ID: 1111828310

View in Genome Browser
Species Human (GRCh38)
Location 13:93296327-93296349
Sequence CATCTTCATTTTCTCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 332}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111828306_1111828310 15 Left 1111828306 13:93296289-93296311 CCCTCTAGTACCACTGTCACTGT 0: 1
1: 0
2: 3
3: 12
4: 157
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332
1111828308_1111828310 5 Left 1111828308 13:93296299-93296321 CCACTGTCACTGTCTTTGTTTAG 0: 1
1: 0
2: 3
3: 49
4: 382
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332
1111828304_1111828310 25 Left 1111828304 13:93296279-93296301 CCTCCTTCTTCCCTCTAGTACCA 0: 1
1: 0
2: 2
3: 35
4: 322
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332
1111828307_1111828310 14 Left 1111828307 13:93296290-93296312 CCTCTAGTACCACTGTCACTGTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332
1111828305_1111828310 22 Left 1111828305 13:93296282-93296304 CCTTCTTCCCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 30
4: 235
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332
1111828303_1111828310 26 Left 1111828303 13:93296278-93296300 CCCTCCTTCTTCCCTCTAGTACC 0: 1
1: 0
2: 5
3: 64
4: 648
Right 1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG 0: 1
1: 0
2: 3
3: 33
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111828310 Original CRISPR CATCTTCATTTTCTCTCAGT TGG Intronic
900983118 1:6057802-6057824 CATGGCCATTTTCTCTCTGTGGG + Intronic
901234236 1:7659046-7659068 CATCTTCACTTATTCTCAGGGGG - Intronic
901296743 1:8166611-8166633 CTTTTTCCTTTTCTCTCACTTGG - Intergenic
903318216 1:22525554-22525576 CAGACTCATTCTCTCTCAGTTGG + Intronic
908715355 1:67063983-67064005 CATATTAATTGTCTCTCAGCTGG - Intergenic
908883223 1:68757377-68757399 CATCTTGAGTTTCTCACAGTTGG - Intergenic
909120646 1:71599248-71599270 CAGATACATTTCCTCTCAGTTGG + Intronic
910231517 1:84992340-84992362 CATATTCCTTTTCCCTCAGCTGG - Intronic
910246800 1:85147539-85147561 CATCTTCTTATTCTCTCAACAGG + Intergenic
911131985 1:94398287-94398309 TAACTTCATTTTCTGACAGTGGG + Intergenic
913072873 1:115316940-115316962 AATATTCATTATCTCTGAGTAGG - Intronic
913565019 1:120064705-120064727 CATCTTTAGTTTTTGTCAGTAGG + Intronic
914245075 1:145879468-145879490 GATGTTCCTTTTCTCTCATTTGG - Intronic
914332540 1:146685646-146685668 GAAATCCATTTTCTCTCAGTGGG + Intergenic
916086470 1:161273684-161273706 CATCTTAATGTTTGCTCAGTGGG - Intronic
916728809 1:167548121-167548143 GATCTTCATTTTCTCTCTATAGG - Exonic
917555144 1:176077976-176077998 CATCTTCGATTTCTTTCAGCAGG - Intronic
918384992 1:183996746-183996768 GACCTTCAGTTTCTGTCAGTAGG - Intronic
918735860 1:188062534-188062556 CATCTCCAATTTCTTTGAGTAGG + Intergenic
918954493 1:191187953-191187975 CATCTTCATTTATTCTCCTTAGG + Intergenic
923713239 1:236403740-236403762 CACCCTCATTTTCTTTCTGTGGG - Intronic
923829653 1:237541215-237541237 GTTCTTCATTTTCTCTGATTGGG + Intronic
923854958 1:237836592-237836614 CATCTTCATTTTGTGTAGGTGGG - Intergenic
924298028 1:242608495-242608517 CATTTTCCTTTTCTGTCATTGGG + Intergenic
1064507377 10:16047838-16047860 CATCTTCCTCTTCTCTAAGATGG + Intergenic
1065144191 10:22751320-22751342 CCTCTTCATTGTCTCCCATTAGG - Intergenic
1066797619 10:39140464-39140486 CATATTCAGTTTTTCTCATTAGG - Intergenic
1068189419 10:53631065-53631087 CATATTCTTTTTCACTTAGTAGG + Intergenic
