ID: 1111834753

View in Genome Browser
Species Human (GRCh38)
Location 13:93374453-93374475
Sequence TTTACCCTGTGCGGGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111834749_1111834753 -4 Left 1111834749 13:93374434-93374456 CCTCTCCTGCAACAGAGTCTTTA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1111834753 13:93374453-93374475 TTTACCCTGTGCGGGCAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 105
1111834750_1111834753 -9 Left 1111834750 13:93374439-93374461 CCTGCAACAGAGTCTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1111834753 13:93374453-93374475 TTTACCCTGTGCGGGCAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 105
1111834748_1111834753 13 Left 1111834748 13:93374417-93374439 CCTCTCTTACGGGGTATCCTCTC 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1111834753 13:93374453-93374475 TTTACCCTGTGCGGGCAGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111834753 Original CRISPR TTTACCCTGTGCGGGCAGTG TGG Intronic
900114884 1:1024188-1024210 TTTACCCTGTCCCGGCAGCCAGG - Intronic
900550526 1:3252283-3252305 GTGTCCCTGTGCGGGCATTGGGG + Intronic
901196916 1:7445439-7445461 TGTACCATCTGTGGGCAGTGGGG - Intronic
902289297 1:15426291-15426313 TTGACCCTGTGCAGGCTCTGGGG + Intronic
907597870 1:55736251-55736273 TTTACCTTGGGCAGACAGTGTGG + Intergenic
907919943 1:58903153-58903175 TTTACACTGTGCAGTCAGTGGGG + Intergenic
909714411 1:78690636-78690658 TTCAGCTTGTGGGGGCAGTGAGG + Intergenic
910337863 1:86155102-86155124 TCAACCCCGTGCGGGCAGCGGGG - Intronic
910643188 1:89486645-89486667 TTTTCTCTGTGCGGCCAGTCTGG - Intergenic
914511491 1:148336214-148336236 TTTACCCAGAGCTGGCTGTGTGG + Intergenic
920760917 1:208783078-208783100 TTTACTCTGTGTGTACAGTGAGG + Intergenic
1063199076 10:3770193-3770215 TTTACCCTGAGCGAGCAATGAGG - Intergenic
1064010229 10:11729810-11729832 TTGAGCCTGTGGGGGCAGGGGGG - Intergenic
1067319263 10:45202128-45202150 TTTGCCCTGTGTGACCAGTGTGG + Intergenic
1068793043 10:61048281-61048303 TTTACTCTGTGCATGCAGAGAGG + Intergenic
1069276082 10:66592808-66592830 TTTACCCTGTGCAGACACTTTGG - Intronic
1076406717 10:130217070-130217092 TTCACACTGGGCGTGCAGTGGGG + Intergenic
1077353473 11:2103786-2103808 TTTTCCCTGGGCCAGCAGTGTGG - Intergenic
1083998013 11:66281820-66281842 TTAACCCTGTGTGGGGGGTGAGG - Intronic
1091660342 12:2378539-2378561 TCTACCCTGTGCGGGCAAGAGGG + Intronic
1091953513 12:4615700-4615722 TTTCCCCTCTTCTGGCAGTGGGG - Exonic
1092243005 12:6847011-6847033 TTTCTCCTTTGAGGGCAGTGGGG + Exonic
1095884079 12:47170445-47170467 GTTGCCCTGTCCGGGAAGTGAGG - Intronic
1096742990 12:53707863-53707885 TTAACCCAGTGTGGGAAGTGAGG - Intergenic
1098671513 12:73235759-73235781 CTGACCCTGTGTGGGCAGAGGGG + Intergenic
1108566564 13:51704934-51704956 TTTACCCTGTACCTCCAGTGTGG + Intronic
1108676768 13:52743823-52743845 TTTACCCTGAGTGGGGAATGGGG + Intergenic
1111834753 13:93374453-93374475 TTTACCCTGTGCGGGCAGTGTGG + Intronic
1112671728 13:101647616-101647638 TTTACCCTGTGCAGGGAAAGAGG + Intronic
