ID: 1111833979

View in Genome Browser
Species Human (GRCh38)
Location 13:93364300-93364322
Sequence TCAGCTCTGCTTATGACACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111833979_1111833980 -7 Left 1111833979 13:93364300-93364322 CCACGTGTCATAAGCAGAGCTGA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1111833980 13:93364316-93364338 GAGCTGAACAGTAAAGTTCATGG 0: 1
1: 0
2: 0
3: 16
4: 166
1111833979_1111833981 18 Left 1111833979 13:93364300-93364322 CCACGTGTCATAAGCAGAGCTGA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1111833981 13:93364341-93364363 AATGTATGTTATCTATCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111833979 Original CRISPR TCAGCTCTGCTTATGACACG TGG (reversed) Intronic
906242432 1:44250268-44250290 TCCGCTCTGCTTATGGCTCGGGG + Intronic
907284628 1:53371681-53371703 TCAGCTCTGCTGCTGAGACCAGG - Intergenic
913315291 1:117545337-117545359 TCAGCTCTGCCACTGACACTGGG - Intergenic
920763519 1:208809048-208809070 TCAGCTCACCTGATGACAGGTGG - Intergenic
922152280 1:223016782-223016804 AAAGCTCTGCTTACTACACGAGG - Intergenic
922215487 1:223516441-223516463 CCAGCTTTGCTCCTGACACGTGG - Intergenic
924177511 1:241407261-241407283 TCAGCTCTGTTTCTTACACCTGG - Intergenic
1064883921 10:20088165-20088187 TTAACTCTGCTTCTGACAAGTGG + Intronic
1070328625 10:75403209-75403231 TTAGCCCTGCTTACGACCCGAGG - Intergenic
1071449812 10:85783641-85783663 TCAGCTCACCTCATGACACAAGG - Intronic
1071979066 10:90985463-90985485 TCAGCTCTGCTTACCTCACATGG - Intergenic
1073425484 10:103452989-103453011 GCAGCTCTGATTATTACACAGGG - Intergenic
1073499142 10:103920006-103920028 TCTGCTCTGCTTATACCACCTGG - Intergenic
1074820645 10:117175645-117175667 CCAGCTCTGCTTGAGAGACGTGG + Intergenic
1074997149 10:118767356-118767378 TCAGATCTGCCTATGGCACCTGG - Intergenic
1075269699 10:121038049-121038071 TCAGCTATGCTCAGGACACTGGG + Intergenic
1076473645 10:130737439-130737461 TCAGCTCTGCTTGTGCAATGAGG + Intergenic
1078226667 11:9398233-9398255 CCAGTTCTTCATATGACACGTGG - Intronic
1083479707 11:62936053-62936075 TCAGCTCTGTTTCTGACCTGGGG + Intergenic
1083793670 11:65002109-65002131 TCAGCTCAGCTTCCGACATGAGG + Intergenic
1084660248 11:70542551-70542573 TCAGCCCTGCTTATGGGACACGG + Intronic
1089002695 11:115065380-115065402 CCAGCTCTGCTGAAGACACATGG - Intergenic
1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG + Intronic
1093015142 12:14147888-14147910 TCCCCTCTGCTCATGACTCGGGG - Intergenic
1094579077 12:31717173-31717195 TCAGCTCCACTTATGACATGCGG + Intronic
1098696947 12:73571827-73571849 TCAACTCCGCTTATGAAAAGTGG + Intergenic
1102351930 12:112199045-112199067 TCAGCTTGGATTAGGACACGGGG + Intronic
1104271873 12:127289603-127289625 TCAGCTCTTCTCCTGACACATGG - Intergenic
1111833979 13:93364300-93364322 TCAGCTCTGCTTATGACACGTGG - Intronic
1118740162 14:68733674-68733696 TCAGCTCTTCTTAAGACAAATGG + Intergenic
1121090525 14:91178536-91178558 TCAGCTCAGAGCATGACACGGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126385661 15:48090768-48090790 CCAGCTCTGCTTCTAACAGGTGG + Intergenic
1129235081 15:74218939-74218961 TCAGCTCAGCTCAGGACAGGGGG - Intergenic
1130403180 15:83575876-83575898 TCAGCACTGTTTCTGACACGGGG + Intronic
1134023357 16:10937175-10937197 CCAGCTCTGCTCCTGACATGAGG - Intronic
1134215291 16:12312539-12312561 TCACCTCTGCTTCTGGCTCGTGG - Intronic
1135024099 16:18985976-18985998 TAAGCTATGATTATGACACTGGG + Intronic
1137713982 16:50586437-50586459 TTAGCTCTGCTTATTACCTGAGG + Intronic
1141159860 16:81621952-81621974 TCAGCTCAGCTTCTGAGACTTGG - Intronic
1145932716 17:28697575-28697597 TCAGCTCTGGATATGACACATGG + Intronic
1147833819 17:43315729-43315751 TCAGCTCTGTTTTTGCCCCGTGG - Intergenic
1150591452 17:66566189-66566211 TCAGATCTGCTGATGATACCTGG + Intronic
1157395520 18:47337719-47337741 GAAGCTCTGCTTATGTCACTGGG + Intergenic
1158552189 18:58445699-58445721 TAAGCTCTGGTAATGCCACGGGG - Intergenic
1165321933 19:35090937-35090959 GCTGCTGTGCTTAGGACACGTGG - Intergenic
1168289073 19:55348181-55348203 TCAGCTGTGCTGATGAGAGGGGG + Intergenic
