ID: 1111828311

View in Genome Browser
Species Human (GRCh38)
Location 13:93296334-93296356
Sequence ATTTTCTCTCAGTTGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111828307_1111828311 21 Left 1111828307 13:93296290-93296312 CCTCTAGTACCACTGTCACTGTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1111828311 13:93296334-93296356 ATTTTCTCTCAGTTGGATTATGG 0: 1
1: 0
2: 2
3: 25
4: 260
1111828305_1111828311 29 Left 1111828305 13:93296282-93296304 CCTTCTTCCCTCTAGTACCACTG 0: 1
1: 0
2: 0
3: 30
4: 235
Right 1111828311 13:93296334-93296356 ATTTTCTCTCAGTTGGATTATGG 0: 1
1: 0
2: 2
3: 25
4: 260
1111828308_1111828311 12 Left 1111828308 13:93296299-93296321 CCACTGTCACTGTCTTTGTTTAG 0: 1
1: 0
2: 3
3: 49
4: 382
Right 1111828311 13:93296334-93296356 ATTTTCTCTCAGTTGGATTATGG 0: 1
1: 0
2: 2
3: 25
4: 260
1111828306_1111828311 22 Left 1111828306 13:93296289-93296311 CCCTCTAGTACCACTGTCACTGT 0: 1
1: 0
2: 3
3: 12
4: 157
Right 1111828311 13:93296334-93296356 ATTTTCTCTCAGTTGGATTATGG 0: 1
1: 0
2: 2
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111828311 Original CRISPR ATTTTCTCTCAGTTGGATTA TGG Intronic
902072414 1:13751130-13751152 TTTTTCTCTTGGTTGGATTTGGG + Intronic
903493516 1:23747651-23747673 ATTTTTCCTGAGTTGGATGATGG + Intronic
903890694 1:26568421-26568443 AGTTTCTCTATGTTGTATTAGGG + Intronic
906340327 1:44974067-44974089 ATTTTCTCTCAAGTGGATTTTGG - Intronic
908216331 1:61957340-61957362 ATTTTCTCTCAGTGGAACAATGG + Intronic
911096209 1:94057095-94057117 AGTTTCTCTAAGTTGGGTTTTGG - Intronic
911386758 1:97185573-97185595 ATTTACTCTAAGTTGTATTTAGG - Intronic
911489572 1:98546778-98546800 ATTTTCTCTCATTTTGGATAAGG - Intergenic
914372267 1:147037691-147037713 ATTTTCTCTCAGTTCTCTCAGGG - Intergenic
916434143 1:164760964-164760986 CTTTCCTCTCACTTGGAATAAGG + Intronic
916771053 1:167908685-167908707 ATTTTCCCTCAGCTTTATTAAGG - Intronic
917049696 1:170906998-170907020 AGTTTCTCTCACTTGAAGTATGG + Intergenic
917845786 1:179019231-179019253 ATTTTCTCCCCACTGGATTATGG - Intergenic
918299414 1:183189059-183189081 ATCATCTCTCATTTGAATTACGG - Intronic
921686021 1:218090161-218090183 ATTTACTATCTGTTGGACTAAGG + Intergenic
922126274 1:222727572-222727594 ACTTTCTAGCAGTTGAATTATGG - Intronic
922213465 1:223502471-223502493 ATTTTATTTCAGTTGGACTCAGG - Intergenic
922408287 1:225341809-225341831 ATTTTATCACAGTTGACTTAGGG - Intronic
922410028 1:225364047-225364069 ATTTTCTTACGGTTAGATTAAGG + Intronic
924797774 1:247304765-247304787 CTTTTCTCACAGTTGTATTTTGG + Intronic
1063647919 10:7904344-7904366 ATTTCATTTCAGTTGTATTAGGG - Intronic
1064041259 10:11966806-11966828 ATTTTTTCTCAGTTGGCTACCGG - Intronic