1117496873 14:56314381-56314403 TTGACACTGTGGGGGCTGTGTGG + Intergenic
1117911532 14:60642269-60642291 TCTGCCCTGTGCGGGAAGCGCGG + Intergenic
1118714831 14:68551758-68551780 TTTTCCATGTGCAGGCACTGGGG + Intronic
1121007694 14:90500821-90500843 TTTGCCCTGGGCCGGCAGTGGGG - Intergenic
1129334144 15:74842565-74842587 TTTCCCTTGTGAGGCCAGTGAGG + Intronic
1132205673 15:99984573-99984595 TTTCCCCTGTGCCAGCACTGGGG + Intronic
1133518078 16:6529273-6529295 TTTACCCTGTCCAGGCACGGTGG + Intronic
1137772867 16:51030961-51030983 TTCACCCTGTGCAGGCATTGGGG - Intergenic
1138552552 16:57755454-57755476 TGGACACTGTGCGGGCTGTGTGG + Exonic
1139269839 16:65671694-65671716 TTTATCCTGAGAGGACAGTGGGG - Intergenic
1141677737 16:85526390-85526412 CTCACCCTGTGCAGACAGTGGGG - Intergenic
1142952448 17:3494631-3494653 TGTAACCTGTGCTGGCTGTGTGG + Intronic
1145735928 17:27231670-27231692 TTTCCCCTGTGCTGGCAGCAAGG + Intergenic
1147429597 17:40363283-40363305 TCGACCGTGTGCGGGCAGGGCGG + Exonic
1149420675 17:56508108-56508130 TTTACCTTGTTCAGGCTGTGGGG - Intronic
1150140275 17:62722452-62722474 TTTAACCTGTGGAGGCAGAGTGG + Intronic
1151713968 17:75822186-75822208 GTTACCCGGTGAGGCCAGTGTGG + Intronic
1154290364 18:13101539-13101561 TTTAGCCTGAGCCAGCAGTGAGG - Intronic
1155446404 18:25917204-25917226 TTTAATATGTGAGGGCAGTGGGG + Intergenic
1156395001 18:36691372-36691394 TTTATCCTGTGGCAGCAGTGTGG + Intronic
1157042977 18:44061532-44061554 TTGAGCCTGTGTCGGCAGTGGGG + Intergenic
1159688572 18:71456668-71456690 TTTACTGTGTGCATGCAGTGAGG + Intergenic
1163441945 19:17326707-17326729 TGTTCCCTGTGCAGGCACTGGGG + Intronic
925730153 2:6914165-6914187 ATTACCCTGTGAAGGCTGTGTGG + Intergenic
936970696 2:118173756-118173778 CGTACTCTGTGGGGGCAGTGTGG + Intergenic
939842129 2:147201992-147202014 TTTACCCTGAGCGTTCACTGAGG + Intergenic
942944272 2:181656622-181656644 GGTAACCTGTCCGGGCAGTGAGG + Intronic
948268711 2:236657417-236657439 TTTGCCCCGTGAGGGCAGAGGGG - Intergenic
948936665 2:241169651-241169673 CTTACCCTGTGAGGGCAGAGAGG + Intronic
1170739765 20:19045153-19045175 TTTACCTTGAGTGGACAGTGAGG + Intergenic
1173573394 20:44093299-44093321 TTTACTCTGTGCTTGCACTGGGG + Intergenic
1175517639 20:59579012-59579034 CTTACTCTGTGCAGGCACTGGGG - Intronic
1176188561 20:63795421-63795443 GTTACATTGTGCAGGCAGTGAGG + Intronic
1179640134 21:42742281-42742303 TTCACCCAGTGCCGGCTGTGCGG + Intronic
1180952085 22:19725009-19725031 AGGACCCTGTGGGGGCAGTGAGG + Intergenic
1181465153 22:23106928-23106950 GTTTCCCTGTGTGTGCAGTGTGG - Intronic
1182905298 22:33930825-33930847 TTTACTCTGTGGGGGCAATTTGG - Intergenic
1183599858 22:38833513-38833535 TTTACCCTTTGGGGCCAATGGGG - Intronic
1185220707 22:49627872-49627894 CCTTCCCTGTGAGGGCAGTGTGG - Intronic
951136316 3:19107704-19107726 CTGAGCCTGTGAGGGCAGTGGGG + Intergenic
952179734 3:30905057-30905079 TTTACTCTGTGCGGGCTTTGAGG + Intergenic
952887386 3:38020029-38020051 TATAACCTGGGCTGGCAGTGGGG - Intronic
964958427 3:162392196-162392218 TTCACCCTGTGTTGGCGGTGGGG - Intergenic
971092341 4:23360505-23360527 CTGAGCCTGTGGGGGCAGTGGGG - Intergenic