1069285023 10:66703107-66703129 CACCATCTTTTTTTCTCAGTTGG + Intronic
1069467848 10:68657628-68657650 CAACTTTCTTTTCTCTCTGTAGG - Intronic
1070438832 10:76422366-76422388 CATTTTTAGTTTTTCTCAGTGGG + Intronic
1070502561 10:77085194-77085216 CATCTTCATTTTCTATAGGCTGG + Intronic
1072238219 10:93471551-93471573 CATCTTCATTTTCCCTATGAGGG - Intronic
1072853026 10:98916939-98916961 CAGCCTCATTTCCTCCCAGTAGG - Intronic
1073987954 10:109230598-109230620 CATATTCTTTTTCTCTAATTTGG - Intergenic
1074763055 10:116681885-116681907 CGTCATCATTTTCTTTCTGTCGG - Intronic
1075164211 10:120052377-120052399 CTTGTTCATTTTCTCAAAGTGGG + Intergenic
1075628387 10:123982455-123982477 CATCTTTGATTTCTTTCAGTAGG - Intergenic
1076113365 10:127878220-127878242 CATCATCATTTTCTACCAGAAGG - Exonic
1076398957 10:130165687-130165709 AATCTTCACTATCTCTAAGTAGG - Intronic
1077642228 11:3892091-3892113 CTTCTTGATTTTCTAGCAGTGGG + Intronic
1078275579 11:9842121-9842143 CAGCTACAATATCTCTCAGTGGG - Intronic
1078343822 11:10525073-10525095 AATCTTTTTTTTTTCTCAGTTGG - Intronic
1078585514 11:12583736-12583758 TATCTTCATTATCTCACAGCTGG + Intergenic
1079340200 11:19605354-19605376 CATCTTCCTTTACTCTCCTTGGG - Intronic
1080119691 11:28663016-28663038 CATTCTCATCTTCTCTCATTGGG + Intergenic
1080343663 11:31297141-31297163 CGTCTTCAGTTTCTCTGTGTTGG - Intronic
1081302184 11:41466359-41466381 CATCTCCATTATTTCTCAATTGG + Intergenic
1081556213 11:44164353-44164375 CAGCTTTATTTTATGTCAGTGGG + Intronic
1081777477 11:45685363-45685385 CATCTTCCTTTTCTTCCATTAGG - Intergenic
1083721368 11:64605231-64605253 CATCTTGATTTTCTGTCTGCAGG - Intergenic
1085674580 11:78503805-78503827 CCTCTTCATTTTCCCTGAATTGG + Intronic
1085855254 11:80168970-80168992 CAGTTTCATTTTCTCTCACTTGG - Intergenic
1085908800 11:80797556-80797578 CATCTGCATTTTGTCTTACTGGG - Intergenic
1086074951 11:82840817-82840839 CATCTTCAAGGTCACTCAGTTGG + Intronic
1086265765 11:84996010-84996032 CATCTTCTATTTCTGTCAGGAGG + Intronic
1087229671 11:95646196-95646218 CATTTTATTTTTCTCTCAGAAGG - Intergenic
1087727136 11:101733435-101733457 CACCATCATCTTCTCACAGTTGG - Intronic
1087757495 11:102070117-102070139 CATCATCATTTTCTTACAGAGGG + Intronic
1088083778 11:105953286-105953308 AATAGTCATTTTTTCTCAGTAGG + Intronic
1088243579 11:107795028-107795050 CATCTTCAATTTCTTTCATCAGG - Intronic
1089355189 11:117845182-117845204 CATCTACTTTTTGTCTCAATGGG + Intronic
1091695711 12:2626776-2626798 AATTTTCATCTGCTCTCAGTGGG + Intronic
1093393003 12:18646007-18646029 CCTTTTCCTTTTCTCTAAGTGGG - Intronic
1093613101 12:21186994-21187016 CTTGTTCACTTTCTCTCATTTGG - Intronic
1094336312 12:29359035-29359057 GATTTAAATTTTCTCTCAGTTGG - Intronic
1095103085 12:38203011-38203033 CATCTGCATTTTCTATGAGCTGG - Intergenic
1097929329 12:65167188-65167210 CATCTTCATTAACTCTTAATTGG + Intergenic
1098432006 12:70429757-70429779 CATCTTCACTTTCTGTGAATGGG + Intronic
1098675027 12:73279269-73279291 CATCTTTCTTTTTTCCCAGTGGG - Intergenic
1099079885 12:78164008-78164030 CAGCTTAATTTTCTCACAGAAGG + Intronic
1100385772 12:94103344-94103366 CACCTTGATTTTATCTCTGTAGG + Intergenic
1100680355 12:96913062-96913084 TTTCTCCATTTTCCCTCAGTGGG + Intronic
1100730320 12:97459866-97459888 AGTCTTCATCTTATCTCAGTTGG - Intergenic
1101766938 12:107710383-107710405 CATCTTCCTGTTCTCTCTCTAGG + Exonic
1103005421 12:117416728-117416750 CTTCTTCATTTTCTGGCATTAGG + Intronic
1103458115 12:121082827-121082849 GATCTTCATTTTCTAACATTTGG + Intergenic
