTCTTGG + Intronic
1002774615 6:318247-318269 GACTGTCACTGTCTGTGTCTTGG - Intronic
1003442736 6:6158842-6158864 CACTGTCATGTACTTTGTTTGGG + Intronic
1004161380 6:13216648-13216670 CACTGTCAATCTCTTACTTTAGG + Intronic
1004463730 6:15863352-15863374 CAGTGTGACTGCCTTTGATTGGG + Intergenic
1004596392 6:17103533-17103555 AACTGCCACTGTCTCTGTATAGG + Intronic
1005475627 6:26204874-26204896 CGCTGTCACTGTCTTGCGTTTGG - Exonic
1007313298 6:40963783-40963805 CACACTGACTGTCTTAGTTTGGG + Intergenic
1008438228 6:51501297-51501319 TACTGCCACTGTTTTAGTTTCGG - Intergenic
1008747009 6:54684294-54684316 CCCTTTTACTCTCTTTGTTTTGG + Intergenic
1009268945 6:61593726-61593748 TACAGACACTGTCTTTGGTTTGG - Intergenic
1009295013 6:61935529-61935551 AACTGTGACTGTAATTGTTTGGG - Intronic
1011165294 6:84439722-84439744 CACTGTTACTGCTTTAGTTTTGG + Intergenic
1011263890 6:85496214-85496236 CACGTTAGCTGTCTTTGTTTGGG + Intergenic
1011401989 6:86973280-86973302 CACAGCCACTGCCTTTGTTCTGG - Intronic
1012000758 6:93651893-93651915 CAATGTTACTTTCTTTTTTTTGG + Intergenic
1012288851 6:97425841-97425863 CACTGTCTCTGCCCTAGTTTAGG + Intergenic
1012695575 6:102378091-102378113 CACTGTCATTCTTTTTTTTTTGG + Intergenic
1013959552 6:115882740-115882762 CTCTGTCAGCCTCTTTGTTTTGG - Intergenic
1014011489 6:116481222-116481244 CACTGCCACTGCTTTAGTTTTGG - Intergenic
1014581902 6:123147960-123147982 TACTGTGATTCTCTTTGTTTTGG - Intergenic
1014754859 6:125291831-125291853 CACTGTCATTTTCTGTGGTTTGG - Intronic
1015461667 6:133498768-133498790 ATATGTCACTGTCTTTGATTTGG - Intronic
1015479849 6:133696587-133696609 TAATGACACTTTCTTTGTTTAGG - Intergenic
1015911248 6:138169499-138169521 CACTGTCACTGCCTTTCCTTGGG + Intronic
1016427971 6:143954406-143954428 CACTGCCACTGCCTTTTTGTTGG - Intronic
1016437809 6:144055824-144055846 CACAGCCACTGTCTTTCTTTGGG + Intronic
1017084962 6:150705398-150705420 CTCTGACACTGTCTTTGTCATGG + Intronic
1017556986 6:155582399-155582421 AAATTTCACTTTCTTTGTTTTGG - Intergenic
1017567027 6:155698378-155698400 CTCTGTTAATGACTTTGTTTAGG + Intergenic
1017840376 6:158217259-158217281 TATTGTCACTGTATGTGTTTAGG + Intergenic
1017966831 6:159274285-159274307 CATTGTTTTTGTCTTTGTTTTGG - Intergenic
1019182495 6:170199585-170199607 CACTGTCACCATCTTTGTCTGGG - Intergenic
1019317511 7:395518-395540 CACTGGCACTCTTTGTGTTTTGG + Intergenic
1020089659 7:5332051-5332073 CACTATCACTGTCTTCCTTTGGG + Intronic
1020328862 7:6998230-6998252 CACTGTCATTATCTTTGCCTAGG + Intergenic
1020607754 7:10359934-10359956 CACTGTCACTGCCTGTTTTGTGG - Intergenic
1021050880 7:15982673-15982695 TACTGTCACGGCCTTAGTTTAGG + Intergenic
1021163660 7:17306829-17306851 CACTGTCACTGCCTTTGGTCAGG + Intronic
1021546656 7:21820998-21821020 CACTGTCACTGCCTAAGTTTAGG - Intronic
1021943741 7:25704967-25704989 CACTGTCATTTTCCTTATTTAGG - Intergenic
1022452130 7:30525386-30525408 CACTGTCAATGTCTATGTTAAGG + Intronic
1023212706 7:37825150-37825172 CACAGTCTCTGCCTTAGTTTAGG + Intronic
1024410123 7:49030806-49030828 CACTTTCACTGTCTTACTTCGGG - Intergenic