971223247 4:24728448-24728470 TTTCCCCTGTGAAGGCAGGGCGG + Intergenic
973996974 4:56467979-56468001 TTTACCCTCCGCGGGAAGCGAGG + Intronic
978576567 4:110196283-110196305 ATTAGCCTGTGTGGTCAGTGTGG - Intronic
979087257 4:116428646-116428668 TTTACCCTGTAGGGCCAGAGGGG + Intergenic
986427917 5:7653232-7653254 CATACCCTGAGCAGGCAGTGTGG + Intronic
991666849 5:69007951-69007973 TTTACCATCAGGGGGCAGTGGGG - Intergenic
993696815 5:91071222-91071244 TTTACCCTGAGGGGCCAGAGAGG + Intronic
997269730 5:132526582-132526604 TGTACCCTGTGCGCCCAGTGTGG + Intergenic
997944585 5:138188574-138188596 TCTACCCTGAGCTGGCAGTAGGG - Exonic
999640060 5:153663342-153663364 TTTCCCCAGTTTGGGCAGTGTGG - Intronic
1002964315 6:1947437-1947459 TTTACACTGTGTGGGCATTAGGG + Intronic
1008112642 6:47509722-47509744 TTTGCCCTTTGCTGGCAGTGTGG + Intronic
1009853226 6:69225463-69225485 TTTACCCTGTTCTCTCAGTGAGG - Intronic
1016371576 6:143380026-143380048 TCTACCCTCAGAGGGCAGTGGGG + Intergenic
1018687944 6:166318185-166318207 TTTGCCCTGTGCTGGCAGCAGGG - Intergenic
1018911307 6:168101977-168101999 TGGACCCGGGGCGGGCAGTGCGG + Intergenic
1019664587 7:2245260-2245282 TTTACCCTGTGAGGGTTGAGGGG - Intronic
1022671732 7:32462220-32462242 TTGTCCCAGTGCAGGCAGTGGGG - Intergenic
1023695631 7:42843391-42843413 GCTCCCCTGTGCGGTCAGTGTGG + Intergenic
1023968472 7:44975644-44975666 TTGACCCTGTCAGGGCAGAGGGG + Exonic
1025190557 7:56892663-56892685 TTTACCAGGTGTGTGCAGTGTGG + Intergenic
1025190596 7:56892886-56892908 TTTACCAGGTGTGTGCAGTGTGG + Intergenic
1025681347 7:63684034-63684056 TTTACCAGGTGTGTGCAGTGTGG - Intergenic
1025681357 7:63684090-63684112 TTTACCAGGTGTGTGCAGTGTGG - Intergenic
1036161368 8:6391720-6391742 TTTACCCTGTGCTGGGAGAAGGG + Intergenic
1039401950 8:37277480-37277502 GTCACTCTGTGCCGGCAGTGAGG - Intergenic
1049198362 8:141327555-141327577 TTTCTCCTTTGCGGGCTGTGAGG + Intergenic
1053538146 9:38946462-38946484 TTTACCCTCTACAGTCAGTGAGG + Intergenic
1053853795 9:42316874-42316896 TTTCCCCTATGCGGAGAGTGAGG + Intergenic
1054570430 9:66804780-66804802 TTTCCCCTATGCGGAGAGTGAGG - Intergenic
1054627988 9:67417459-67417481 TTTACCCTCTACAGTCAGTGAGG - Intergenic
1056408390 9:86299086-86299108 CTTGCGCTGTGCTGGCAGTGCGG - Intronic
1058554596 9:106153605-106153627 TTGAGGCAGTGCGGGCAGTGTGG - Intergenic
1060236802 9:121869856-121869878 TCTACCCTGTGGGGGCACTTTGG - Intronic
1061115911 9:128611812-128611834 TGGAGCCTGTGCCGGCAGTGAGG + Exonic
1061247227 9:129406708-129406730 TGTACACTGTGAGGGCACTGGGG - Intergenic
1187316892 X:18204725-18204747 TCTACCCCGTGCAGGCACTGAGG + Intronic
1191869199 X:65731216-65731238 TTCACCCTGTAAGGGAAGTGGGG - Intronic
1195849640 X:109269336-109269358 TTTACCATGTGCAGGCATTGTGG + Intergenic
1195914254 X:109920460-109920482 ATTACCCTGTGCTGTCAGGGGGG + Intergenic
1195938334 X:110145968-110145990 TTTACCCTGTGCGGCCACTTGGG + Intronic
1199672221 X:150156782-150156804 GTTTCCCTGTTCGGGCAGTTAGG - Intergenic
1199699683 X:150365775-150365797 TGTAGCCTAGGCGGGCAGTGAGG + Intronic