1103802073 12:123544782-123544804 CAGCTTCCTTTTCTGTAAGTGGG - Intergenic
1104295734 12:127511034-127511056 CATCTTCATTCTCTGTCCATGGG - Intergenic
1104588887 12:130068635-130068657 CGTGTTAATTTTATCTCAGTGGG + Intergenic
1106024900 13:25947327-25947349 CATCTTCATTAATTCTAAGTAGG + Intronic
1106944863 13:34815908-34815930 CATCTTCCTTTTCCCTAAGAAGG + Intergenic
1108604991 13:52028879-52028901 CATCTTCATTTTCACTCAAGGGG - Exonic
1108643732 13:52406615-52406637 CATCTCCATTTTCTTTCCCTGGG + Intergenic
1111736417 13:92145702-92145724 CATTTACATTATTTCTCAGTTGG - Intronic
1111828310 13:93296327-93296349 CATCTTCATTTTCTCTCAGTTGG + Intronic
1112166955 13:96930407-96930429 CATGTTCATTCTCTCTGACTTGG + Intergenic
1113233856 13:108247155-108247177 TCACCTCATTTTCTCTCAGTGGG - Intergenic
1113939526 13:114011138-114011160 CTTCTTCATTTTCTCTTTTTAGG - Intronic
1114156617 14:20110526-20110548 CTTCTTTATTTTGTCTCAGCTGG - Intergenic
1114229797 14:20770306-20770328 GAGCTTCATTTTCTCTCATGAGG - Exonic
1116864887 14:50023992-50024014 CTTCTTTATTTTTTCTCAGAAGG + Intergenic
1117591771 14:57276975-57276997 CATCTTCATTTTATCCTACTCGG + Intronic
1118012323 14:61622598-61622620 CATATTCAATTTCCCACAGTGGG - Intronic
1118361297 14:65059640-65059662 CTTCTTCATTATCCCACAGTGGG + Intronic
1118818851 14:69331679-69331701 CCTCTTCATTTTCTCTTTGGAGG - Intronic
1119170080 14:72528345-72528367 CACCTTCATTTTCTCTTCTTGGG - Intronic
1119237677 14:73033279-73033301 CATCTTTCTTTTCACTCTGTTGG + Intergenic
1120919699 14:89743689-89743711 CATCTTCATGTTCACCCAATAGG + Intergenic
1121099977 14:91243771-91243793 CAGCTTCCTTTTCCTTCAGTTGG + Intronic
1121793500 14:96717133-96717155 CATCTTAAATTTCTGACAGTGGG + Intergenic
1122464932 14:101925573-101925595 CATCTTCATGTTCTCCCAAATGG + Exonic
1123738460 15:23210127-23210149 CCTCTCCATTTTCTCTCACAGGG - Intergenic
1124289670 15:28438791-28438813 CCTCTCCATTTTCTCTCACAGGG - Intergenic
1124293551 15:28478520-28478542 CCTCTCCATTTTCTCTCACAGGG + Intergenic
1125442338 15:39716423-39716445 TATGATCATTTTCTCTCAGTTGG - Intronic
1127190469 15:56525286-56525308 CCTCTTGATTTTCCCTTAGTGGG + Intergenic
1127521625 15:59748642-59748664 CATTTTCATATACTGTCAGTGGG - Intergenic
1127656301 15:61059300-61059322 CATCTTATGTTTCTCTCAGTAGG - Intronic
1131208236 15:90470242-90470264 CTTCTTCATTTTCTCTCTGGAGG + Intronic
1131228265 15:90642743-90642765 AATTTTCATTTTCTCCCAGCTGG + Exonic
1135103694 16:19628637-19628659 CATCTTCTTTTTCGATCACTGGG + Exonic
1135900087 16:26449880-26449902 TTTCTTCATTTTGTCTAAGTTGG + Intergenic
1136059377 16:27715233-27715255 CACCTTCATTTTCTCGCATGTGG - Intronic
1136709007 16:32217858-32217880 CCTCTCCATTTTCTCTCACAGGG + Intergenic
1136758902 16:32711566-32711588 CCTCTCCATTTTCTCTCACAGGG - Intergenic
1136809205 16:33158818-33158840 CCTCTCCATTTTCTCTCACAGGG + Intergenic
1136815681 16:33268898-33268920 CCTCTCCATTTTCTCTCACAGGG + Intronic
1138026812 16:53528529-53528551 CATCTTCATTTTTCATCAGCAGG + Intergenic
1138090401 16:54169138-54169160 CATTTTCATTTTCTTTCTGCAGG + Intergenic
1138321274 16:56114398-56114420 AAACTTAATTTTCTATCAGTAGG - Intergenic
1139016594 16:62696793-62696815 CAGCTTCCTTATCTCTCAGTTGG - Intergenic
1139648127 16:68346802-68346824 CATCCTGAGTTTCTCTCAGAGGG + Intronic
1140001074 16:71025595-71025617 GAAATCCATTTTCTCTCAGTGGG - Intronic
1140510438 16:75503648-75503670 CACCTTTATTTTATCACAGTGGG - Intergenic
