ID: 1111838364

View in Genome Browser
Species Human (GRCh38)
Location 13:93417560-93417582
Sequence TGAAATAACCAAAATGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 544}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111838360_1111838364 3 Left 1111838360 13:93417534-93417556 CCTCCTGTGCTGAATTACTTCTT 0: 1
1: 0
2: 3
3: 24
4: 296
Right 1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 544
1111838361_1111838364 0 Left 1111838361 13:93417537-93417559 CCTGTGCTGAATTACTTCTTTCA 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 544
1111838359_1111838364 14 Left 1111838359 13:93417523-93417545 CCAGTCTGGTTCCTCCTGTGCTG 0: 1
1: 0
2: 0
3: 26
4: 286
Right 1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111838364 Original CRISPR TGAAATAACCAAAATGAGGT GGG Intronic
902897631 1:19489833-19489855 TAAAAATACCAAAATTAGGTGGG + Intergenic
902999459 1:20254749-20254771 TGAAAATACAAAAATGAGCTGGG - Intergenic
903220708 1:21868197-21868219 TAAAATAACAAAAATTAGCTGGG - Intronic
904243938 1:29172450-29172472 TGAAATTACAAAAATTAGCTGGG - Intronic
904834217 1:33324508-33324530 TGAAGTAACCCAACTCAGGTTGG + Exonic
905946904 1:41909304-41909326 GGAAAATACCAAAATGAAGTTGG + Intronic
906276194 1:44517944-44517966 TGAAATTACAAAAATTAGCTGGG + Intronic
906308143 1:44734321-44734343 TGAAATAAGCATAATGGGCTAGG - Intergenic
907148954 1:52264155-52264177 TAAAATAACCAGAGTGAGGTGGG + Intronic
907187183 1:52618730-52618752 TGAAAATACAAAAATGAGCTGGG - Intergenic
907578056 1:55546397-55546419 TGCAATAACCAACATCAGATAGG - Intergenic
908145726 1:61240697-61240719 TGAATTAACCAAAATGACAGTGG - Intronic
908250992 1:62265590-62265612 TAAAATAACAAAAATGAGTTGGG + Intronic
908645231 1:66271203-66271225 TGAAATAACCATAATAAGCAGGG - Intronic
909626785 1:77726108-77726130 TAAAAATACAAAAATGAGGTGGG - Intronic
910339773 1:86172790-86172812 CAAAACAACAAAAATGAGGTGGG - Intergenic
910586096 1:88880846-88880868 TAAAATAACAAAAATTAGCTGGG + Intronic
910930522 1:92438836-92438858 TAAATCACCCAAAATGAGGTTGG + Intergenic
911275871 1:95856961-95856983 TGGAATAGCCAAAATGATTTTGG - Intergenic
911593699 1:99777333-99777355 AGAAATAACAAAAATTAGCTGGG - Intergenic
911744248 1:101422353-101422375 TAAAATTATTAAAATGAGGTAGG + Intergenic
911974848 1:104478802-104478824 TAAAATAAACAAAATTAGCTGGG + Intergenic
912051828 1:105539432-105539454 TGAAAAAACAAAAATTAGCTGGG + Intergenic
912145545 1:106789774-106789796 TCAAATAAGAAAACTGAGGTTGG - Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912846131 1:113076164-113076186 TGAAAATACAAAAATTAGGTGGG - Intronic
912848001 1:113094143-113094165 TGTAACAACCTAAATGAAGTAGG + Intronic
913175952 1:116273465-116273487 ACAAATAACCAAAGTGAGGAAGG - Intergenic
913191815 1:116419442-116419464 TGAAAGTACAAAAATTAGGTGGG - Intergenic
913716926 1:121544994-121545016 TGAATTAATTTAAATGAGGTAGG + Intergenic
914217631 1:145647505-145647527 TGAAATATCTAAATTGAGGCCGG + Intronic
914470198 1:147970197-147970219 TGAAATATCTAAATTGAGGCCGG + Intronic
914815740 1:151060620-151060642 TGAAAGACCCCACATGAGGTGGG + Intronic
914947189 1:152078349-152078371 TGAAAATACAAAAATTAGGTGGG - Intergenic
915223917 1:154397508-154397530 TAAAATTACAAAAATTAGGTCGG - Intergenic
915996223 1:160567042-160567064 TTTAATAACCAATATGACGTGGG + Intronic
916576613 1:166072589-166072611 TGAAATAACCATACTGGAGTCGG + Intronic
916690483 1:167185511-167185533 TAAAATTACCAAAATTAGCTGGG + Intergenic
916950021 1:169770501-169770523 AGAATTAACTATAATGAGGTAGG + Intronic
917406807 1:174715763-174715785 TGAAAGACCCAAAATGATATTGG - Intronic
917466101 1:175277601-175277623 TCAGATAACCAAAATCAGGAGGG - Intergenic
917945878 1:179970055-179970077 AGAAATAACCAAAAGAAGGGGGG - Intronic
918285374 1:183049622-183049644 TAAAATTACAAAAATGAGCTGGG - Intronic
918765559 1:188478525-188478547 TCAAACAACAAAAAAGAGGTAGG - Intergenic
919085480 1:192916343-192916365 TGATTTACACAAAATGAGGTGGG + Intergenic
919525806 1:198648854-198648876 TGTAATATCAAAAATGAGTTGGG - Intronic
919716744 1:200785983-200786005 TAAAATAACCAAAATTGGCTGGG - Intronic
920727325 1:208448322-208448344 TGAAATGAACAAAAGAAGGTGGG - Intergenic
920739965 1:208571274-208571296 TCAAATAACCATAATTATGTAGG - Intergenic
920892569 1:210004637-210004659 TTAAATAATTAAAATGAAGTAGG - Intronic
922123723 1:222701121-222701143 TGAAAATACAAAAATTAGGTAGG - Intronic
922651879 1:227347571-227347593 TAAAAATACCAAAATTAGGTGGG - Intergenic
923237548 1:232048744-232048766 AAAAAAAACAAAAATGAGGTTGG - Intergenic
923522081 1:234742878-234742900 TGAAATAATCACAAAGACGTTGG + Intergenic
923619862 1:235569726-235569748 TGAAAATACAAAAATGAGCTGGG - Intronic
923630613 1:235647651-235647673 ATAAATAAACAACATGAGGTGGG - Intronic
923837336 1:237627125-237627147 TGAAATTACCAAAATTAAGTGGG - Intronic
924389007 1:243530657-243530679 AGAAATAACCAAAATCAGAGCGG + Intronic
924427497 1:243966257-243966279 TAAAATAAGGAAAATGAAGTAGG - Intergenic
924871908 1:248056359-248056381 AGAAATAACCAAGATCAGGGTGG - Intronic
