ID: 1111834750

View in Genome Browser
Species Human (GRCh38)
Location 13:93374439-93374461
Sequence CAGGGTAAAGACTCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111834750_1111834753 -9 Left 1111834750 13:93374439-93374461 CCTGCAACAGAGTCTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1111834753 13:93374453-93374475 TTTACCCTGTGCGGGCAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 105
1111834750_1111834754 -8 Left 1111834750 13:93374439-93374461 CCTGCAACAGAGTCTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1111834754 13:93374454-93374476 TTACCCTGTGCGGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111834750 Original CRISPR CAGGGTAAAGACTCTGTTGC AGG (reversed) Intronic
909593236 1:77375828-77375850 CAGGGTGAAGAGTCAGTCGCAGG - Intronic
909844329 1:80372640-80372662 CAGGGGTAAGACTCTGGTGGAGG - Intergenic
913031904 1:114915825-114915847 TAGGATAAGTACTCTGTTGCCGG - Intronic
920543519 1:206797106-206797128 CAGTGTAGAGACTTTGCTGCGGG + Intergenic
921811025 1:219514619-219514641 CAGGGTACACATTTTGTTGCAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG + Intergenic
1069060300 10:63887852-63887874 AAGTGTACAGACTCTGTTTCTGG + Intergenic
1069665774 10:70156690-70156712 CAAGGTAAAGACTGCGTGGCAGG + Intronic
1074003116 10:109392239-109392261 CAGGGTAAGGACGCTGGTGCTGG + Intergenic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1075199201 10:120388069-120388091 CAGGCTAAGGACTCAGTTCCTGG - Intergenic
1079731538 11:23941173-23941195 CAGACTAAAGACACGGTTGCAGG - Intergenic
1081420276 11:42867606-42867628 CAAGGTAAGGACTCTGATCCAGG - Intergenic
1081466736 11:43326225-43326247 CAAGGTCAAGACACTTTTGCAGG - Intronic
1084708103 11:70827570-70827592 CAGGGGCAAGGTTCTGTTGCCGG + Intronic
1087705909 11:101491692-101491714 CAGTGCAAAGACTTTGTTGTTGG - Exonic
1088143237 11:106643959-106643981 CATTTTAAAGACTCAGTTGCAGG + Intergenic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG + Intergenic
1097923216 12:65099573-65099595 CTGAGTAAAGACTCTGTTTCAGG - Intronic
1103162069 12:118737526-118737548 CCTGGTAAGGACCCTGTTGCAGG - Intergenic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104495054 12:129229172-129229194 CAGGGTAAACACTCAGCTTCGGG + Intronic
1104515273 12:129419358-129419380 CAGGGAAAAGAGCCTCTTGCAGG - Intronic
1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG + Intergenic
1107740766 13:43447496-43447518 CAGGGCACAGACTATCTTGCAGG - Intronic
1108089163 13:46828659-46828681 CAGAGTTAAGACTCAGGTGCAGG - Intergenic
1108207403 13:48104636-48104658 CAGAGTAAAGATGATGTTGCAGG + Intergenic
1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG + Intergenic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113362260 13:109642475-109642497 CAGGGAATATACTCTGTTCCTGG - Intergenic
1117255463 14:53972739-53972761 CAAGATAAAGCCTATGTTGCTGG + Intergenic
1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG + Intergenic
1127026721 15:54815112-54815134 CAGGGTACAGCCCCTGTAGCTGG - Intergenic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1129075262 15:72989556-72989578 AATGTTAAAAACTCTGTTGCTGG - Intergenic
1130874962 15:88005802-88005824 AAGGGTAAAAACTTTGTTGAAGG - Intronic
1134050829 16:11136065-11136087 CTGGGCAAATACTCTGCTGCTGG - Intronic
1135167321 16:20150883-20150905 CAAGGGAAAGTCTCTGTAGCAGG - Intergenic
1135876047 16:26200927-26200949 CAGGGTGAAGGCTCTTTTTCTGG + Intergenic
1135989152 16:27206885-27206907 CTGGGGAAACACTCTCTTGCTGG - Intronic
1142685033 17:1572658-1572680 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142687825 17:1587884-1587906 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1148389234 17:47258295-47258317 CAGGGAAATGACTCTGTTTAGGG + Intronic
1150414752 17:64977682-64977704 GAGGGTAAAGACTCTCATACGGG + Intergenic
1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG + Intronic
1154226005 18:12504894-12504916 CAAGGCAAAGGCTCTGTTACAGG + Intronic
1155623348 18:27806861-27806883 CAGTGCAAAGAATCTGATGCCGG + Intergenic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161646107 19:5454472-5454494 CATGGGAAAGACTATGTTACAGG + Intergenic
1162336786 19:10066550-10066572 CAGGGTACACTCTCTGTTTCAGG + Intergenic
1166535458 19:43571264-43571286 TAGGGAAAAGACTCTGAAGCTGG - Intronic