1067925162 10:50501195-50501217 ATTTACTCCAAGTAGGATTAGGG - Intronic
1069025051 10:63530303-63530325 ATTTTCTTTCAATTAGGTTAAGG + Intronic
1070307826 10:75250373-75250395 ATTATCTCTGAGTTGGGTTTGGG - Intergenic
1071826463 10:89330596-89330618 ATTTTCTATCATTTGGATGAAGG + Intronic
1072610687 10:97015598-97015620 TTCTTCTCTCAGTTGGTTTATGG - Intronic
1073856477 10:107681024-107681046 ATTTTCTATCTGTTGGAAAAGGG - Intergenic
1076087454 10:127647635-127647657 ATTTTCTCTCAGTTTTATTGAGG - Intergenic
1076493735 10:130882892-130882914 ATTGTCTCCAAGTTGGATAAGGG - Intergenic
1079041528 11:17064363-17064385 ATTGTCTCTAGGTGGGATTATGG - Intergenic
1079858681 11:25639639-25639661 ATTCTGTCTCAGTTGGACAAAGG - Intergenic
1080559027 11:33445112-33445134 AGTGGCTCTCAGTTGGATGAGGG + Intergenic
1081347263 11:42004917-42004939 ATTTTCTCTCAGTTTTCTTCTGG - Intergenic
1082041122 11:47685854-47685876 ATTTTCTCTCCATTGAGTTAGGG - Intronic
1083129510 11:60611476-60611498 AATTTATCTCAGTTTGAATATGG + Intergenic
1083213102 11:61201489-61201511 AGTTTCTCCCAGTTGGTTTGTGG + Intergenic
1085714646 11:78861776-78861798 CTTTTCTCTCAGTTGACTTTTGG - Intronic
1086214284 11:84359191-84359213 ATTTTCTCCAAGTTGGATTGAGG + Intronic
1086501625 11:87459524-87459546 ACTTTCTCTCAGTGGCAGTAAGG + Intergenic
1087737143 11:101847180-101847202 ATTTTCATTCAGTAGGATTGGGG - Intronic
1087982854 11:104638048-104638070 ATTGTTTCTCACATGGATTATGG - Intergenic
1088460790 11:110080704-110080726 ATTATCTCTCACTAGCATTAAGG + Intergenic
1089727849 11:120498486-120498508 GTGTTGTTTCAGTTGGATTAAGG + Intergenic
1090320084 11:125835519-125835541 ATTTTCTCTCAGCTGTAAGAAGG - Intronic
1090335556 11:125960838-125960860 ATTTTCTCTGATTTGAATTAAGG + Exonic
1090722013 11:129484024-129484046 ATTTTCCCTCAGCTTTATTAAGG + Intergenic
1091296765 11:134479370-134479392 CTTTTCTTTCTGTTGGATCAGGG + Intergenic
1091422829 12:357932-357954 ATTTCCTCCCAGTTGTAGTATGG - Intronic
1092489484 12:8932526-8932548 TTTTTCTCTCTGTTGTATTCTGG + Intronic
1093083448 12:14840361-14840383 ATTTTTTCTCAGTGGGTTTTTGG - Intronic
1093181717 12:15974454-15974476 ATTTTCTCACAGTTAGATTCAGG + Intronic
1095391613 12:41713978-41714000 ATTTTCTCTCTGTATGGTTATGG + Intergenic
1095461369 12:42447673-42447695 ATTCTCTCTCACTTGAATTCTGG + Intronic
1096773137 12:53949255-53949277 TTGTTCTCTCAGTTGGGTTCCGG - Intergenic
1098050701 12:66449482-66449504 ATTCCATCTCAGCTGGATTAAGG + Intronic
1098255806 12:68613913-68613935 ATTTTCTCTTAGCTGTATAAAGG + Intronic
1098449176 12:70600267-70600289 ATGCTTTCTCAGTTGGAATAGGG + Intronic
1099335126 12:81346561-81346583 ACTTTTTCTCAGTTGCATTCAGG + Intronic
1101301040 12:103482342-103482364 ATTTTCTCTCAGTCCACTTAAGG + Intronic