924951141 1:248884589-248884611 TTAAAAAACTATAATGAGGTGGG - Intergenic
1062869571 10:888157-888179 TGAAAATACAAAAATGAGCTGGG + Intronic
1066344602 10:34572209-34572231 TGAAAAAAGCACAATGAGGCTGG + Intronic
1068263008 10:54607983-54608005 CACAATAACCAAAATGATGTAGG - Intronic
1068577454 10:58700173-58700195 GGAAATAAACACAGTGAGGTGGG + Intronic
1069220021 10:65871544-65871566 GGAAATAAACAAAATGAGCATGG - Intergenic
1069500759 10:68950930-68950952 GGAAATAACCTGAATGAGGAGGG + Intergenic
1070020657 10:72582441-72582463 TCAAATAACCATAATGTGGCTGG + Intronic
1070254251 10:74800505-74800527 TGAAATTACAAAAATTAGCTGGG - Intergenic
1070892954 10:79956151-79956173 TAAAATCACCAAAATGGGGATGG + Intronic
1071664960 10:87545626-87545648 AGATATAACTAAAATGAGTTTGG - Intronic
1071693027 10:87842642-87842664 AGAAAATACCAAAATTAGGTGGG + Intergenic
1072439664 10:95442761-95442783 TAAAATAGCCAAAATGATTTTGG - Intronic
1072536665 10:96369598-96369620 TGAAAATACAAAAATTAGGTGGG + Intronic
1072569456 10:96645838-96645860 TGAAATAAACTAAAAAAGGTGGG - Intronic
1073241758 10:102063793-102063815 TGAAAATACAAAAATTAGGTGGG + Intergenic
1073863494 10:107773718-107773740 AGAAATAACCAAAATCAGAGTGG + Intergenic
1074480470 10:113815731-113815753 TGAAATTAGCCAAATGAGCTGGG - Intergenic
1075400932 10:122161092-122161114 AAAAATAAACAAAATTAGGTGGG - Intronic
1076046183 10:127295878-127295900 TGAAAAACCTAAAATCAGGTTGG + Intronic
1076918245 10:133437070-133437092 TAAAATTACAAAAATGAGCTGGG - Intergenic
1077528313 11:3082274-3082296 TAAAATACCCAAAAGGAGGAGGG - Intergenic
1077832882 11:5894458-5894480 TGAAATAAGCAGATTGAGGCAGG + Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079070273 11:17339146-17339168 TGAAAAAACAAAAATTAGCTGGG - Intronic
1079631460 11:22682715-22682737 TAAAAATACCAAAATTAGGTGGG + Intronic
1079878392 11:25890412-25890434 TGAAATAACAAAAATAAAGATGG - Intergenic
1080122547 11:28693938-28693960 TGTAATAAAAAAAAGGAGGTCGG - Intergenic
1080367846 11:31597860-31597882 TGAAAAGACCAAAATCAGCTGGG - Intronic
1080987115 11:37482100-37482122 TAAAATAACAAAAATGAGCCTGG + Intergenic
1081161232 11:39751799-39751821 TGAAAAAAAGAAAATAAGGTAGG + Intergenic
1081565851 11:44260708-44260730 TGTAAAAAAAAAAATGAGGTCGG - Exonic
1081745961 11:45472756-45472778 TGTAAAAAACAAAAAGAGGTGGG + Intergenic
1083152282 11:60799306-60799328 TGAAATTAGGAAAATGAGGAAGG - Intronic
1085111704 11:73895808-73895830 TGAAATTACAAAAGTGAGGCTGG + Intronic
1085148995 11:74232838-74232860 TCAAATAACAAAAATTAGCTGGG - Intronic
1087786120 11:102356354-102356376 AGAAATTACAAAAATGAGCTGGG - Intronic
1088533343 11:110834502-110834524 TGAAAGTACAAAAATTAGGTGGG - Intergenic
1088634222 11:111803970-111803992 TAAAAATACCAAAATGAGCTGGG + Intronic
1089241026 11:117079602-117079624 TGATATAAACCAAATGAGATAGG - Intronic
1090982928 11:131739264-131739286 TGAAATAAACAAAAGAAGATGGG + Intronic
1091469010 12:710423-710445 TAAAATAACCAAAAAAAGATGGG - Intergenic
1091491906 12:939912-939934 TGAAAATACAAAAATTAGGTGGG + Intronic
1091510827 12:1123832-1123854 TGAAAATACAAAAATGAGCTGGG + Intronic
1092439884 12:8491215-8491237 TGAAATAGGGAAAATGAGGGTGG - Intergenic
1092608772 12:10150236-10150258 TTAATTAACCACAATGAAGTAGG - Intergenic
1093033490 12:14311461-14311483 TGAAAATACCAAAATTAGCTGGG + Intergenic
1094206821 12:27849130-27849152 GGAAATAACCAAGATCAGGATGG - Intergenic
1094568694 12:31623129-31623151 TGAAAAAACAAAAATGAGCTGGG + Intergenic
1094649158 12:32358259-32358281 TAAAATAACAAAAATTAGCTGGG - Intronic
1095395579 12:41758604-41758626 CAACATAACCACAATGAGGTGGG - Intergenic
1095757218 12:45782469-45782491 TGAAAATACAAAAATTAGGTGGG + Intronic
1096205147 12:49715183-49715205 AAAAATAACAAAAATGAGCTGGG + Intronic
1096764832 12:53876917-53876939 TGAAATAATAAAAATTAGGGTGG + Intergenic
1096969747 12:55656166-55656188 TAAAATAACAAAAATTAGCTGGG - Intergenic
1100208764 12:92379610-92379632 TGAAAAAATTAAATTGAGGTGGG + Intergenic
1100310406 12:93389738-93389760 TAAAAGTACCAAAATGAGCTGGG + Intronic
1100999510 12:100343774-100343796 TAAAATTACCAAAATTAGCTGGG - Intergenic
1101205411 12:102482279-102482301 TGGAAAATCCAAAATGAGGGAGG + Intergenic
1101219041 12:102617502-102617524 TGAAGGAATCAAAATGAAGTTGG - Intergenic
1101263100 12:103054046-103054068 TGAATTAACTAAAATGATTTTGG - Intergenic
1102115760 12:110402013-110402035 TAAAATAACAAAAATTAGCTGGG + Intronic
1103119222 12:118366927-118366949 TAAAATTACCAAAATTAGCTGGG + Intronic
1103576584 12:121881940-121881962 TGAAAATACGAAAATTAGGTTGG - Intergenic
1103750638 12:123157781-123157803 TAAATTAACTAAAATGAGGCTGG - Intronic
1106993916 13:35458255-35458277 TGATACAATCAAAATGTGGTGGG - Intronic
1107541225 13:41390972-41390994 TGAAATCCTCAAAATGAGCTTGG + Intergenic
1107765324 13:43728141-43728163 TGAAAAAACAGAAATGAGGTGGG + Intronic
1108436942 13:50410223-50410245 TGAAATAACCAAAAACAAGGTGG - Intronic
1110088617 13:71415311-71415333 TTAAATAATCAAAATCATGTCGG - Intergenic