1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG + Intronic
926722190 2:15969068-15969090 CAGGGTGGGGACTCAGTTGCAGG - Intergenic
927214568 2:20660745-20660767 CCGGGTCAACACTCTGTTTCAGG + Intergenic
932117984 2:69070423-69070445 AAGGGGAAAGACTCTTCTGCAGG - Intronic
941058410 2:160815328-160815350 TGGTGTAAAGATTCTGTTGCTGG + Intergenic
946743658 2:222825250-222825272 CAGGGTAGAAACTCAGTGGCTGG + Intergenic
947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG + Intronic
947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG + Intergenic
947969019 2:234306433-234306455 CAGGCAAAAGACTCAGGTGCAGG + Intergenic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1173639128 20:44587129-44587151 CAGGGTAAAGACACTGCCTCTGG + Intronic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1175192485 20:57220892-57220914 CAGGGCAAAGATACTGTGGCCGG + Intronic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
1185290021 22:50019193-50019215 GAGGTTACAGACTCTGTTTCTGG - Intronic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG + Intergenic
961513906 3:127421027-127421049 CAGGGTGAGTACTCTGTTGGAGG - Intergenic
964869770 3:161300717-161300739 CACTGTAAAGACCCTGATGCAGG - Intergenic
967225475 3:187287171-187287193 CAGGGTAAAGCGTCTGCTCCTGG + Intronic
967481366 3:189977094-189977116 CATCGTAAAGTCTCTGCTGCAGG - Intronic
970459525 4:16258911-16258933 CAGGGCAAGGACTCTGATCCAGG - Intergenic
971126197 4:23757931-23757953 CAGGTTAGAGAGTGTGTTGCAGG + Intronic
974389971 4:61253555-61253577 CAGGGAATATACTGTGTTGCAGG + Intronic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG + Intergenic
979573867 4:122263235-122263257 CAGGGGAAATTCTATGTTGCTGG - Intronic
980179450 4:129386300-129386322 CTGGATAAAGAAACTGTTGCTGG - Intergenic
982271699 4:153596485-153596507 CAGGATGAAGGCTGTGTTGCGGG + Intronic
984874520 4:184355374-184355396 CTGGGTAAAGTCATTGTTGCTGG + Intergenic
994445299 5:99864585-99864607 CAAGGCAAAGACTCTGTTTATGG - Intergenic
996318533 5:122188448-122188470 AAGGTTTAATACTCTGTTGCAGG + Intergenic
997223993 5:132195159-132195181 CTGGGAAATGTCTCTGTTGCTGG - Intronic
997346238 5:133194483-133194505 CATGCTAAATACTCTGGTGCTGG + Intergenic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1012119013 6:95340097-95340119 CTGGGCAAAGACTATGATGCAGG - Intergenic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1014016041 6:116531216-116531238 CAGGTTAAAGACTCTCTTTTTGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017248420 6:152253093-152253115 CAGGGACAAGACTGAGTTGCTGG + Intronic
1021236260 7:18146016-18146038 CAGCATGAAGACTCTTTTGCTGG - Intronic
1022670087 7:32447394-32447416 GAGGGGAAAGACTCTGTGGGAGG + Intergenic
1023415293 7:39926600-39926622 AAGATTAAAGACTCTGTGGCTGG + Intergenic
1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG + Exonic
1028149138 7:87351935-87351957 AAGGGTTAAGTCTCTATTGCAGG - Intronic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1029147958 7:98459783-98459805 CTGGGTAAAGCCTCTGGTGGTGG - Intergenic
1033491570 7:141848593-141848615 CAGGCTACAGACTCTTTTCCTGG - Intergenic
1041700969 8:60788582-60788604 TAGGGTAAAGAATTTGTGGCTGG + Intronic
1044265459 8:90176346-90176368 AAGGGTACAGACCCTGCTGCAGG - Intergenic
1046697792 8:117361200-117361222 CAGGGTAAACACTTTGGAGCAGG - Intergenic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1052026625 9:23580688-23580710 CAGAGTAGAGACCTTGTTGCTGG - Intergenic
1052205707 9:25837351-25837373 CAGTGTAAAGATGCTGTTCCTGG + Intergenic
1053305314 9:36980646-36980668 CAGTGTAGAGACCCTGTTGGAGG + Intronic
1056921327 9:90791970-90791992 CAGGCTAAGGAGTCTGTTTCTGG + Intergenic
1056966429 9:91166350-91166372 CAGGGTGGAGTCTCTGTTGCTGG - Intergenic
1059180930 9:112211404-112211426 CAGGGGAAAGAATCTGGGGCTGG + Intergenic
1059647638 9:116283297-116283319 CAGTGGAAAGCCTCTGGTGCAGG + Intronic
1061822941 9:133238633-133238655 CAGGGTCAAGGCTGTGTTGAGGG + Intergenic
1186126806 X:6423109-6423131 CATGGTTAAGACTGTGTTGGTGG - Intergenic
1189960394 X:46318898-46318920 CAGGGTAAAGGCTTTGGTTCTGG - Intergenic
1196311904 X:114178120-114178142 CAGGAAAAAGGCTCTTTTGCTGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1201571521 Y:15420620-15420642 CGGGGCAGAGACTCTGCTGCTGG - Intergenic