1140641037 16:76973249-76973271 CAATTTCATTTTGTATCAGTTGG + Intergenic
1141364456 16:83429557-83429579 AAGCTTCATTTTCTCTCTTTTGG - Intronic
1203061058 16_KI270728v1_random:971891-971913 CCTCTCCATTTTCTCTCACAGGG - Intergenic
1145233098 17:21189331-21189353 CACCTTCATCTTGTCTCATTTGG + Intronic
1145805528 17:27725721-27725743 CTCCTTTAATTTCTCTCAGTAGG + Intergenic
1148017610 17:44533481-44533503 CATCTTTATTTGCTCACAGTTGG - Intergenic
1148897588 17:50848576-50848598 CATCTTTATTTTCTTCCATTAGG - Intergenic
1148946860 17:51270264-51270286 TATCTTCTTTTTCTCTCATTTGG + Intronic
1151055132 17:71021982-71022004 CATATTCATTTTCACTCAGAAGG + Intergenic
1151209099 17:72530699-72530721 CATTTTCTTTTTCTCCCGGTTGG - Intergenic
1151294138 17:73171542-73171564 CATTTCCATTTTCTTTCATTAGG - Intergenic
1153262627 18:3239164-3239186 CATCATCAAGTTCTCTCTGTTGG - Intergenic
1153880049 18:9414275-9414297 CAGCTTCATTGTCTTTCAGGTGG - Intergenic
1156269272 18:35516071-35516093 TGTCTTCATTTTCCCTCAGCAGG - Intergenic
1156524550 18:37754465-37754487 CATCCTCATATTATCACAGTTGG + Intergenic
1156809858 18:41234611-41234633 TATCTTCATTTTCTCTTTTTGGG - Intergenic
1158021846 18:52852139-52852161 CATCTTCAGTTTATCTTACTAGG + Intronic
1158238854 18:55353571-55353593 TATCTTCATTTTCCCTAAGGAGG - Intronic
1158523101 18:58188232-58188254 CATCTCCGTTTTCTCCCAGTAGG - Intronic
1158709157 18:59821801-59821823 TATCCTCATTCTCTCTCAGAAGG - Intergenic
1159524779 18:69574181-69574203 CATCTTCATTTTCTGAAACTTGG - Intronic
1160121674 18:76135867-76135889 CCTCTTCTTTGTCTCTCACTAGG - Intergenic
1160669533 19:353419-353441 CTTCTCCATTTTCTCTCAGTTGG + Intergenic
1165529112 19:36381646-36381668 CATCCGCAGTTTCTCTTAGTAGG + Intergenic
925633167 2:5915795-5915817 CATCCTTATTTTTTCTAAGTAGG + Intergenic
926004812 2:9365529-9365551 AAGCTTCATTTTGGCTCAGTGGG + Intronic
927230092 2:20814058-20814080 CAACTTTATTTTCTTTCAGATGG + Intronic
928057987 2:28077877-28077899 CATCCTTGTTTTCTCTCTGTTGG - Intronic
928315346 2:30240261-30240283 GATCAGCATTTTCTCTAAGTAGG + Intronic
930364277 2:50419544-50419566 AATTTTCATTATTTCTCAGTGGG + Intronic
930601342 2:53447082-53447104 CATTTTCATATTCTCTCTTTTGG - Intergenic
931463950 2:62470813-62470835 CAACTTCATTTTCTCTCAGGAGG + Intergenic
931661516 2:64568517-64568539 CATCTACCTTTTTTCTCAGAAGG - Intronic
932924657 2:75958759-75958781 CATAGTCATTTTCTTTCAATTGG + Intergenic
933535530 2:83568358-83568380 TCTCTTCTTTTTTTCTCAGTGGG + Intergenic
936676274 2:114719272-114719294 CTTCTTCATTTTTCCTCATTTGG + Intronic
940614795 2:156036798-156036820 CTTCTTCATTTTTCCTCTGTAGG - Intergenic
941127295 2:161599736-161599758 CATCTGTATCTTCTCTCAGTAGG + Intronic
941392285 2:164929164-164929186 CATCTTAATTTTCTCTAACCTGG + Intronic
942229192 2:173843941-173843963 GATCTTCAGTTTCTCTCACGCGG + Intergenic
943037120 2:182761082-182761104 CATCTTCCTTTTCTTTCATGTGG - Intronic
943143593 2:184014665-184014687 CAGCTTCCTTTTTTCACAGTGGG + Intergenic
944080003 2:195776922-195776944 CATCTTGCTTTTTTCTCACTTGG + Intronic
944587487 2:201185478-201185500 CATCTTAACTTTCTCTCTCTGGG + Intronic
944821004 2:203430911-203430933 TATGTTCATTTTCTTTTAGTAGG + Exonic
945691560 2:213043333-213043355 CATCTTGATTTTCATTTAGTAGG - Intronic
945837507 2:214850191-214850213 CATCTTCATTTTCTGTGTTTAGG - Intergenic
946208648 2:218129497-218129519 CCTCTTCATTTTCTCCCTTTGGG + Intronic
946745717 2:222843694-222843716 CAGCCTCATTTTATATCAGTAGG - Intergenic
