ID: 1111834754

View in Genome Browser
Species Human (GRCh38)
Location 13:93374454-93374476
Sequence TTACCCTGTGCGGGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111834748_1111834754 14 Left 1111834748 13:93374417-93374439 CCTCTCTTACGGGGTATCCTCTC 0: 1
1: 0
2: 1
3: 4
4: 49
Right 1111834754 13:93374454-93374476 TTACCCTGTGCGGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 70
1111834749_1111834754 -3 Left 1111834749 13:93374434-93374456 CCTCTCCTGCAACAGAGTCTTTA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1111834754 13:93374454-93374476 TTACCCTGTGCGGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 70
1111834750_1111834754 -8 Left 1111834750 13:93374439-93374461 CCTGCAACAGAGTCTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1111834754 13:93374454-93374476 TTACCCTGTGCGGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111834754 Original CRISPR TTACCCTGTGCGGGCAGTGT GGG Intronic
900550527 1:3252284-3252306 TGTCCCTGTGCGGGCATTGGGGG + Intronic
904010155 1:27384726-27384748 TTCCCCTGAGTGGGCAGTTTTGG - Intergenic
905902117 1:41588588-41588610 TGACCCTGGGCAGGCAGTGCTGG - Intronic
908863348 1:68516215-68516237 TTACCCTGGGTAGTCAGTGTTGG + Intergenic
914511492 1:148336215-148336237 TTACCCAGAGCTGGCTGTGTGGG + Intergenic
916501222 1:165388946-165388968 GTACCATGTGCAGGCAATGTAGG + Intergenic
1072421929 10:95296691-95296713 TGACCCTGGGCAGGCAGCGTAGG - Intergenic
1075247756 10:120839023-120839045 TTATCCTGAGCAGGCTGTGTTGG - Intergenic
1076030368 10:127152618-127152640 TTGCCCTGTGCAGGCAGCATAGG + Intronic
1076612862 10:131737377-131737399 CCAGCCTGTGGGGGCAGTGTGGG - Intergenic
1076685286 10:132195888-132195910 TCACCCTGTGTTGGCAGTGCTGG + Intronic
1077353472 11:2103785-2103807 TTTCCCTGGGCCAGCAGTGTGGG - Intergenic
1085300714 11:75456753-75456775 TTACCTTGTGCAGCCAGTGCAGG + Exonic
1093493090 12:19726466-19726488 TGAGCCTGTGAGGGCAGGGTGGG + Intergenic
1103277143 12:119721879-119721901 TTACTCCATGCAGGCAGTGTGGG + Intronic
1104910324 12:132237126-132237148 TGAGGCTGTGCAGGCAGTGTGGG + Intronic
1105242597 13:18621196-18621218 TGACCATTTGCAGGCAGTGTGGG + Intergenic
1105407868 13:20146272-20146294 TTTCCCTGTGGGGCCAGTGGAGG + Intronic
1108566565 13:51704935-51704957 TTACCCTGTACCTCCAGTGTGGG + Intronic
1111834754 13:93374454-93374476 TTACCCTGTGCGGGCAGTGTGGG + Intronic
1123488698 15:20763397-20763419 TGACCATTTGCAGGCAGTGTGGG - Intergenic
1123545197 15:21332484-21332506 TGACCATTTGCAGGCAGTGTGGG - Intergenic
1127121301 15:55774552-55774574 TTGGCCTCTGGGGGCAGTGTTGG - Intergenic
1131978099 15:97965937-97965959 GTACTGTGTGCGGGCAGTGTTGG + Exonic
1202953543 15_KI270727v1_random:59755-59777 TGACCATTTGCAGGCAGTGTGGG - Intergenic
1133993366 16:10728052-10728074 CTACCCTGTGTGGGCAGTGGAGG + Intergenic
1139441932 16:66972728-66972750 TCACCCTGTCCGGGCAAAGTGGG - Exonic
1139447490 16:67006799-67006821 TCACCCTGTGCGGGCAAAGTTGG - Intronic
1139510936 16:67428293-67428315 GTACCCTCTGCTGGCCGTGTAGG - Intergenic
1142296794 16:89229192-89229214 TGATCCTGTGTGAGCAGTGTAGG + Exonic
1142296871 16:89229986-89230008 TGATCCTGTGTGAGCAGTGTAGG + Exonic
1151671020 17:75571761-75571783 TGAGCCTGTGCGGGCAGAGCAGG + Exonic
1151713969 17:75822187-75822209 TTACCCGGTGAGGCCAGTGTGGG + Intronic
1156395002 18:36691373-36691395 TTATCCTGTGGCAGCAGTGTGGG + Intronic