1101687709 12:107042517-107042539 ATTTTCTCATAGTTAGATTAAGG - Intronic
1102638235 12:114343206-114343228 ATTTTTTCCCAGTGGCATTATGG - Intergenic
1103673298 12:122636037-122636059 ATTTTCTCTTAATTTGATAAAGG - Intergenic
1106117529 13:26830212-26830234 ATTTTCTCTTAGGTTTATTACGG + Intergenic
1107572927 13:41682453-41682475 ATTTTCTCTTATTTTGATGAAGG - Intronic
1107679073 13:42829277-42829299 ATATTCTCTCATCTGGATTATGG + Intergenic
1109393805 13:61726892-61726914 ATTGTCTGTCAATTTGATTATGG - Intergenic
1109834825 13:67843894-67843916 TTTTTCTTTCAGTTTTATTAAGG + Intergenic
1109918869 13:69029064-69029086 TTTTTCTCCCAGTTGGAATGTGG - Intergenic
1110155632 13:72313386-72313408 AATTTCTCTCCCCTGGATTATGG + Intergenic
1110735431 13:78930262-78930284 ATTTCCTCTCTGTTTTATTAAGG - Intergenic
1111828311 13:93296334-93296356 ATTTTCTCTCAGTTGGATTATGG + Intronic
1112129947 13:96511965-96511987 AATATTTCTCAGTTGGTTTAAGG + Intronic
1112141589 13:96649666-96649688 ATCATCTCCCACTTGGATTATGG + Intronic
1112802499 13:103127920-103127942 ATATTCTCTTCATTGGATTATGG - Intergenic
1114311795 14:21474248-21474270 AATTTCTATCAGTAGGATGATGG + Intronic
1114786580 14:25606916-25606938 ATTTTCTCTCAGACTGATAAGGG + Intergenic
1118054591 14:62066566-62066588 ATTTTCTCTCACTTGAAATATGG + Intronic
1118940059 14:70325883-70325905 ATTTTCTCTCATATCTATTAGGG - Exonic
1119390095 14:74285756-74285778 ATTTACTTTCATTTGGGTTAAGG + Exonic
1119785178 14:77307808-77307830 ATTCTCTCTCAGTTCCCTTAAGG + Intronic
1122011766 14:98755700-98755722 ATTTTTTCTCAGCTAGATAAGGG + Intergenic
1122863716 14:104594181-104594203 AATTTGTGCCAGTTGGATTAAGG - Intronic
1125655298 15:41351821-41351843 ATTTTTTTTCAGATGTATTAAGG - Intronic
1126403211 15:48295658-48295680 ATTTTCTCTCTGTTGTTTCAAGG + Intronic
1126464332 15:48947347-48947369 TTTTTCTCTCTTGTGGATTAGGG - Intronic
1127068769 15:55267728-55267750 GTTTTTCCTCAGTAGGATTAAGG - Intronic
1127420661 15:58802165-58802187 ATTTTCTCTGGGTAGGATTGGGG + Intronic
1127437601 15:58973430-58973452 ATTTTCCCTCTGCTAGATTATGG + Intronic
1128179609 15:65590251-65590273 CTTATCTCTCACTTGGATTATGG + Intronic
1128377128 15:67085092-67085114 ATTTGCCCTCAGTTGTTTTAAGG + Intronic
1130695543 15:86127813-86127835 ATTTTTTTTCAGTTAGCTTAAGG + Intergenic
1133585177 16:7187313-7187335 ATAATCTCTCAGAAGGATTAAGG - Intronic
1134160701 16:11886735-11886757 ATTTTATGTTAGTGGGATTAAGG - Intronic
1137819391 16:51429265-51429287 ATTTTCTCCCAGTTAGATTCAGG + Intergenic
1137859950 16:51836555-51836577 CTTTTCTTTCAGGTGGATTTTGG + Intergenic
1138742524 16:59327259-59327281 ATTTTCTCTCAGTAGTTTCATGG + Intergenic