947285522 2:228510358-228510380 GCTCTTCATTGTCTCTCATTTGG - Intergenic
948111763 2:235461946-235461968 CTTCCTCATTTTCTCTCAAGGGG - Intergenic
948338766 2:237232307-237232329 CATCTTCCTTCTCTCTCACTTGG + Intergenic
948408834 2:237743358-237743380 CATTTTCATTTTCTCGAAGTGGG - Intronic
1170206207 20:13801309-13801331 CATCATGATTTTCTGACAGTTGG + Intronic
1170594423 20:17794400-17794422 CATATCCATTTTCTCTCTGTGGG - Intergenic
1170751026 20:19145177-19145199 CACCTTGATTTTATCTCAGTGGG + Intergenic
1171007345 20:21479521-21479543 AATCTTCCTTTTCTCTCCTTCGG - Intergenic
1173122122 20:40303259-40303281 CTTCTCCATTTTCTATCATTGGG - Intergenic
1173752951 20:45491053-45491075 CATCTTCATCTTCTTACATTGGG + Intergenic
1177209471 21:18052185-18052207 AATCTTCATTTACTCACATTAGG + Intronic
1177655179 21:24008013-24008035 TACCTTCCTTTTCTCTCATTAGG + Intergenic
1177903518 21:26946991-26947013 CCTCTGCCTTTTCTCTCACTAGG - Intronic
1178767493 21:35468012-35468034 CTTCTTCCTATTCTCTCATTTGG + Intronic
1178789280 21:35683836-35683858 CACATGCATTTACTCTCAGTTGG - Intronic
1178948155 21:36965633-36965655 CCTCTCCATCTTCTGTCAGTTGG - Intronic
1179095607 21:38311860-38311882 CATCTTCATCTCTCCTCAGTAGG + Intergenic
1179273319 21:39868276-39868298 CATCTTCATTTCCTCTTGGTTGG + Intronic
1179359423 21:40691525-40691547 CATCTTCATCTTCTCTCCTTAGG - Intronic
1179962093 21:44773290-44773312 GATCGTCTTTTTCCCTCAGTAGG - Intronic
1181371256 22:22419180-22419202 TATCTGCATTTTCACTCTGTTGG - Intergenic
1183977885 22:41523705-41523727 CCTCTTCATTTTCCCTCGGTAGG + Intronic
949098151 3:111294-111316 CATCTACATTGTCTGTCACTAGG + Intergenic
949398031 3:3635834-3635856 CATCTACATGTGCTCTCATTCGG - Intergenic
949948117 3:9206534-9206556 CATCTTCTATTTCTCTCCCTTGG + Intronic
950949351 3:16981426-16981448 CATCTTCATTTTCACTGACTAGG + Intronic
951307982 3:21089208-21089230 CAGTTTCATTTTTTCTCATTTGG - Intergenic
951335046 3:21410359-21410381 CATCTACCTTCTCTCCCAGTGGG - Intergenic
952538310 3:34337422-34337444 TGGCTTCATTCTCTCTCAGTAGG - Intergenic
953067696 3:39489518-39489540 CATCTGCCTTTCCTGTCAGTGGG + Intronic
954991431 3:54843869-54843891 CTTCTTCCTCCTCTCTCAGTAGG - Intronic
955689803 3:61579802-61579824 TATCTTCATTTTCTGGCACTTGG + Intronic
957119301 3:76069042-76069064 CATTTTCTTTTTATCTCAGATGG + Intronic
957121417 3:76099208-76099230 CCTCTTCTATCTCTCTCAGTGGG + Intronic
958461207 3:94398706-94398728 CATCTTCATTTTATATAGGTTGG + Intergenic
958820190 3:98964636-98964658 CATCTTTATATTCCCACAGTAGG - Intergenic
958909772 3:99980966-99980988 CATCTTCATTATGCCTCATTTGG - Intronic
961080937 3:124027267-124027289 CATCTTGATTTTTGCCCAGTGGG + Intergenic
961714340 3:128848396-128848418 CCTCTTCAGTTTCTCCCAGAAGG + Intergenic
965384102 3:168025169-168025191 CAATTTCATTTTCTGCCAGTGGG - Intronic
965915131 3:173835771-173835793 CCTCTTCTTTCTCTCTCAGAAGG - Intronic
966438097 3:179911419-179911441 GATCTTTTTTTTCTCTAAGTTGG + Intronic
966451787 3:180071595-180071617 CTTCTTCATTGTATCTTAGTTGG - Intergenic
966453511 3:180089574-180089596 AATATTCATTTTCTTTCTGTAGG + Intergenic
968138410 3:196236136-196236158 CCTCTTCCTCTGCTCTCAGTGGG - Exonic
969037319 4:4265148-4265170 CAGCTTCATTTTGTCTAAGTTGG - Intergenic
970573007 4:17401120-17401142 CATCTTGATTTTAGTTCAGTGGG - Intergenic
970662974 4:18306800-18306822 CATCTGCATTCTCTCTCTCTGGG + Intergenic
971371617 4:26023933-26023955 CAGCTTCCTTGTCCCTCAGTGGG - Intergenic