1111738936 13:92177378-92177400 TGAAATAAGGAAAGTGAGATGGG - Intronic
1111776680 13:92672175-92672197 AGAGATTAACAAAATGAGGTTGG - Intronic
1111838364 13:93417560-93417582 TGAAATAACCAAAATGAGGTGGG + Intronic
1112413926 13:99188795-99188817 TAAAATTACAAAAATTAGGTGGG + Intergenic
1112605495 13:100901487-100901509 TCAAGAAACCAAAATGATGTAGG - Intergenic
1113239721 13:108323535-108323557 TGAAAAAAGCAAAATGATGGAGG - Intergenic
1113641340 13:111959465-111959487 CAAACTAACCAAAATGAGGAGGG - Intergenic
1113778106 13:112960461-112960483 TGCAACAACCAAAATGAGCAGGG - Intronic
1114488980 14:23084308-23084330 TTAAAAAATCAAAATGAGGCTGG + Intronic
1115149282 14:30265526-30265548 TGAAATATCCAAGCAGAGGTTGG + Intergenic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1116051048 14:39803586-39803608 TGAAATAACCAAAATGTCCATGG - Intergenic
1116885413 14:50216255-50216277 TGAAAATACCAAAATTAGCTGGG - Intronic
1117029882 14:51657511-51657533 TGATATATCCAAATTGATGTAGG + Intronic
1117548261 14:56810309-56810331 TTAAAGAACGAAAATGAGGAAGG + Intronic
1119394488 14:74316219-74316241 TTAAAGAACCTAAATGAGGCTGG + Intronic
1119791560 14:77354791-77354813 AGAAAATACCAAAATTAGGTAGG + Intronic
1120152927 14:81057248-81057270 TGAAAAAACAAAAATTAGCTGGG + Intronic
1120630803 14:86887573-86887595 AGAAATAACCAAAATCAGAGTGG - Intergenic
1120644127 14:87051867-87051889 TGAAATAACCAAAATCAGTCAGG + Intergenic
1122457946 14:101869810-101869832 TAAAAATACAAAAATGAGGTGGG - Intronic
1122563990 14:102638504-102638526 TGAAAATACAAAAATGAGCTGGG - Intronic
1202927694 14_KI270725v1_random:5968-5990 TGAAATAACAAAAATGCGGGGGG - Intergenic
1123710622 15:22984457-22984479 TGAAAATACCAAAATTAGCTGGG + Intronic
1125813266 15:42560747-42560769 TGAAAAAACAAAAATTAGCTGGG - Intronic
1126311130 15:47318152-47318174 TGAATTAATTTAAATGAGGTAGG + Intronic
1126904473 15:53349546-53349568 GGAAATAAGCAAAATGAGCTTGG + Intergenic
1127631458 15:60831616-60831638 TCAAAATACCCAAATGAGGTGGG - Intronic
1128000727 15:64188963-64188985 TAAAATTACAAAAATGAGCTGGG + Intronic
1128201230 15:65809813-65809835 TAAAAATACCAAAATTAGGTGGG + Intronic
1130003282 15:80066734-80066756 TGAAAATACCAAAATTAGCTGGG + Intronic
1130569643 15:85030110-85030132 GGAAGTAACCAAAGGGAGGTTGG - Intronic
1130895572 15:88168137-88168159 TGGATTAACCAAAATAAGGGAGG + Intronic
1131244784 15:90781463-90781485 AAAAATAACAAAAATGAGCTGGG + Intronic
1131973729 15:97919656-97919678 TGGAATAACCAGAATGAAGTGGG + Intergenic
1133151689 16:3837453-3837475 TGAAATACAGAAAATCAGGTGGG + Intronic
1133162456 16:3921010-3921032 TAAAAATACAAAAATGAGGTGGG - Intergenic
1133520408 16:6550484-6550506 TGAAAACACGAAAATTAGGTGGG - Intronic
1133555682 16:6904438-6904460 TGAAAGTACAAAAATGAGCTAGG + Intronic
1133772039 16:8872392-8872414 TAAAATAACAAAAATTAGCTGGG + Intergenic
1134130811 16:11648738-11648760 TGAAAATACCAAAATTAGCTGGG + Intergenic
1134373730 16:13650233-13650255 TTACATAAGCAAAATGAGGTGGG + Intergenic
1135028231 16:19015122-19015144 TGAAAATACCAAAATTAGGTGGG - Intronic
1135143171 16:19939012-19939034 TGAATTAATAAAACTGAGGTGGG + Intergenic
1135248205 16:20876125-20876147 TGAAAATACAAAAATGAGCTGGG - Intronic
1135462923 16:22660732-22660754 TGAAGTTACAAAAATGAGTTTGG - Intergenic
1135905598 16:26509018-26509040 TGAAAATACAAAAATGAGCTGGG - Intergenic
1136592366 16:31225027-31225049 TGAAAATACAAAAATGAGCTGGG + Exonic
1137846503 16:51694770-51694792 AGAAATAAACAAGATGAGCTAGG + Intergenic
1138049497 16:53761255-53761277 TGAAAAAAAAAAAATGAGCTGGG - Intronic
1138174242 16:54882327-54882349 TGAAAGAACCAGAGTGAGATGGG + Intergenic
1139816486 16:69678373-69678395 TGAAAAAACAAAAATTAGCTGGG - Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140108601 16:71983822-71983844 TGAAAAAACAAAAATTAGCTGGG - Intronic
1140298937 16:73737641-73737663 TGAAATGACTAAAATGGGGCAGG - Intergenic
1141484774 16:84331461-84331483 AGTAATAATCATAATGAGGTTGG - Intergenic
1142503736 17:349506-349528 TGAAATAATCAATATGTGGTGGG - Intronic
1143568880 17:7741957-7741979 TGAAATTCCTAAAATGAGGCCGG - Intronic
1143700254 17:8653955-8653977 GGAAATATACAAAATGAGCTTGG + Intergenic
1143798814 17:9360393-9360415 AAAAATAACAAAAATGAGCTGGG - Intronic
1144820400 17:18069316-18069338 AGAAATAAAAAAAATTAGGTGGG - Intergenic
1145069495 17:19791387-19791409 TAAAATTACAAAAATTAGGTGGG + Intronic
1145896857 17:28463704-28463726 TAAAATTACAAAAATGAGCTGGG - Intronic
1146248207 17:31310407-31310429 TGAAGTAGGCAAAATGAAGTTGG + Intronic
1146567960 17:33929408-33929430 GAAAATTACCTAAATGAGGTTGG - Intronic
1146772979 17:35586102-35586124 TGAAAAAACAAAAATTAGCTGGG - Intronic
1147675841 17:42204971-42204993 TGCAGTCATCAAAATGAGGTTGG + Intronic
1147919774 17:43908578-43908600 TAAAATAAACAAAATTAGCTGGG + Intronic
1148634187 17:49134571-49134593 TAAAATAACAAAAATTAGTTGGG - Intronic
1149136951 17:53378611-53378633 TTAAATAACTAAAATCAGATTGG - Intergenic
1149282313 17:55121334-55121356 TGATGGAACCAAAGTGAGGTTGG + Intronic