1139111288 16:63893845-63893867 ATTCTCTCTCAATTGGTGTAAGG - Intergenic
1140296293 16:73712475-73712497 ATTTTCTCCCAGTTTGCTCAGGG + Intergenic
1140524473 16:75611237-75611259 ATAATCTCTGAGTTGTATTATGG - Intronic
1142436212 16:90059435-90059457 ATTTTCTCTCACTTGGAAACTGG + Intronic
1144486167 17:15666129-15666151 ATTGTCTCTCGCCTGGATTATGG + Intronic
1144557945 17:16298326-16298348 ATGTCCTCTCAGTAGCATTATGG + Intronic
1144615247 17:16765217-16765239 ATTTTCCCTCAGTTGAAAAATGG - Intronic
1144897454 17:18550439-18550461 ATTTTCCCTCAGTTGAAAAATGG + Intergenic
1144914853 17:18716163-18716185 ATTGTCTCTCGCCTGGATTATGG - Intronic
1145134918 17:20395278-20395300 ATTTTCCCTCAGTTGAAAAATGG - Intergenic
1146278054 17:31527715-31527737 TCTTTCTCTCAGTTGGTTTCTGG + Intronic
1148000189 17:44383288-44383310 ATTGTCTCTTGCTTGGATTAAGG + Intronic
1148883365 17:50750703-50750725 ATTGTTTCTCACTTTGATTAGGG + Exonic
1148890925 17:50806460-50806482 ATTTTCTCTGTGTTGGATTAGGG + Intergenic
1149029948 17:52071360-52071382 ATTTTTTCTCATTTGTATGATGG - Intronic
1149254094 17:54805153-54805175 ATTTTGTCTCATTTTGATTTGGG - Intergenic
1149649176 17:58266046-58266068 ATTTTCTCTTAGTTGAATGTGGG - Intronic
1151064710 17:71136307-71136329 ATTTTCCCTCAGTTAGCCTAGGG + Intergenic
1151107279 17:71630920-71630942 GTTTTCTCTCATTTGGGCTATGG - Intergenic
1155142001 18:23052210-23052232 AGTTTGTATCAGTTGGATAACGG - Intergenic
1156080778 18:33332510-33332532 ATTTTTGCTCAGTATGATTATGG + Intronic
1156641111 18:39100048-39100070 ATTTTCTGTCAGTTGAATTTTGG + Intergenic
1158163245 18:54509281-54509303 ATTTTAGCTCTGTTGTATTAGGG + Intergenic
1158339653 18:56451591-56451613 ATCTACTCTCATTTGGAGTATGG + Intergenic
1163111773 19:15165677-15165699 ATTTTTTCTCATTTGGAAAATGG - Intronic
925080348 2:1058477-1058499 ATTTGCTCTGTATTGGATTATGG + Intronic
926462710 2:13152596-13152618 TTTTTCTCTAAGTTGGATAGCGG + Intergenic
929004189 2:37379608-37379630 ATTTCCTTGCAGTTGGATTCTGG + Intergenic
932574414 2:72954882-72954904 AGTTTCTCCCAGTAGGATTAGGG - Intronic
933275846 2:80283688-80283710 AGCTTCTCTCAGCTGCATTAGGG - Intronic
933548069 2:83740196-83740218 AATTTCTCTCATTTGGAATGGGG - Intergenic
934580896 2:95436850-95436872 ATTTTCTCTGATTTGAATTAAGG - Intergenic
934598555 2:95639865-95639887 ATTTTCTCTGATTTGAATTAAGG + Intergenic
935134320 2:100286211-100286233 ATTGGCTCTCAGCTGGTTTAGGG - Intronic
936989952 2:118352626-118352648 ATTATTTCTCAGTTGATTTATGG - Intergenic
938573065 2:132580252-132580274 TTTGCATCTCAGTTGGATTAAGG + Intronic
939119796 2:138102414-138102436 GTTTTCTCTTAGGTGGAATAAGG + Intergenic
939793411 2:146609940-146609962 ATTTTTTTTCAGCTGTATTAAGG + Intergenic