971516314 4:27491019-27491041 TTTCTTCTCTTTCTCTCAGTGGG - Intergenic
971558446 4:28042967-28042989 CTTCTTGATTTAATCTCAGTAGG + Intergenic
972000959 4:34032064-34032086 CATTTTTTTCTTCTCTCAGTTGG + Intergenic
972856841 4:43117682-43117704 CATCTCCCTTTTTTCTTAGTTGG - Intergenic
973302175 4:48599078-48599100 AAACTTTGTTTTCTCTCAGTTGG - Intronic
973596222 4:52493312-52493334 CATCTTTAATTTCTCTCATCAGG - Intergenic
973671528 4:53223938-53223960 CATCTTTATCTTCTCTCAGGTGG - Intronic
974918895 4:68212361-68212383 CTTGTTCATTTTCTGGCAGTAGG - Intergenic
974921200 4:68241688-68241710 CTTGTTCATTTTCTGGCAGTTGG - Exonic
975073269 4:70170793-70170815 CATCTTCATGTAATTTCAGTGGG - Intronic
975317318 4:72969612-72969634 CATCCTTATTTTGTCTAAGTAGG + Intergenic
977139946 4:93357155-93357177 CATTTTCATTTTTTGTTAGTGGG - Intronic
977732575 4:100371704-100371726 TATCTTCATTTTATCTCTCTTGG - Intergenic
978389664 4:108212258-108212280 CATCTTCATCTTCTCACAAGTGG - Intergenic
979121453 4:116907283-116907305 TGTCTTCATTTCCTCTAAGTAGG - Intergenic
983177451 4:164607725-164607747 CTTCTTCACTTTTTTTCAGTGGG + Intergenic
983843768 4:172490149-172490171 CTGCTTCAGTCTCTCTCAGTGGG - Intronic
983975834 4:173933045-173933067 CATCTTTAATTTCTCTCCTTAGG + Intergenic
984657106 4:182330056-182330078 CATTTTTTTTTTCTCTCAGTAGG - Intronic
986002562 5:3641831-3641853 CATCCTCGTTTTCTCTGATTTGG + Intergenic
986737434 5:10678575-10678597 CATACTCATTTTCTGTCACTGGG - Intergenic
987153710 5:15066804-15066826 CATCTTCATTGTCTCATAGCTGG + Intergenic
988069414 5:26267325-26267347 CAGCTGCATTTTCTCCCAGGTGG - Intergenic
988510867 5:31863546-31863568 CACTTACATTTTCTATCAGTTGG - Intronic
991091303 5:62696343-62696365 CACCTGCAGTTTCTCTTAGTGGG + Intergenic
992091623 5:73322734-73322756 TCTGTTCATTTTCTCTCAGGTGG + Intergenic
992483550 5:77174622-77174644 CAGCTTCATTCTCTCTGAGCAGG + Intergenic
993314622 5:86386098-86386120 CCTCTTCACTTGCTATCAGTCGG - Intergenic
993607347 5:90008174-90008196 GATATTCATTTTCTCTCATGTGG - Intergenic
994488776 5:100414756-100414778 CATCTGTATTTTCTCCCACTTGG + Intergenic
994765411 5:103909763-103909785 CATCTTCTTTTTCTAGAAGTTGG - Intergenic
994833976 5:104824543-104824565 AATCTTAATTGTCTCTCAGATGG - Intergenic
995287331 5:110405121-110405143 CATCTCAACTTTCTCTCATTTGG + Intronic
996138306 5:119872806-119872828 CAAATTCATTCTATCTCAGTAGG + Intergenic
998026173 5:138818727-138818749 CTTCTTGTTTTTCTCACAGTAGG + Intronic
998787588 5:145729454-145729476 TGTCTTCTTTTTCTCTAAGTGGG + Intronic
999955306 5:156694784-156694806 CACATTCCTTTTTTCTCAGTGGG - Intronic
1001120358 5:168975082-168975104 CAGCTGCATTTTTGCTCAGTAGG - Intronic
1002814263 6:664277-664299 CATCTACAATTTCTTTCAGCAGG - Intronic
1002866872 6:1129635-1129657 CATCTTCATATCCTCTCTGGAGG - Intergenic
1003479161 6:6515510-6515532 CCTGTTCTTTTTCTCTCATTAGG + Intergenic
1003674358 6:8189312-8189334 CATCTTCTTTTGCTTTAAGTTGG + Intergenic
1004237856 6:13890468-13890490 CTTCTTCATTTTCTCCCAGGTGG + Intergenic
1004858926 6:19781325-19781347 CATTTTCCCTTTCTGTCAGTTGG + Intergenic
1006763153 6:36481540-36481562 CACCTACATTTTCTCTCTGCAGG + Exonic
1006998532 6:38285771-38285793 CATCTGCAATTTCTTTCAGTAGG - Intronic
1007042031 6:38731440-38731462 CATCTGCATTTTATTTCATTAGG + Intronic
1007236826 6:40396440-40396462 CATTATGATTTTCTCTGAGTTGG - Intronic
1008923025 6:56862558-56862580 CATCTTCATCTTCATCCAGTAGG + Intronic