1149687720 17:58546828-58546850 AGAAACAACCCAAATGAGGTGGG - Intergenic
1149755164 17:59180289-59180311 TAAAAGAACAAAAATGAGCTGGG - Intronic
1149770110 17:59314080-59314102 TGAAAATACAAAAATTAGGTGGG - Intergenic
1149945102 17:60916523-60916545 TGAAAGAACAACAATGGGGTGGG + Intronic
1150259781 17:63779557-63779579 AGAAGAAAACAAAATGAGGTGGG - Intronic
1150749463 17:67846859-67846881 TAAAATAACAAAAATTAGCTGGG - Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151291273 17:73151897-73151919 TGAAATTACAAAAATTAGCTGGG + Intergenic
1152485758 17:80591537-80591559 TAAAATTACAAAAATGAGCTGGG - Intronic
1152973813 18:193339-193361 TAAAATGTCCAAAATTAGGTGGG - Intronic
1153211276 18:2767749-2767771 TGAAAAAACAAAAATCAGCTGGG - Intronic
1154230021 18:12547779-12547801 TAAAATTACAAAAATGAGCTGGG + Intronic
1155303935 18:24460175-24460197 AGAAATAACAAAAATTAGCTGGG + Intergenic
1155361537 18:25007844-25007866 TGAGATGCCTAAAATGAGGTAGG - Intergenic
1155689737 18:28604611-28604633 TGAAAACACCAAAATTAGCTGGG + Intergenic
1155750621 18:29418645-29418667 TGAAATCACCAAAATAATTTTGG + Intergenic
1155826475 18:30450075-30450097 TTAAAAACCCAAAATGAGGAAGG - Intergenic
1155863350 18:30932580-30932602 TGAAATAGCCAAAATGGTTTTGG - Intergenic
1157016592 18:43722189-43722211 AGAAATAACCAAGATCAGATAGG + Intergenic
1157190615 18:45578329-45578351 TGCAATAACCAAAATCAAGATGG - Intronic
1157704170 18:49788577-49788599 TGAAATCATGAAAATGAGATGGG + Intronic
1158266688 18:55666742-55666764 TGAAAATACAAAAATTAGGTGGG + Intergenic
1158370805 18:56801437-56801459 TGAATTAACCAAAATGCCGAGGG - Intronic
1158428514 18:57361614-57361636 TGAAATAAAGAAAATGAGAATGG - Exonic
1158903520 18:61988215-61988237 TGAATTATCCAAACTGAGGGTGG + Intergenic
1159373995 18:67567085-67567107 TAAAATAACAAAAATGCGGCCGG - Intergenic
1160998206 19:1894826-1894848 TGAAAAAACAAAAATTAGCTGGG + Intergenic
1161135727 19:2618507-2618529 TGAAAATACAAAAATTAGGTGGG - Intronic
1162317575 19:9949362-9949384 TAAAAAAACAAAAATTAGGTGGG - Intergenic
1162673455 19:12278569-12278591 AAAAATAAACAAAATTAGGTGGG + Intronic
1163041742 19:14607870-14607892 TCAAAAAACTAAAATAAGGTTGG - Intronic
1163088466 19:15000966-15000988 TGGGATAACCCAAATTAGGTGGG - Intronic
1163298444 19:16428038-16428060 TAAAAATACAAAAATGAGGTGGG + Intronic
1164090157 19:21943672-21943694 TGAAACAAAAAAAATGAGATAGG + Intronic
1164260328 19:23563770-23563792 TAAAATAACCAAAATATGGGAGG + Intronic
1164276737 19:23725248-23725270 TGAAAATACAAAAATTAGGTGGG - Intergenic
1164682998 19:30148405-30148427 TAAAATGAGCAAAATGAGGGTGG - Intergenic
1164847797 19:31449408-31449430 TAAAAATACCAAAATTAGGTGGG - Intergenic
1166195460 19:41202938-41202960 TGAAAATACAAAAATGAGCTGGG + Intronic
1166590633 19:43995084-43995106 TAACCTAACCAAAAAGAGGTTGG - Intronic
1167018758 19:46859403-46859425 TAAAAATACAAAAATGAGGTGGG - Intergenic
1167582527 19:50354439-50354461 TGAAATCAAGAAAATGAGATGGG - Intronic
1168049854 19:53821331-53821353 TAAAATAATCACAATGAGCTGGG - Intronic
1168192024 19:54745658-54745680 TTAAAGAACTAAAAAGAGGTTGG - Intronic
1168194307 19:54762215-54762237 TTAAAGAACTAAAAAGAGGTTGG - Intronic
1168196356 19:54776936-54776958 TTAAAGAACTAAAAAGAGGTTGG - Intronic
1168204714 19:54841192-54841214 TTAAAGAACTAAAAAGAGGTTGG - Intronic
925324646 2:3008500-3008522 TGAATTATCCCAAAGGAGGTTGG - Intergenic
925878649 2:8332660-8332682 TGAAATAAACAAAAGGAGTGGGG + Intergenic
926494325 2:13565706-13565728 TAAAAAAATCAAAATGAGCTGGG - Intergenic
927334492 2:21906326-21906348 TGAAATAACTAAAATCAGAGCGG - Intergenic
927687983 2:25185664-25185686 TAAAATTACAAAAATGAGCTGGG - Intergenic
927780513 2:25935692-25935714 AGAAACAACCAAAATGGGGTTGG + Intronic
928056694 2:28063333-28063355 TGAAAGAACTAAAATGAAGTAGG + Intronic
928338476 2:30419843-30419865 TAAAATAATTAAAATGAGGCTGG - Intergenic
928728910 2:34208010-34208032 AGAAATAACCAAAATCAGAGTGG + Intergenic
929256790 2:39819809-39819831 TAAAATTACCAAAATTAGCTGGG + Intergenic
929574899 2:43045311-43045333 TGGATTAACCAAAGTGAGTTGGG - Intergenic
929887081 2:45888609-45888631 TGAAATTACAAAAATTAGCTAGG - Intronic
930611057 2:53544159-53544181 TGAAAATACAAAAATTAGGTGGG - Intronic
931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG + Intergenic
932080632 2:68711351-68711373 TAAAATCATCATAATGAGGTTGG - Intronic
932509849 2:72275291-72275313 GGAACTATTCAAAATGAGGTAGG - Intronic
933156990 2:78987153-78987175 AGAAATAACCAAATTGAAATTGG - Intergenic
933203518 2:79478526-79478548 AGAAATAACCATGATTAGGTTGG + Intronic
933482854 2:82878885-82878907 TGAAATAACCAAGATCAGAGTGG + Intergenic
933559621 2:83874411-83874433 TTCTATAACCAAAAAGAGGTTGG - Intergenic
933641199 2:84762106-84762128 TGAAAGAACCAAATTGATGTAGG + Intronic
933645876 2:84812317-84812339 TGAAAGAACAAAAAAGGGGTTGG - Intronic
934121673 2:88846152-88846174 TGTAATAACCAGTCTGAGGTGGG + Intergenic
934155017 2:89190828-89190850 TTGAATAAATAAAATGAGGTAGG - Intergenic
934212298 2:89991896-89991918 TTGAATAAATAAAATGAGGTAGG + Intergenic