940538320 2:154976258-154976280 ATTTTCTCTAAGTGGCATAAAGG + Intergenic
940798526 2:158106151-158106173 ATTCTCTATCACTTGGATTTGGG + Exonic
941071341 2:160958054-160958076 GTTTTCTATCAGTTTGTTTATGG - Intergenic
941320669 2:164050193-164050215 ATTTTTTTTCAGTTAGAATAAGG - Intergenic
942504501 2:176627262-176627284 TTTTGCTCTCTGTTGCATTAGGG + Intergenic
943252944 2:185553016-185553038 TTTGTATCTCACTTGGATTATGG + Intergenic
943459204 2:188149367-188149389 ATTTTCTCTCTGTTCTTTTAGGG - Intergenic
944016793 2:195050127-195050149 CTTTTCTCTCTGTGGGTTTAAGG + Intergenic
944385653 2:199161144-199161166 ATTTTCTCCTAGTTGTATAAAGG - Intergenic
945630011 2:212262767-212262789 ATTTTCTCTCTGTAAGCTTATGG + Intronic
945786819 2:214250156-214250178 ACTTTCTTGCAGTTGGGTTATGG - Intronic
1169282632 20:4280308-4280330 TTGTGCTCTGAGTTGGATTATGG - Intergenic
1169934383 20:10867017-10867039 ACTTTATGCCAGTTGGATTATGG + Intergenic
1170443501 20:16401824-16401846 ATTACCTTTCACTTGGATTAAGG + Intronic
1171565225 20:26178133-26178155 ATATTCTCTCACTTGGACTTAGG - Intergenic
1172088129 20:32405718-32405740 ATTTTCTCATAATTGGATTCAGG + Intronic
1173105775 20:40132692-40132714 AGCTTCTCTCACTTGGATTCAGG + Intergenic
1174654256 20:52157202-52157224 ATGTTCTCTCAGCTGGACAAAGG + Intronic
1176778889 21:13169477-13169499 TTTTTTTCTCAGATGGATAAAGG - Intergenic
1176947929 21:15006700-15006722 ACTTTCACTCACTTGGATTCAGG + Intronic
1177242895 21:18483831-18483853 ATATTCTCTCTGTTTGATTCTGG - Intronic
1177293642 21:19147692-19147714 ATTTTGTCTTAGTCTGATTATGG + Intergenic
1177738395 21:25121622-25121644 ATTTTCTCTCAGTTGTCTGCAGG - Intergenic
1178279519 21:31269365-31269387 AGTTTCTCTTAGTAGGATTTAGG - Intronic
1178883519 21:36466888-36466910 AATTTCTCTCATTTGGAATAGGG - Intronic
1178893267 21:36538132-36538154 ATTTTCAGTCAGTTGGATGGAGG + Intronic
1182224813 22:28788926-28788948 ATTTTATCTGAGTTTGAGTAGGG + Exonic
1183910407 22:41074885-41074907 ATCTTCTCACAGTTGGCTTTGGG + Intergenic
950816577 3:15709729-15709751 ATTTTCTCTCAATAGGAATTTGG - Exonic
952100549 3:30007461-30007483 TGTTTCTCTCATTTGGATTGTGG - Intronic
952134919 3:30407594-30407616 AGTTTCTCTCAGTTTGATCCAGG - Intergenic
956811137 3:72865140-72865162 ATTTTCTTTCAGTTATGTTATGG + Intergenic
957499852 3:81040728-81040750 ATTTTCTTTCAGTTTGGGTAGGG - Intergenic
958621297 3:96565916-96565938 GTTTTATTTAAGTTGGATTATGG + Intergenic
958703859 3:97628154-97628176 ATTATCTCTTACCTGGATTATGG - Intronic
959267676 3:104164427-104164449 ATTTTCTTTCACTTATATTAAGG - Intergenic
960090223 3:113631068-113631090 TTTTCATCTCAGTTGGAATAAGG - Intergenic
960124206 3:113980370-113980392 AGCTTCTCTCAGTTTGAGTAAGG - Intronic