1009062423 6:58413868-58413890 TATGTTCATTTTCTCTAACTGGG + Intergenic
1009250113 6:61288433-61288455 TATGTTCATTTTCTCTAACTGGG + Intergenic
1009375481 6:62963031-62963053 TTTCCTCATTTTTTCTCAGTAGG + Intergenic
1010870555 6:81032021-81032043 CATGTTCATTTTCTTTCTGCTGG + Intergenic
1010959553 6:82130177-82130199 AATCTTCTTTTTTTTTCAGTAGG - Intergenic
1011542122 6:88441905-88441927 CATCTTCATTTTTATTCACTCGG - Intergenic
1011870230 6:91884064-91884086 TAGCTTCATTTTGTCTCATTTGG + Intergenic
1012263687 6:97115722-97115744 AAGCTGCATTTTCTCCCAGTTGG + Intronic
1012888196 6:104868850-104868872 CAGAATCATTTTCACTCAGTAGG - Intergenic
1013323775 6:109023106-109023128 CATTTTTATTTTGTCTCAATGGG - Intronic
1013569291 6:111404877-111404899 CTTGTCCATTTTATCTCAGTGGG - Intronic
1013657057 6:112256900-112256922 CCTCTTCATCTTCTTTCTGTGGG + Intergenic
1016922937 6:149314187-149314209 ACTCTTCATTATCTCTCATTTGG + Intronic
1017397572 6:154020102-154020124 CAACTAAATTGTCTCTCAGTAGG - Intronic
1018627927 6:165798288-165798310 CATCTCAATTTTCTCTCAGAAGG - Intronic
1019812611 7:3175571-3175593 CCTTTTTATTTTCTATCAGTGGG - Intergenic
1021203870 7:17755702-17755724 CATTTTCTGATTCTCTCAGTAGG + Intergenic
1022743862 7:33149813-33149835 CATATACATTTTGTTTCAGTGGG + Intronic
1023594430 7:41813982-41814004 CATCTTAATTATCTGCCAGTAGG + Intergenic
1023872841 7:44272080-44272102 CCTCTTCATTTTCTTTCCGGCGG + Intronic
1024055150 7:45655638-45655660 CATCTTCAATCTTTCCCAGTCGG - Intronic
1024314907 7:48007048-48007070 CATCTGCTTCTTCTCCCAGTGGG - Intronic
1024743778 7:52384063-52384085 CTTCTTCATTTTCACACATTTGG - Intergenic
1024825877 7:53388505-53388527 CATCTAAATTTTCTCTCAGAAGG + Intergenic
1025975838 7:66369110-66369132 TATATTGATTTTCTCTCATTTGG + Intronic
1026104613 7:67410956-67410978 CATCTCCCTTCTGTCTCAGTTGG - Intergenic
1026172865 7:67969883-67969905 CATTATCATTGTCTCTCAGCAGG - Intergenic
1028083869 7:86613198-86613220 CATCTTCATTTTCTCCCAGGTGG - Intergenic
1029047825 7:97649459-97649481 CAGTTTAATTTTCTCTCAGAGGG + Intergenic
1030910348 7:115240574-115240596 CATTTTCATTTTCTTCTAGTGGG + Intergenic
1031514800 7:122688635-122688657 CAGCTTAATTTTCTCTCTCTGGG + Intronic
1031649519 7:124270005-124270027 CATCTTAGCATTCTCTCAGTGGG + Intergenic
1033575436 7:142678776-142678798 CAATGTCATTTTCTCTCAGCTGG - Intergenic
1034176329 7:149102859-149102881 GATTTTCATTTTCTCTCAGATGG - Exonic
1034251661 7:149696613-149696635 CATCTTCATTTTACATCAGAGGG + Intergenic
1034369486 7:150582553-150582575 CATCTTGATTTATTCTCACTTGG + Intergenic
1035301195 7:157898329-157898351 CATATTCATTTTCACACACTTGG + Intronic
1036160327 8:6381591-6381613 CATCTTCATTTTCTCTTCTGGGG - Intergenic
1036804740 8:11822809-11822831 CAACTTTATTTTCTTTCAGATGG - Intronic
1037501398 8:19489041-19489063 CATCTCCATTTTCTACCTGTAGG - Intronic
1038557753 8:28538946-28538968 CATGTTTATTTTCTCTTACTAGG - Intronic
1039053005 8:33512019-33512041 CATCTTCATTTTCTCCATGTAGG + Exonic
1039150010 8:34493942-34493964 GCTCTTCATTTACTCCCAGTCGG - Intergenic
1040116764 8:43630505-43630527 CATATTCAGTTTTTCTCTGTAGG - Intergenic
1040132002 8:43808027-43808049 GATATTCATTTTTTCTCAATAGG - Intergenic
1040139258 8:43891609-43891631 AATATTCATTTTTTCCCAGTAGG - Intergenic
1041157561 8:55004237-55004259 CATCTTTACTCTCTCTCGGTTGG - Intergenic
1041364725 8:57089963-57089985 CATCTTCATTTGCTCACAATTGG - Intergenic