935099055 2:99975037-99975059 TGAAATAACCAGGATTATGTGGG + Intronic
935254447 2:101297046-101297068 TGAAATTACAAAAATTAGCTAGG + Intronic
935297107 2:101659455-101659477 TGGAATATCCAGCATGAGGTTGG + Intergenic
936769664 2:115896138-115896160 TTATATAACCAAAATGAAATGGG + Intergenic
937683011 2:124664845-124664867 TAAAAATACAAAAATGAGGTGGG - Intronic
939101973 2:137905822-137905844 TGAAATTACAAAAATTAGCTGGG - Intergenic
939656315 2:144830546-144830568 AGAAACAACCAAGATGAGGAGGG - Intergenic
941842416 2:170100577-170100599 TGCAGTAACCAACATCAGGTAGG - Intergenic
942008314 2:171732200-171732222 TGAAAATACAAAAATGAGCTGGG + Intronic
942373202 2:175308459-175308481 AGCAATAAGCAAGATGAGGTGGG - Intergenic
942418915 2:175787429-175787451 AGAAGGAAACAAAATGAGGTAGG + Intergenic
943066838 2:183096530-183096552 TGAAAAAAACAAAATGAGGTCGG - Exonic
943362836 2:186942912-186942934 TGAAAAAACAAAAATTAGCTGGG + Intergenic
944236771 2:197448195-197448217 TAAAATAACCCAAAAGGGGTTGG - Intergenic
944246034 2:197531338-197531360 TAAAATAGCAAAAATGAGGCCGG - Intronic
944660855 2:201920424-201920446 TTAAATATAAAAAATGAGGTGGG + Intergenic
945255974 2:207803573-207803595 AGAAATAACCCAAATGGGCTGGG - Intergenic
945323078 2:208449498-208449520 AGAAATAACCAGAATTAGGTAGG + Intronic
946006797 2:216532063-216532085 AGAAATATACAAAATGAGTTTGG - Intronic
946060794 2:216939796-216939818 TGAAATAATCAAAATGTTCTGGG - Intergenic
946455863 2:219825565-219825587 TGAAATTACAAAAATTAGCTGGG + Intergenic
946786599 2:223251750-223251772 TGCAATAAGCTAAATGAGTTTGG - Intergenic
1169160376 20:3372590-3372612 TGACATAACCCAAATGAGAGAGG - Intronic
1169253580 20:4080415-4080437 TAAAATTACAAAAATGAGTTGGG - Intergenic
1169318460 20:4611942-4611964 TGACATAGCCAAATGGAGGTGGG + Intergenic
1169530069 20:6475586-6475608 TGACATCAACAAGATGAGGTAGG - Intergenic
1170072319 20:12382000-12382022 TGAAATTACAAAAATTAGCTGGG + Intergenic
1171340143 20:24421025-24421047 TGGAATCACCAATATCAGGTGGG + Intergenic
1171393326 20:24815346-24815368 TGAAATAACCCTGGTGAGGTGGG + Intergenic
1172081998 20:32349368-32349390 AGAAAAAACCAAAATGGGTTGGG - Intergenic
1172566100 20:35931788-35931810 TGAAATTACAAAAATTAGCTAGG + Intronic
1172789047 20:37489909-37489931 TGAAAATACAAAAATTAGGTGGG - Intergenic
1173237738 20:41263226-41263248 TGAAATAATGATAATGAAGTTGG + Intronic
1173280288 20:41620845-41620867 TGAAATAACATAAATGAGGTGGG + Intergenic
1174330858 20:49816257-49816279 TGAAATTACAAAAATTAGCTGGG + Intronic
1175591723 20:60198414-60198436 AGAAATAACCAAAATCAGAGTGG - Intergenic
1176589715 21:8634628-8634650 TGAAATAACAAAAATGCGGGGGG - Intergenic
1177356624 21:20016982-20017004 TGTAATAAGCTAAATGATGTTGG - Intergenic
1177479807 21:21671603-21671625 TAAGATAACCAAATTGGGGTGGG + Intergenic
1177540094 21:22481303-22481325 TGAAAATACAAAAATGAGTTGGG + Intergenic
1177641659 21:23851094-23851116 TGAAAATACCAAAATTAGCTGGG + Intergenic
1178310596 21:31526860-31526882 TAAAAATACCAAAATGAGCTTGG - Intronic
1179938548 21:44622270-44622292 AGCAAAAACCAAAATGAGATGGG - Intronic
1180272548 22:10611643-10611665 TGAAATAACAAAAATGCGGGGGG - Intergenic
1182212127 22:28685465-28685487 TGAAAAAACAAAAATTAGCTGGG + Intergenic
1182901993 22:33906163-33906185 AAAAATAAACAAAATGAGGGAGG + Intronic
1183131296 22:35839359-35839381 TGGCATAACCAAAAAGAGGCAGG + Intronic
1183560898 22:38571577-38571599 TAAAAAAACTAAAATGAGCTGGG + Intergenic
1183889996 22:40919392-40919414 TAAAATAACAAAAATTAGCTGGG + Intronic
949137574 3:587073-587095 TGAAATAACAAAAATGCCGGGGG + Intergenic
949314550 3:2737239-2737261 TGAAAATACCAAAATTAGCTGGG - Intronic
949661167 3:6280656-6280678 TGAAATAACCCAGAAAAGGTTGG + Intergenic
951930650 3:27963368-27963390 TGAAAATACAAAAATTAGGTGGG - Intergenic
952423965 3:33156199-33156221 TGAAAATACCAAAATTAGCTGGG - Intronic
953107361 3:39896917-39896939 TAAAATAACTAACATGAGGAAGG - Intronic
953495408 3:43382221-43382243 AGAAATAACCAAGATCAGGCCGG + Intronic
954234045 3:49242102-49242124 TGAAAATACAAAAATGAGCTGGG - Intronic
957314053 3:78554930-78554952 AGAAAGAACCAAAAGTAGGTAGG - Intergenic
957450224 3:80371150-80371172 TGAAAATACCAAAATTAGCTGGG + Intergenic
957938102 3:86969666-86969688 ATAAATAAATAAAATGAGGTTGG - Intronic
958121530 3:89295884-89295906 TGAAATGACAACAAAGAGGTCGG - Intronic
958951034 3:100416346-100416368 GGAAATAAACAAAATGACCTTGG - Intronic
959340938 3:105129909-105129931 AGAAATAACTAAAATCAGATTGG - Intergenic
959667323 3:108936494-108936516 TAAAGTAACAAAAATGAGGACGG + Intronic
959670693 3:108973755-108973777 AAAAATAACAAAAATGAGCTGGG - Intronic
959755210 3:109889106-109889128 TGAAATGAATAAAATGAGGAAGG - Intergenic
960086338 3:113595417-113595439 AAAAATAAACAAAATTAGGTGGG + Intronic
960265937 3:115621237-115621259 TCTAATACTCAAAATGAGGTAGG - Intergenic
960979305 3:123206925-123206947 TGAAAATACAAAAATGAGCTGGG + Intronic
961098936 3:124181943-124181965 GGAAATATCCAAACTCAGGTTGG - Intronic