962558058 3:136576010-136576032 ATTTTCTCTAAGTGGGAGGAAGG - Intronic
967622285 3:191648605-191648627 ATATACTCTCAATTGGATTAAGG + Intergenic
968169218 3:196495554-196495576 GTTTTCTCACAGTTAGATTCAGG + Intronic
970089875 4:12393459-12393481 AAATTTTCTCAGTTGAATTATGG - Intergenic
970468750 4:16354281-16354303 GTTTCCTCTCAGTTTGATTTAGG + Intergenic
972786870 4:42334534-42334556 CTTTTCTCCCAGCTGGATGAAGG + Intergenic
973668332 4:53186659-53186681 ATTTTCTTTCAGTATAATTATGG - Intronic
974304262 4:60111560-60111582 AGTTTTTCCCAGTTTGATTAAGG - Intergenic
974510057 4:62827760-62827782 ATTGTCTCTCAGTTGGGTGGAGG - Intergenic
975093743 4:70433516-70433538 ATTTTCTCTCAGTTTGTTATTGG + Intronic
975303448 4:72819442-72819464 TTTTTCTCTCACTTACATTATGG - Intergenic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976645388 4:87381982-87382004 ATTTTCTTTCAGTAGGTTGAAGG - Intronic
977327479 4:95594022-95594044 ATTGTCTCGCTGTTGGAGTAAGG - Intergenic
977384790 4:96325289-96325311 ATGGTCTATCAGTTGGAGTAAGG + Intergenic
978470118 4:109056705-109056727 ATATCCTCTCAGTTGGCTTTAGG - Intronic
978914590 4:114109003-114109025 ATTTAATCTCAGTTGGTTCAGGG + Intergenic
979391520 4:120133937-120133959 AATTTCTCTGAGTTTCATTAGGG - Intergenic
979844340 4:125489735-125489757 ATTATCTTTCAGCTGGATGATGG + Intronic
981675284 4:147336227-147336249 CTTTTCTCTCCGTAGGATCAGGG - Intergenic
982534675 4:156595416-156595438 ATTTTCTCTGATTTGTAGTAAGG + Intergenic
983231569 4:165134433-165134455 ATTTTTTTTCAGTTGGAGTCTGG + Intronic
983445661 4:167847389-167847411 ATTTTATCTGAGATGGATAAAGG - Intergenic
983488437 4:168359540-168359562 ATTTTCTCTCACCTGGAATATGG + Intronic
986004308 5:3655259-3655281 ATTTATTCTCAGTTTCATTAAGG + Intergenic
986086422 5:4455400-4455422 ATATTTTCTCTGTAGGATTAAGG + Intergenic
986703558 5:10435459-10435481 CTTTTCTCTCATTTGAAATAAGG + Exonic
987101655 5:14596390-14596412 ATTTTATCTCAGTTGTATTTGGG + Intronic
987483193 5:18485749-18485771 ATTTTCTTTCAATTGCTTTATGG + Intergenic
987749553 5:22021685-22021707 ATTTTCATTCAATTGGAATAGGG + Intronic
988130783 5:27102544-27102566 ATTTTTTCTCAATTCAATTATGG + Intronic
988421338 5:31009191-31009213 GTTTTCTCTAAGTTTTATTATGG + Intergenic
988873921 5:35422771-35422793 AATTTCTCCCAGTTTTATTAAGG - Intergenic
989043993 5:37256756-37256778 ATATTCTTTCAGTTACATTATGG + Intergenic
989091152 5:37733333-37733355 ATGTTCTCTCATTTGGAAAAAGG - Intronic
989819606 5:45780018-45780040 ATTTTCTCTGAGATGTAGTAGGG - Intergenic
991294745 5:65068799-65068821 AGTTTCTCTCACTTGACTTAAGG - Intergenic
994440465 5:99796766-99796788 ATTTTGTGTTAGTTGTATTAGGG - Intergenic
995128407 5:108603611-108603633 ATTTTCTTTCAGATTGTTTAAGG - Intergenic