1024941202 7:54765001-54765023 CTCTGTCAATGGCTTTGTCTTGG - Intergenic
1026899521 7:74029168-74029190 GACTGTCACTGTGTGTGTTATGG + Intronic
1027770854 7:82404197-82404219 CTCTTTCCCTGTCTTTCTTTTGG - Intronic
1028004400 7:85544894-85544916 CACAGTCTCTGTCTTTTATTTGG + Intergenic
1028479851 7:91292795-91292817 CACTGTCACTGCCCTAGTTCAGG + Intergenic
1030312968 7:108086408-108086430 CAGTGTCACTGTCTTAGATTGGG - Intronic
1030934878 7:115573144-115573166 CACTATTACTCTCTTTGTCTCGG + Intergenic
1031914433 7:127549652-127549674 CAGGGTCCCTGTCTTAGTTTAGG + Intergenic
1032425302 7:131817996-131818018 GACTGTTACTGTCCTTGTTGAGG - Intergenic
1033079699 7:138283855-138283877 CACTGTGCCTGGCCTTGTTTGGG - Intergenic
1033873826 7:145789906-145789928 CTCTGTCACTGTCTTTTAATTGG + Intergenic
1035246976 7:157569020-157569042 AACTGTCACTAGCTTTGTTGTGG - Intronic
1036249684 8:7151123-7151145 CACTGTCATTATCTTTGCCTAGG + Intergenic
1036367769 8:8135924-8135946 CACTGTCATTATCTTTGCCTAGG - Intergenic
1036460133 8:8945241-8945263 TTTTGTCACTGTCTTGGTTTTGG - Intergenic
1036617846 8:10402662-10402684 TACTGTGACTGTCTCTGTGTCGG - Intronic
1036662799 8:10718715-10718737 CACTGTCAGTTTCCTTCTTTGGG - Intergenic
1036883112 8:12529737-12529759 CACTGTCATTATCTTTGCCTAGG + Intergenic
1036925030 8:12896184-12896206 CACTGCCAATGTCTTTGTGATGG - Intergenic
1037701158 8:21274868-21274890 CACTGTCACTGTCTTGGTTCAGG + Intergenic
1038920667 8:32080448-32080470 GACTGTCACTGTCTGAGCTTAGG - Intronic
1039552093 8:38450675-38450697 CCCTGACAGAGTCTTTGTTTGGG + Intronic
1039567995 8:38564780-38564802 CACCGTCACTCCCTTTGGTTTGG + Intergenic
1040910819 8:52516825-52516847 TACTCTTACTGTCATTGTTTTGG + Intergenic
1041545097 8:59033890-59033912 TACTGTCAGTGTCTATGTTGAGG - Intronic
1041662227 8:60411594-60411616 CTCTGTCTCAGTCTCTGTTTTGG - Intergenic
1042035179 8:64525354-64525376 CATTTTCTCTCTCTTTGTTTTGG + Intergenic
1042290184 8:67162728-67162750 TGGTGTCACTGCCTTTGTTTGGG - Intronic
1042611057 8:70601710-70601732 CACAGTCACTGTCTTAGTTCAGG - Intronic
1043004119 8:74796842-74796864 TTTTGTCACTGTCTTGGTTTTGG + Intronic
1043148598 8:76684164-76684186 CTCTGTGACTGACTGTGTTTTGG + Intronic
1043567474 8:81563230-81563252 CACTGTAGCTGTATCTGTTTAGG - Intergenic
1044583352 8:93844502-93844524 CACTGTCACTGCCTTGGCGTAGG - Intergenic
1045372429 8:101538094-101538116 CACTGTCCTAGTTTTTGTTTTGG + Intronic
1045961546 8:107974516-107974538 CTCTGTCTCTTTCTTTCTTTTGG - Intronic
1046308035 8:112396714-112396736 CATTGTCACTATATTGGTTTTGG - Intronic
1047149346 8:122242926-122242948 CAATATCACTGTCTGTATTTTGG - Intergenic
1047710246 8:127544363-127544385 CATTCTCATTGACTTTGTTTAGG - Intergenic
1047756570 8:127923509-127923531 TGCTGTCACTGCCTTGGTTTGGG + Intergenic
1048226546 8:132592745-132592767 TATTGCCACTGTCTTTGTCTTGG - Intronic
1048956223 8:139538668-139538690 GATTGTCCTTGTCTTTGTTTTGG + Intergenic
1049466910 8:142755579-142755601 CTGTGTCACTGTTTCTGTTTTGG + Intergenic