961481890 3:127186176-127186198 TGAAAAAACAAAAATTAGCTGGG - Intergenic
962013941 3:131421594-131421616 TGAAATAAACAAACAGAGGGTGG - Intergenic
962562794 3:136624796-136624818 TGGCATAACCAAAGTGAGGTGGG + Intronic
962593018 3:136910340-136910362 TAAAATAACCAAAAGGGGGTAGG - Intronic
963659469 3:148105818-148105840 TGAAATAGCCAAAACGTGGAGGG - Intergenic
963754178 3:149216309-149216331 GGCAATAACCCAAATGAGCTAGG - Intronic
964114648 3:153123188-153123210 TAAAATAACAAAAATTAGCTGGG + Intergenic
964976307 3:162624114-162624136 TGAAATAATCAAACTGAGTACGG + Intergenic
965256570 3:166421468-166421490 AGAAATAACCAAAATCAGAGTGG - Intergenic
965303262 3:167031005-167031027 AGAAATAAGGAAAATAAGGTTGG + Intergenic
965546443 3:169921169-169921191 TAAAATAGGTAAAATGAGGTTGG - Intronic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
966037852 3:175442103-175442125 TGAAATTACAAAAATTAGCTGGG - Intronic
966350508 3:179028997-179029019 TAAAATAACAAAAATTAGCTGGG + Intronic
966557965 3:181284948-181284970 TTAAAACATCAAAATGAGGTGGG + Intergenic
966622921 3:181985164-181985186 AAAAATAACCAAAATTAGCTGGG - Intergenic
966921489 3:184614573-184614595 TGAATGAACAAAAATGAGGAAGG + Intronic
967618915 3:191607792-191607814 AAAAATAAATAAAATGAGGTAGG + Intergenic
968160051 3:196419104-196419126 AAAAATAACCAAAATTAGCTGGG + Intronic
968417324 4:451608-451630 TGTAATAACCAAATTGCAGTGGG - Intronic
969254546 4:5993120-5993142 TGAAATAGCCAACAGCAGGTGGG + Intergenic
969536082 4:7756795-7756817 TGAAATACCCAACATGAGCCTGG - Intergenic
971310802 4:25524160-25524182 AAAAACAACAAAAATGAGGTGGG + Intergenic
971548866 4:27923397-27923419 TCAAATAACCATACTGAGATTGG + Intergenic
972089385 4:35260952-35260974 TGAATTAATCAAAAGGAGGATGG - Intergenic
972579262 4:40380279-40380301 TTAAAATACAAAAATGAGGTGGG + Intergenic
973267876 4:48229613-48229635 TAAAATAACAAAAATTAGCTGGG + Intronic
974806298 4:66884583-66884605 TGAAATAATCACACTGAGGGAGG + Intergenic
975297856 4:72754519-72754541 AGAAATAACCAAGATTAGGGTGG + Intergenic
975315438 4:72946693-72946715 TAAAGTAACCTAAATCAGGTTGG + Intergenic
975613619 4:76224721-76224743 TAAAATAACAAAAATTAGCTGGG - Intronic
975788302 4:77918392-77918414 TGCAACAACAAAAAAGAGGTGGG - Intronic
975873467 4:78807989-78808011 GGAAATAACAAAAATTAGGGTGG - Intronic
976335823 4:83884984-83885006 TGCAATAATCAAAAGGAGGGTGG - Intergenic
976570112 4:86597396-86597418 TAAAATAAACAAAATTAGCTAGG - Intronic
976725062 4:88207838-88207860 TGAAAAAAACAAAATGAGGTTGG - Intronic
976945552 4:90762661-90762683 TGAAATAACAAAAAGGATTTGGG - Intronic
977140646 4:93367105-93367127 TGAAACAACTAAATTGAGATTGG - Intronic
977394940 4:96458866-96458888 TGAAATAACAAGCAAGAGGTTGG + Intergenic
977458053 4:97287309-97287331 TAAGATTACAAAAATGAGGTTGG + Intronic
978054450 4:104246466-104246488 AGAAATAACCAAAATCAGAATGG - Intergenic
980347735 4:131644531-131644553 TCAAATAAACAAAATGCAGTTGG - Intergenic
981878719 4:149581372-149581394 TGTAATAACTACAATGAGGGAGG - Intergenic
982577317 4:157130620-157130642 ACAAATAACCAAAATTTGGTAGG - Intronic
982646423 4:158029468-158029490 AGAAATAACCAAAATCAGAATGG + Intergenic
983632735 4:169866001-169866023 TGAAATAATCATAAGGAGATAGG + Intergenic
983689745 4:170453715-170453737 TGAAATTACCAAAATGCTGTTGG - Intergenic
983742879 4:171157414-171157436 TGAAATATGAAAAATAAGGTGGG + Intergenic
983958021 4:173719630-173719652 AGAAATAACCAAAATCAGAGAGG + Intergenic
984251259 4:177337856-177337878 TAAAAACACAAAAATGAGGTGGG + Intronic
984258153 4:177411603-177411625 TTAATTAAGCAAAATGAGCTGGG - Intergenic
984532613 4:180934960-180934982 TGAAATACAAAAAATTAGGTTGG + Intergenic
985323154 4:188736906-188736928 TGATATAATAAAAATGATGTAGG + Intergenic
986509977 5:8494202-8494224 TGAAATAACCACATTAAGCTAGG - Intergenic
989385465 5:40850915-40850937 TGAAATAGCTAAAATGAGTTAGG + Intronic
989429746 5:41338939-41338961 TAAAAGAACCAGAATGAGGGCGG - Intronic
989683532 5:44058214-44058236 TGAAATAGCCAACCTCAGGTTGG + Intergenic
989961637 5:50422787-50422809 TGAATTAATTTAAATGAGGTAGG - Intronic
990470827 5:56113808-56113830 TGAAAATACCAAAATTAGCTGGG - Intronic
991220118 5:64204574-64204596 TACAATAACCAAAAAAAGGTTGG - Intronic
991541324 5:67732503-67732525 TGAAATAACCAAAAAGAAAAAGG - Intergenic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
991967160 5:72104625-72104647 TGAAATAACAAGAATGAGAGAGG + Intergenic
993564923 5:89461947-89461969 TGAAATCAATAAAATGAGGCTGG - Intergenic
994771121 5:103982828-103982850 TGAAAAAACAAAAATTAGCTGGG - Intergenic
994854309 5:105097685-105097707 TGAAATAAACAAGTTTAGGTAGG + Intergenic
995646119 5:114314110-114314132 GGACATGAACAAAATGAGGTGGG + Intergenic
996210792 5:120807061-120807083 AGAAATAAAGAAACTGAGGTAGG - Intergenic
996598958 5:125238983-125239005 TGATAAAACCAAATTGAGGATGG + Intergenic
996978999 5:129467296-129467318 TGATATAACCAAGATTAGTTAGG + Intronic
997149763 5:131480773-131480795 TAAAATTACCAAAATTAGGCCGG - Intronic
998921282 5:147070988-147071010 TGAAAAAAATAAAATGAAGTGGG + Intronic