995243309 5:109909916-109909938 ATCATCTCTCATTTGGACTAGGG + Intergenic
996354368 5:122579877-122579899 ATCATCTCTCACCTGGATTATGG + Intergenic
996519870 5:124414634-124414656 CTTTTCTCTCAGGTGGCTTCTGG - Intergenic
998078040 5:139252335-139252357 ATTATCTCTCACCTGGACTATGG + Intronic
998941432 5:147287171-147287193 ATTTTCTATGCCTTGGATTATGG - Intronic
998949476 5:147378025-147378047 ATTTTCTCTCTTTTACATTAAGG + Intronic
1001349164 5:170939917-170939939 ATTTTCTCTTTGCTGGGTTATGG - Intronic
1001836073 5:174833780-174833802 AGTTTCCTTCAGTTGGTTTAAGG + Intergenic
1004471525 6:15933790-15933812 ATTTTCTCTGAGTTAGAGAATGG - Intergenic
1004560743 6:16747726-16747748 ACTTTCTCTTAGCTGGCTTAGGG - Intronic
1006991060 6:38215264-38215286 ATTTTCTATCACTTGTATTTTGG + Intronic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008792843 6:55259546-55259568 AATTTCTCTCAGATGACTTAAGG - Intronic
1010384024 6:75257818-75257840 ATTATGACTCATTTGGATTATGG + Intronic
1010704578 6:79092279-79092301 ATTTTCTCTATTTTAGATTAAGG + Intergenic
1010791332 6:80068589-80068611 TTTTTCTCTCCGTTGGAATCAGG + Intergenic
1012267864 6:97168597-97168619 AATTTCACACTGTTGGATTAGGG + Intronic
1012455496 6:99399254-99399276 ATTTTAACTCAGTTGCTTTAGGG - Exonic
1013042108 6:106445788-106445810 ATTTTTTCTCAGCTGAATAAAGG - Intergenic
1013056496 6:106588441-106588463 ATTTTCTATCATTTGGTTTCAGG + Intronic
1013821309 6:114156313-114156335 AATTTCTAACAATTGGATTAGGG + Intronic
1014288050 6:119525564-119525586 ATTTTATCTGAATTGGATAAGGG + Intergenic
1014702233 6:124704564-124704586 ATTTTCTCCCAGTAGGGTTATGG - Intronic
1015615735 6:135072793-135072815 TTTTTTTCTCACTTGGCTTATGG - Intronic
1018432576 6:163734291-163734313 CTGTTCCCTCAGTTGGATTATGG + Intergenic
1022512060 7:30943225-30943247 ATTTTTTCTCACATGGATTGTGG + Intronic
1023754624 7:43405080-43405102 ATTTTCTCTTTCTTGTATTAAGG + Intronic
1025794776 7:64729409-64729431 ATCTGCTCTCAGAAGGATTATGG + Intergenic
1028930341 7:96406147-96406169 ATTTTCCCTCAGTTAAATTGGGG - Intergenic
1029148599 7:98464502-98464524 ATTTGCTTTCAGTGGGATTCAGG + Intergenic
1030267831 7:107638709-107638731 TTTTTCTCTCATTTGAATTTTGG + Intergenic
1030439237 7:109565593-109565615 ATTTTTTCTCGGGTGTATTATGG - Intergenic
1031453473 7:121950750-121950772 ATTTTCTTTCAGTGAGACTAAGG - Intronic
1031455496 7:121974456-121974478 ATTGTCTCTCAGTGGTATTGGGG + Intronic
1033388338 7:140901068-140901090 ATATTATGTCAGTTGGACTATGG - Intronic
1037075480 8:14711927-14711949 ATTTGCACTGAGTTGGATTTTGG - Intronic
1037385184 8:18332370-18332392 ATTTTCTGTGAGTGGCATTAGGG - Intergenic
1038650372 8:29397505-29397527 TATTTCTCTGAGTTGGTTTAGGG + Intergenic