1050327817 9:4514863-4514885 CTCTGACACTGTCTTGGTTCAGG - Intronic
1052493230 9:29193195-29193217 CATTACCACTGCCTTTGTTTAGG + Intergenic
1052744030 9:32422099-32422121 CACTATCCCTCTCTTTCTTTAGG - Intronic
1055771947 9:79726900-79726922 CACTGTTGCTGTTTTTGTTTTGG + Intergenic
1056086339 9:83153267-83153289 CACTCTCCCTCTCTTAGTTTAGG + Intergenic
1056956904 9:91089912-91089934 TACTGCCACTTTATTTGTTTAGG - Intergenic
1057353048 9:94316366-94316388 CACTGTCCCTGTCCTTGTTTTGG - Intergenic
1057654698 9:96941225-96941247 CACTGTCCCTGTCCTTGTTTTGG + Intronic
1057713903 9:97472977-97472999 CACTGTGAATGTCTTTATTATGG + Intronic
1058002402 9:99879530-99879552 CACTGTCACTTTCCTAGTTGAGG - Intergenic
1058759330 9:108115319-108115341 CACTGTCTCTGTGTATGATTAGG + Intergenic
1058994018 9:110281982-110282004 CCTTGTCTCTGTCTTTGATTGGG - Intergenic
1059181567 9:112218241-112218263 AACTGTCTCTGTCTTCATTTAGG - Exonic
1059546617 9:115182380-115182402 CACTCTCACCATCTTGGTTTTGG - Intronic
1060067840 9:120519222-120519244 CACAGTAACTGTCTTTAGTTGGG + Intronic
1061065411 9:128275147-128275169 CACTGTCAATGTCTATGTTAAGG + Intronic
1062130513 9:134890173-134890195 TTTTGTCACTGTCTTGGTTTTGG - Intergenic
1185842993 X:3410607-3410629 ACTTGCCACTGTCTTTGTTTTGG - Intergenic
1185859767 X:3566703-3566725 TCTTGTCACTGTCTTGGTTTTGG + Intergenic
1187993673 X:24902830-24902852 CTATGTCATTGTTTTTGTTTAGG - Intronic
1189089226 X:38061855-38061877 CATTATGACTGTCTTTGTGTTGG - Intronic
1191098053 X:56695462-56695484 CATTATCACTGTCTTTGTTAAGG - Intergenic
1193075045 X:77346735-77346757 CACTGTCACTATCCTAGTCTAGG - Intergenic
1194076580 X:89401175-89401197 CACTGTCATTTTCCTTGTTTAGG - Intergenic
1194314642 X:92361175-92361197 TCCTTTCACTGTCTTTATTTTGG + Intronic
1194725158 X:97387264-97387286 CACTGTCACTGTATTAGTTCAGG - Intronic
1194749998 X:97673475-97673497 CACTGTCAGAGTCTTTTATTCGG - Intergenic
1194771284 X:97908984-97909006 CACTGCCACTATCTTGGTTCAGG - Intergenic
1194880600 X:99246644-99246666 TACTGTCAATTTCTTTCTTTAGG - Intergenic
1195515896 X:105775406-105775428 CTCTGTCACTGTCTTTGGCAAGG + Intergenic
1195919934 X:109973843-109973865 CACTGACACTGTGTGTGTATCGG + Intergenic
1195937241 X:110137485-110137507 CGCTGTGTCTGCCTTTGTTTAGG + Intronic
1195949402 X:110251652-110251674 CACTGCCACTGCCTTTGTCTGGG - Intronic
1196696130 X:118614122-118614144 CACTGTCATTGTCCTAGTTAAGG - Intronic
1196698911 X:118644979-118645001 CACTGTCACTGCCTTACTTCAGG - Intronic
1198370395 X:135983993-135984015 CACAGTCACTGGCTCTGATTTGG + Intergenic
1198578190 X:138034254-138034276 GATTGTCACTGTCTTAATTTTGG + Intergenic
1199157422 X:144566958-144566980 CAGGGTCACTGACTTTGCTTAGG + Intergenic
1199855858 X:151758376-151758398 CATTGTAACTGTCTCTGTCTGGG + Intergenic
1199879367 X:151961029-151961051 CACTGGCACTACCTTGGTTTAGG - Intronic
1200429221 Y:3056695-3056717 CACTGTCATTTTCCTTGTTTAGG - Intergenic
1200622697 Y:5472693-5472715 TCCTTTCACTGTCTTTATTTTGG + Intronic
1201232198 Y:11875968-11875990 ACTTGCCACTGTCTTTGTTTTGG + Intergenic