999124140 5:149234239-149234261 AGAAATAAGCTAAAGGAGGTGGG + Intronic
1000049977 5:157554441-157554463 TGAACTGTCCAATATGAGGTTGG - Intronic
1000652619 5:163835701-163835723 TGAAATAACTATAATGAGTATGG - Intergenic
1000803328 5:165756811-165756833 TCAAATAACTAGATTGAGGTGGG + Intergenic
1001011623 5:168104188-168104210 TGAAAAATCCAAAATTAGCTGGG - Intronic
1001031664 5:168267684-168267706 TAAAATAATAAAAATGAGGTTGG - Intergenic
1001046431 5:168375733-168375755 TAAAATTACAAAAATGAGCTGGG - Intronic
1001152780 5:169246756-169246778 TGAAAATACAAAAATGAGCTGGG + Intronic
1001637746 5:173224495-173224517 AGAAATAAGGAAAATGAGGTGGG - Intergenic
1001730624 5:173953163-173953185 TAAAATACCCAAAAGGAGCTGGG + Exonic
1001798519 5:174523022-174523044 TGAAAGAACCAAAAACAGGAAGG - Intergenic
1001967455 5:175921254-175921276 TGGAATAACTCAAATGAGATAGG + Intronic
1003196767 6:3921560-3921582 TAAAAATACAAAAATGAGGTGGG - Intergenic
1003373052 6:5547246-5547268 TAAAATAACCATTATGAGGCCGG - Intronic
1004536412 6:16506892-16506914 TGAAATAAACCAAAGGATGTAGG + Intronic
1005625814 6:27661455-27661477 TGAAAAAACAAAAATTAGCTGGG - Intergenic
1005699518 6:28386415-28386437 TGAAATAACAATAACGGGGTGGG - Intronic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005771719 6:29080354-29080376 TTAAATAACAAAAATAAGATGGG - Intergenic
1005951132 6:30632104-30632126 TGAAAATACCAAAATTAGCTGGG + Intronic
1006240804 6:32676830-32676852 AGAAATAACCAAAATCAGACTGG - Intergenic
1006394370 6:33777497-33777519 TGAAAGCCCCAGAATGAGGTTGG - Intronic
1007039012 6:38704203-38704225 TCACCTAACCAAAATGAGGTTGG + Intergenic
1008147849 6:47913119-47913141 TGACACAACCAATATGGGGTAGG - Intronic
1008289148 6:49691995-49692017 TGGAATAATCAATATTAGGTTGG - Intergenic
1008703386 6:54128696-54128718 TGGGAAAACCAAAATGAGATGGG + Intronic
1008734273 6:54523491-54523513 TAAAAATACCAAAATGAGTTGGG + Intergenic
1008770223 6:54969970-54969992 TGAAAGAATCAAAATGATTTCGG + Intergenic
1009777514 6:68223750-68223772 TGTATTCACCAACATGAGGTAGG + Intergenic
1009976269 6:70674406-70674428 TGAAATAAGCAAAAGGGGCTGGG - Intronic
1010143404 6:72637972-72637994 AGGAATAAACAAAATGAGATGGG + Intronic
1010158030 6:72817731-72817753 TAAAAGTACCAAAATTAGGTGGG + Intronic
1010208619 6:73345434-73345456 TAAAAAAGTCAAAATGAGGTGGG - Intergenic
1010394561 6:75375537-75375559 TGAGATAACCTAAAGGAGCTTGG + Intronic
1010451979 6:76013707-76013729 TGAATTAAACAAAATGTGCTGGG - Intronic
1010744911 6:79549673-79549695 TAAAATAACAAAAATCAGGGAGG + Intergenic
1011088690 6:83571103-83571125 TGAAAAAAAAAAAAAGAGGTGGG - Intronic
1011506720 6:88052674-88052696 TGAAAATACAAAAATTAGGTGGG + Intronic
1011696661 6:89919164-89919186 AAAAAAAACCAAAATGAGCTGGG - Intergenic
1011877912 6:91984806-91984828 AGCAATAACCCAAATGAGCTTGG + Intergenic
1012707142 6:102545920-102545942 TTAAATAAATAAAATAAGGTTGG - Intergenic
1012972763 6:105749216-105749238 TGAAAGCACCAAACTGAGGCTGG - Intergenic
1013058599 6:106609741-106609763 TGAACTGACAATAATGAGGTCGG - Intronic
1013595651 6:111658284-111658306 TGAAAGAAGTAAAAAGAGGTTGG + Intergenic
1013990343 6:116247473-116247495 TGAAGTAACCAAAATGGGGAAGG + Exonic
1015372698 6:132472996-132473018 AAAAATAACAAAAATTAGGTAGG + Intronic
1015392588 6:132699759-132699781 CAAAATAAACAAAATGAAGTTGG + Intronic
1015821852 6:137269790-137269812 TGATTTGCCCAAAATGAGGTGGG + Intergenic
1016658760 6:146550958-146550980 GTAAATATCCAGAATGAGGTGGG - Intronic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017746781 6:157454136-157454158 TGAGATAACCAAAGGGATGTAGG - Intronic
1018444619 6:163843966-163843988 TAAAAAAACAAAAATTAGGTGGG + Intergenic
1019653794 7:2175971-2175993 ACAAATAACCAAAATCAGGCAGG + Intronic
1019826768 7:3290997-3291019 TGAAAATACAAAAATGAGTTGGG - Intergenic
1020196489 7:6043587-6043609 TAAAAATACAAAAATGAGGTGGG - Intronic
1020249077 7:6452754-6452776 TGAAAATACAAAAATTAGGTGGG + Intronic
1021079208 7:16343426-16343448 TGAAAAAAGCAAAATAAGGTTGG + Intronic
1022920826 7:35012311-35012333 TGAATGAAGCAGAATGAGGTAGG - Intronic
1023317885 7:38959207-38959229 AGAAATAACCAAAATCAGAGTGG + Intergenic
1024426448 7:49231691-49231713 TGAAAATACAAAAATGAGCTGGG + Intergenic
1024502498 7:50126473-50126495 TGAAATAACCTATATAAGATTGG - Intronic
1025185694 7:56856568-56856590 TGAAAAAACAAAAATTAGCTGGG - Intergenic
1025264191 7:57441697-57441719 TGAAATTACAAAAATTAGCTAGG + Intergenic
1025814451 7:64898021-64898043 AGAAATCAGCAAAATGAGGCCGG - Intronic
1026472923 7:70709548-70709570 TAAAAATACAAAAATGAGGTGGG + Intronic
1026510189 7:71021039-71021061 TGAAAATACAAAAATTAGGTAGG + Intergenic
1026549369 7:71354445-71354467 TGAAAAAACTGAAATGAGTTTGG - Intronic
1026780422 7:73262907-73262929 TGAAAATACAAAAATGAGCTGGG - Intergenic
1027021281 7:74816348-74816370 TGAAAATACAAAAATGAGCTGGG - Intronic
1027066744 7:75129589-75129611 TGAAAATACAAAAATGAGCTGGG + Intronic
1027243084 7:76346004-76346026 TGAAAGAACCAGGAAGAGGTGGG - Intronic