1038910012 8:31952555-31952577 TTTTTTTCTCACTTGGATTTTGG + Intronic
1039498654 8:38000126-38000148 TTTGTCTCCCAGCTGGATTAGGG + Intergenic
1040054527 8:43045851-43045873 CTTTTCTCTCAGTTTCATTTTGG + Intronic
1041135782 8:54757410-54757432 TTTGTCTCTCAGTTGGCTTTGGG - Intergenic
1042752066 8:72169112-72169134 TTTTTCTCTCAGTTTGATATTGG + Intergenic
1043037261 8:75213901-75213923 ATTTTCTCACAGTTAGCTTGAGG + Intergenic
1043314146 8:78898880-78898902 ATATTATCACAGTGGGATTAGGG + Intergenic
1044946333 8:97393310-97393332 ATTTTCTGGCAGTTGAAATAAGG - Intergenic
1045297026 8:100880916-100880938 ATTTTCTCACAATTAGATTCAGG - Intergenic
1046621767 8:116535627-116535649 ATTTTCTATCAGTTGAAAAAGGG - Intergenic
1047166664 8:122446844-122446866 ATTTTCATTCTGTTGGATGAAGG + Intergenic
1048839439 8:138551926-138551948 AATTTCTCCCAGTTGGAATGGGG + Intergenic
1049045577 8:140148693-140148715 ATTTTCTCTCATCTGGAGCAAGG - Intronic
1055438692 9:76318062-76318084 ATTTTCTCTAAGCCGGCTTATGG + Intronic
1055681831 9:78723677-78723699 ATTTTTTCTCAGTAGGTTTAGGG - Intergenic
1056419368 9:86408803-86408825 ATTTTCTCTCACTTGATTTGGGG - Intergenic
1057170542 9:92960761-92960783 AATTTCTCTCAGCTGGCCTAGGG - Intronic
1060423935 9:123489031-123489053 ATATTCTCTCAGCTGGCATAGGG - Intronic
1060428582 9:123527209-123527231 ATCTTCTTTCTGCTGGATTATGG + Intronic
1186562165 X:10624081-10624103 AGTTTCTTTCAGTTGGTTAAGGG + Intronic
1186872432 X:13785808-13785830 ATTTTCTCTCCTTTGGGTTCAGG - Exonic
1186991117 X:15069206-15069228 ATTTTCTTTCAACTGGATTTGGG - Intergenic
1187354139 X:18551080-18551102 ATTTTCTGCCAGAGGGATTAAGG + Intronic
1188036477 X:25323120-25323142 ATCTTCTCCCAGCTTGATTATGG - Intergenic
1188591947 X:31848169-31848191 ATTTTCTCTCATTTATATTCTGG - Intronic
1188632973 X:32391556-32391578 ATTTGCTCTCATTTGTTTTAAGG - Intronic
1189946296 X:46183184-46183206 ATTTTCTCTGTGTTGAATTCTGG + Intergenic
1191166368 X:57396441-57396463 TTTTTCTCTCTTTTGGATGAAGG + Intronic
1191751820 X:64550771-64550793 ATTTTATTTCAGTTGGATTAAGG + Intergenic
1193800049 X:85924226-85924248 ATCTTCTCTTACTTGGTTTATGG - Intronic
1194058849 X:89171607-89171629 GTTTTATATCAGTTGTATTAAGG - Intergenic
1194415715 X:93609329-93609351 ATTTTCTCTTACTTGGAAGAGGG - Intergenic
1194479682 X:94405334-94405356 AATTTTACTCAGTTGGATGATGG + Intergenic
1195793707 X:108620441-108620463 GTTTTCTCTGATTTGGATTAAGG + Intronic
1196022016 X:111000374-111000396 TTTTTCTTACAGTTAGATTAAGG - Intronic
1197430467 X:126356894-126356916 ATTTTCTTTCAATTGGATTTTGG - Intergenic
1198830191 X:140742202-140742224 TTTTTGTGTAAGTTGGATTATGG + Intergenic
1200804294 Y:7416367-7416389 ATTTTCTCTCAGTTTTTTAATGG + Intergenic