926108298 2:10166170-10166192 TCAGCTCTGCTCAGGAAATGGGG - Intronic
927518000 2:23683115-23683137 CCAGCCCTGCTTCTGACACTTGG - Intronic
934980045 2:98832144-98832166 TCAGGTCTGGTTAGGAGACGTGG - Intronic
935318889 2:101865840-101865862 TCAGCACTGCTAATGGCAGGGGG + Intronic
941826286 2:169900663-169900685 TTAGCTGTGCTTATTACATGTGG + Intronic
947214184 2:227735232-227735254 TCAGCTCTGGTAATGTCAAGTGG + Intergenic
948312815 2:237001789-237001811 ACAGTTCTGCCTATGACACATGG - Intergenic
1171322499 20:24258700-24258722 TCAGCTGTGCTTTTGACCAGGGG - Intergenic
1174443184 20:50572574-50572596 TCTGCCCTGCTTATGAGATGAGG + Intronic
1175839508 20:62018144-62018166 TCAGTTCGGCTTAGGAGACGTGG - Intronic
1181359930 22:22326792-22326814 TCACCTCTCCTGCTGACACGTGG + Intergenic
1181369954 22:22408221-22408243 TCACCTCTCCTGCTGACACGTGG + Intergenic
1183973955 22:41499384-41499406 CCAGCTCTGGTGATCACACGGGG - Intronic
1184354209 22:43967758-43967780 TCAACTTTCCTTATCACACGAGG + Intronic
956932389 3:74059705-74059727 TCAGCTCTGCCTAAGACACTTGG + Intergenic
958142931 3:89586874-89586896 TCAGCTCTCCTAATGACATCTGG - Intergenic
965628877 3:170710258-170710280 CCAGCTGGGCTTATGACAGGTGG - Intronic
968273603 3:197423501-197423523 GCAGCTGTGCTTAGGACCCGAGG + Intergenic
968436958 4:598170-598192 TCTCCTTTGCTTATGACACTGGG + Intergenic
969296832 4:6275276-6275298 TCAGGTCTTCAAATGACACGTGG - Intronic
970210001 4:13699600-13699622 TCAGCACTGCTTATGGAACAGGG + Intergenic
978309815 4:107374127-107374149 TCAGCTCTGCTCATAACACCTGG - Intergenic
979225195 4:118277203-118277225 TCAGTTCTGCTTTTGATACATGG - Intergenic
981165896 4:141556422-141556444 TCAGCCCTGGCTATGACACAGGG + Intergenic
984172716 4:176380501-176380523 TCAGCTCAGCTCTTGACAGGTGG - Intergenic
989233948 5:39122337-39122359 TCATCTCTGCTGATGAAACAGGG + Exonic
990022708 5:51147374-51147396 TCAGCTTTGCTTATGAAGCTTGG - Intergenic
995314653 5:110754720-110754742 TCTGCTCTGCTTATCTCACAAGG + Intronic
995540997 5:113186211-113186233 TCAGCCCTGCTTCTCACACAGGG + Intronic
996098662 5:119425504-119425526 TCTGCTCATCTTATGACAAGAGG - Intergenic
999716006 5:154360488-154360510 AGAGCTCTGCTTATGTCATGTGG - Intronic
999890010 5:155967317-155967339 CTACCTCTGCTTATGACATGGGG - Intronic
1005410786 6:25543660-25543682 TCAGCTTTACTTATGATATGAGG + Intronic
1009967878 6:70596192-70596214 TCAACTCTGCTTCTCACAGGAGG - Intergenic
1021609658 7:22444965-22444987 ACAGCTCTCCTTGTGCCACGCGG - Intronic
1021826457 7:24557424-24557446 TCTGCTCTACTTATGACCCCTGG - Intergenic
1022189340 7:28001965-28001987 TGAGGTCTGCTTCTGACATGTGG + Intronic
1023648878 7:42347860-42347882 TCAGATCTGCTTGTGACAAAGGG - Intergenic
1024972104 7:55079809-55079831 TCAGCTCTGCTGCAGACACCTGG - Intronic
1026277575 7:68893584-68893606 TCAGCACTGCTTATGACTGAAGG - Intergenic
1030275282 7:107714279-107714301 TCAGATTTGATTATGACACCAGG - Intronic
1031997405 7:128241583-128241605 TCAGCTCTGCGAATGCCACCAGG - Intronic
1034827890 7:154283110-154283132 TCATCTCAGCTTATTACCCGTGG + Intronic
1038272471 8:26086675-26086697 TCAGCTCTGCTTTAGAAACCAGG - Intergenic
1044565135 8:93654508-93654530 TCAGCCCTCTTTCTGACACGTGG + Intergenic
1047771139 8:128031077-128031099 TCAGCTCTGCCTGTCACACTGGG + Intergenic
1047923189 8:129656241-129656263 TCAGCTCTGTTTAATACAGGAGG - Intergenic
1050550274 9:6743191-6743213 TTAGCTCTACTTAAGACAAGAGG - Intronic
1050935849 9:11393539-11393561 TTAGCTCTGCCCTTGACACGTGG - Intergenic
1051918234 9:22232848-22232870 TGAGCTCTTCTTTTCACACGTGG - Intergenic
1053471805 9:38351975-38351997 TCAGCTCAGCTTCTAACACATGG - Intergenic
1055826447 9:80331069-80331091 TCAGCACTGCTTTTCACAAGAGG - Intergenic
1057933224 9:99214266-99214288 GCAGCTCTGTTTATGCCAAGAGG - Intergenic
1059581263 9:115550992-115551014 TCAGCGTTGCTTAGGACACTGGG + Intergenic
1061931656 9:133836016-133836038 TCAGCTCTGCCTGTGACCCAGGG - Intronic
1194717566 X:97305109-97305131 TCAGCTCAGCTTAGGACAGATGG - Intronic
1196167609 X:112552585-112552607 TCAGCTATGATTAGGACACAGGG - Intergenic