1162379544 19:10323351-10323373 TGAGCCTGTGCGGGCAGAGGTGG - Intronic
1165103683 19:33456288-33456310 CTACCCTGTGCTGGCAGGGCAGG - Intronic
926308528 2:11657753-11657775 CTGGCCTGTGCGGGCAGTGCAGG + Intergenic
936456239 2:112676472-112676494 TTACCCTGTGTGGCCAATTTAGG - Intergenic
936970697 2:118173757-118173779 GTACTCTGTGGGGGCAGTGTGGG + Intergenic
945916483 2:215709883-215709905 TTAGCCTTTGAGGGCAGTATTGG - Intergenic
948936666 2:241169652-241169674 TTACCCTGTGAGGGCAGAGAGGG + Intronic
1168820236 20:768128-768150 TTACCCTATGCTGGGACTGTTGG - Intronic
1172877389 20:38173590-38173612 TGACCCTTTGGGGGCAGTGGCGG + Intergenic
1175517638 20:59579011-59579033 TTACTCTGTGCAGGCACTGGGGG - Intronic
1176188562 20:63795422-63795444 TTACATTGTGCAGGCAGTGAGGG + Intronic
1178795262 21:35738210-35738232 TTACCCTTGGCAGGCAGTGCAGG - Intronic
1178921478 21:36741700-36741722 TCACCTTGTGCTTGCAGTGTTGG + Exonic
1179967457 21:44815692-44815714 TTACCCTGTGGGGGACGTCTGGG - Intronic
1181509661 22:23383500-23383522 TGGCCCTGAGCGGGCAGAGTTGG + Intergenic
1185236736 22:49718209-49718231 TTACCCTCTGCAGTCAGTGCTGG + Intergenic
951136317 3:19107705-19107727 TGAGCCTGTGAGGGCAGTGGGGG + Intergenic
956247026 3:67195238-67195260 CTACTCTGTGCTGGCACTGTTGG - Intergenic
962251173 3:133836931-133836953 TTGCCCTGTGTGGACAGTGCTGG - Intronic
974094179 4:57344206-57344228 TTACCCTGATGTGGCAGTGTTGG + Intergenic
975124029 4:70761611-70761633 TTACACTGTGCCAGCACTGTGGG - Intronic
977435098 4:96984954-96984976 TGACCACGTGCGGGAAGTGTGGG - Intergenic
978257143 4:106705969-106705991 TTACCCTATGTGCTCAGTGTAGG + Intergenic
985085810 4:186311418-186311440 TTACCCTGTGAGGACAGGTTTGG + Intergenic
994992315 5:107012629-107012651 TTAAAATGTGCGGGCAGTCTCGG - Intergenic
997269731 5:132526583-132526605 GTACCCTGTGCGCCCAGTGTGGG + Intergenic
997681799 5:135761748-135761770 CTACCCTGTGTGGGCAGTGGAGG + Intergenic
997771553 5:136559137-136559159 TTATCCTTTGCAGGCAGTGATGG - Intergenic
999829333 5:155303948-155303970 CTTACCTGTGGGGGCAGTGTTGG + Intergenic
999938013 5:156509101-156509123 TTACACTGTGTAGCCAGTGTTGG + Intronic
1002539804 5:179898979-179899001 TTACCCTGGGTGGGCACTGGAGG - Intronic
1015980254 6:138831268-138831290 TCTCCCTGTGCAGTCAGTGTTGG + Intronic
1020846255 7:13287962-13287984 ATACCCTGTGCTGGCATTGCTGG - Intergenic
1022102734 7:27178455-27178477 TTCCCCTGTTAGGGAAGTGTTGG + Intronic
1023322594 7:39014231-39014253 TAACCCAATGCTGGCAGTGTAGG + Intronic
1023695632 7:42843392-42843414 CTCCCCTGTGCGGTCAGTGTGGG + Intergenic
1029495100 7:100892330-100892352 TGACCCTGTGCGGGCAAAGTTGG + Exonic
1033311479 7:140264996-140265018 TCACCCTGTGTGGTCAGTATAGG + Intergenic
1034683855 7:152952369-152952391 TTACTCTGACCCGGCAGTGTGGG + Intergenic
1041536217 8:58928002-58928024 TTAACTTGTCCGGGGAGTGTTGG - Intronic
1044964316 8:97560369-97560391 TCTCCCGGTGAGGGCAGTGTTGG - Intergenic
1056408389 9:86299085-86299107 TTGCGCTGTGCTGGCAGTGCGGG - Intronic
1057915799 9:99054126-99054148 TTGTCCTGTGCGGGCACTCTTGG + Intronic
1060236801 9:121869855-121869877 CTACCCTGTGGGGGCACTTTGGG - Intronic
1189372662 X:40441583-40441605 TTACACTTTGGGGGCAGGGTAGG - Intergenic
1195938335 X:110145969-110145991 TTACCCTGTGCGGCCACTTGGGG + Intronic
1197157041 X:123282315-123282337 TAGCCCTGTGAGGGCAGTGAAGG - Intronic