1041455876 8:58059096-58059118 CATCTTCCTCTTATATCAGTAGG + Intronic
1041936826 8:63341564-63341586 CATTCTCACTTTCTCTCAGATGG + Intergenic
1041957860 8:63576494-63576516 TATCTTTATGTTTTCTCAGTTGG + Intergenic
1044578288 8:93795128-93795150 CTTCCTAATTTTCTCTTAGTTGG - Intronic
1044696452 8:94927193-94927215 TATTCTCATTTTCTCTGAGTTGG - Exonic
1045051363 8:98329502-98329524 CATCTTCTTATTGTTTCAGTAGG - Intergenic
1045317080 8:101052485-101052507 CATTTTTATTTTCTTTGAGTTGG + Intergenic
1045337503 8:101221833-101221855 CATCTTGGCTTTCTGTCAGTGGG + Intergenic
1046127608 8:109929663-109929685 TATCTTCAGTTTCTATCTGTCGG + Intergenic
1046806820 8:118487697-118487719 CATTTTCCTTTTCTCTAAGAAGG - Intronic
1047759372 8:127942735-127942757 CAGCTTTATTTTCTTTCAGTGGG + Intergenic
1048725000 8:137373506-137373528 CATTATCATTTTCTCTCATGTGG + Intergenic
1050421526 9:5470702-5470724 AATTTTCATTCTCTCTCATTCGG + Intergenic
1050871557 9:10577538-10577560 CATCTTTCTTTTCACCCAGTGGG + Intronic
1051035108 9:12734988-12735010 CATTTTCACTTACTCTTAGTTGG + Intergenic
1052850020 9:33372619-33372641 CACCCTCATTTTCTCTCACCCGG - Intergenic
1054994281 9:71366905-71366927 AATCTTCAACTTCTTTCAGTTGG - Intronic
1055162654 9:73149527-73149549 CATGTTTATTTTCACTCATTTGG - Intergenic
1056699702 9:88892076-88892098 CATCTTGATTTTCATTCATTGGG - Intergenic
1056932144 9:90887901-90887923 CTGCTTCATTTTCTCACTGTGGG + Intronic
1057249471 9:93488639-93488661 TGTCTTCATTTTCTCTAAATTGG + Intronic
1058491270 9:105502578-105502600 CATCTTCATTTTCTTTATCTAGG + Intronic
1059395276 9:114030516-114030538 CAGCTTCAGTGTCTCTGAGTAGG + Intronic
1060847262 9:126847352-126847374 CATCCTCATTGTCTCTCACCTGG + Intergenic
1185523995 X:762724-762746 CACCTTCATTTTCCATCAGGAGG - Intergenic
1186642372 X:11469783-11469805 CCTGTCCATTTGCTCTCAGTGGG + Intronic
1187158040 X:16739309-16739331 CATGTAACTTTTCTCTCAGTGGG + Intronic
1187460373 X:19481325-19481347 CAACTTCATTCTTTCTCATTTGG - Intronic
1188155660 X:26738683-26738705 CATCTTTATTTTCTGGCAATAGG - Intergenic
1188379913 X:29478755-29478777 CATCTGCTTTTTCTCTCTGCCGG + Intronic
1188951554 X:36381443-36381465 TATCTTCATTTTGCCTCACTTGG + Intronic
1189407654 X:40739679-40739701 AATCTTAACTGTCTCTCAGTAGG + Intergenic
1191630585 X:63317505-63317527 CATCTTCATCTTCTATCCTTGGG + Intergenic
1192666360 X:73091634-73091656 CTTTATCATTTTCTCTCTGTAGG - Intergenic
1193309911 X:79994242-79994264 CCTCTTCAACTTCTTTCAGTAGG - Intergenic
1194292821 X:92096344-92096366 TATCTTCACTTGCTCTCAGGGGG + Intronic
1194665450 X:96672689-96672711 CATATTCATATTCTCTCTCTAGG + Intergenic
1194738664 X:97545730-97545752 AATCTTGATTTTCTGTCAGGAGG + Intronic
1194745279 X:97621383-97621405 CATCTACTATTTCTCTCACTTGG + Intergenic
1195236433 X:102903468-102903490 CATCTTCATGCTCTGTCATTCGG - Intergenic
1195654168 X:107319212-107319234 CAACCTCTTTTTCTCTCAATAGG - Intergenic
1196049255 X:111288036-111288058 CATATTCATTTACTCTCATCTGG + Intergenic
1196357463 X:114810481-114810503 CATCTAAATGCTCTCTCAGTGGG + Intronic
1196460915 X:115929532-115929554 CATATTCATTTTCTTTCTTTAGG + Intergenic
1197294672 X:124704131-124704153 CATATTCATTGTCTCTTAGTGGG + Intronic
1198519484 X:137438388-137438410 CATCTTCCATTTCTTTCAGCTGG - Intergenic
1200610327 Y:5320906-5320928 TATCTTCACTTGCTCTCAGGAGG + Intronic
1201779550 Y:17704120-17704142 TATATTCATTTTTTCTCAATAGG + Intergenic
1201822006 Y:18201872-18201894 TATATTCATTTTTTCTCAATAGG - Intergenic