1028212430 7:88091232-88091254 TTAAGTAAGCAAAATGAGTTTGG - Intronic
1028575858 7:92349506-92349528 TGAAATAATCAAAATGTTGATGG + Intronic
1028730326 7:94140356-94140378 TGAAAATACAAAAATTAGGTGGG - Intergenic
1029407669 7:100386088-100386110 TGAAACTACAAAAATTAGGTGGG - Intronic
1029997911 7:105027428-105027450 TGAAATGTCAAGAATGAGGTTGG - Intronic
1030387749 7:108886313-108886335 TGAATGAACCAATATGAGATAGG + Intergenic
1031096347 7:117425827-117425849 TAAAATTACCAAAATTAGCTGGG + Intronic
1032806078 7:135355655-135355677 TGGAATTACCAAGATGAGGGTGG - Intergenic
1036553569 8:9837450-9837472 TAAAATAAACAAAATTAGATGGG + Intergenic
1036703686 8:11030819-11030841 TGAAAGCCCCAAAATGAGGAGGG + Intronic
1037011242 8:13845642-13845664 AGAAATGATCAAAGTGAGGTTGG + Intergenic
1037495540 8:19437247-19437269 TGAATTAACAAAAAGGAGGGTGG + Intronic
1038072244 8:24030008-24030030 TGATATGACCAAGATGAGGAGGG + Intergenic
1038959502 8:32503434-32503456 TCAAGTAACCAAAAAGATGTCGG + Intronic
1039226725 8:35396656-35396678 TGAAAACACAAAAATTAGGTGGG - Intronic
1039619298 8:38982006-38982028 TGAAAATACGAAAATGAGCTGGG - Intronic
1039619787 8:38986011-38986033 TAAAATAAACAAAATCAGCTGGG + Intronic
1039822791 8:41148420-41148442 TTAACTAAGCAAAACGAGGTTGG - Intergenic
1040551404 8:48440281-48440303 AGAAAGAACCAACATGAGGTGGG + Intergenic
1040836279 8:51734882-51734904 TGAAATAAACATAATAGGGTTGG + Intronic
1040897002 8:52378846-52378868 TGAGATCAAGAAAATGAGGTAGG - Intronic
1042590107 8:70389824-70389846 TGAAAATACAAAAATGAGCTGGG - Intronic
1043025233 8:75058966-75058988 AGAAATAACCAAAATCAGAGAGG + Intergenic
1043035595 8:75194057-75194079 TATATTACCCAAAATGAGGTAGG - Intergenic
1043146464 8:76661634-76661656 TGAAATAACGAAAAAAAGGAAGG + Intergenic
1043234613 8:77847278-77847300 GGCAATAACCAAAGTGAGTTTGG + Intergenic
1044557163 8:93575614-93575636 TGATAAAACCAAAATGATGCAGG - Intergenic
1044563310 8:93635821-93635843 AGAAATATCCAAAATGTGGAGGG + Intergenic
1045236945 8:100360371-100360393 TGAAAATACAAAAATTAGGTGGG - Intronic
1045331993 8:101163133-101163155 TGAGACAACCCAAAGGAGGTGGG + Intergenic
1045402958 8:101836775-101836797 TTAAAAAGGCAAAATGAGGTTGG + Intronic
1045670296 8:104543759-104543781 TGAAAACACAAAAATGAGCTAGG + Intronic
1045882346 8:107056181-107056203 TGAAAAAACCTAACTGTGGTAGG + Intergenic
1046531981 8:115458024-115458046 TGAAAAGGCCAAAATGAGGGAGG + Intronic
1046691489 8:117290431-117290453 TGAAAAAACAAAAATTAGGTGGG + Intergenic
1046877451 8:119271475-119271497 TGACATAGCCAAATGGAGGTAGG - Intergenic
1047360157 8:124161813-124161835 TGCAATAACCAAAAGTAGGGTGG + Intergenic
1049106214 8:140615088-140615110 TGAAATAAACAAAAGCAGGCTGG + Intronic
1049627461 8:143631940-143631962 AGAAAAAAAGAAAATGAGGTAGG - Intergenic
1050245363 9:3683792-3683814 TGAAAATACAAAAATGAGCTGGG - Intergenic
1050984265 9:12061973-12061995 GGAAATAACTAAGATGAGGAGGG + Intergenic
1051637991 9:19198227-19198249 TGAAAAAAAAAAAATGAAGTTGG + Intergenic
1052474986 9:28947849-28947871 TGAAGTATCCCAAATGAAGTTGG - Intergenic
1052812509 9:33074164-33074186 CAAAATAATCTAAATGAGGTTGG + Intronic
1053437625 9:38087155-38087177 TGAAAATACAAAAATGAGCTGGG + Intergenic
1055084323 9:72298886-72298908 TGAAAAAATAAAAATAAGGTAGG + Intergenic
1056031815 9:82561112-82561134 TGAAAAAAGCAAAAGGAGGCCGG + Intergenic
1056486980 9:87068764-87068786 TTAAGTAGCCAAAATTAGGTTGG - Intergenic
1056636427 9:88334997-88335019 AGAAATAAACAAAATTAGTTGGG - Intergenic
1057073378 9:92119843-92119865 GGAAATAAGCAAATTGAGGAAGG - Intergenic
1057739607 9:97700077-97700099 TGAAAAAGGAAAAATGAGGTTGG + Intergenic
1057924283 9:99129737-99129759 TAAAATAACAAAAATTAGCTGGG + Intronic
1057962272 9:99468324-99468346 TGAAAATACAAAAATGAGCTGGG + Intergenic
1058013924 9:100008900-100008922 AAAAATAACAAAAATGAGCTGGG - Intronic
1058261676 9:102841053-102841075 TGAACTAACAGAAATGATGTAGG + Intergenic
1059177014 9:112176338-112176360 TGAAAAAAAAAAAATTAGGTGGG + Intergenic
1059940636 9:119356085-119356107 TGGAATAACCAATAGGAAGTAGG - Intronic
1060071779 9:120556286-120556308 TAAAATAACTAAAATGAAATAGG + Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1060701355 9:125751843-125751865 TAAGATGACCAAAAAGAGGTGGG - Intronic
1061111622 9:128576204-128576226 TTAAAACACCAAAATGTGGTTGG + Intronic
1061365231 9:130169181-130169203 TGAAAGAAGAAAAATGAGGCGGG - Intergenic
1203619732 Un_KI270749v1:113277-113299 TGAAATAACAAAAATGCGGGGGG - Intergenic
1185537862 X:876523-876545 TGAAAATACAAAAATTAGGTGGG - Intergenic
1186050067 X:5582649-5582671 TGAAATAACCATCATGATCTAGG - Intergenic
1186134512 X:6504988-6505010 TAAAAATACCAAAATGAGCTGGG - Intergenic
1186783344 X:12935479-12935501 TGAAATACCAAAAATTAGCTGGG + Intergenic
1186864577 X:13706712-13706734 TGAAAGAACCAGTAAGAGGTAGG + Intronic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1188278217 X:28228137-28228159 TGAAATAAGCAAAATTTAGTAGG - Intergenic
1189124628 X:38433305-38433327 AGAAATAACCAAAAAAAGGAGGG - Intronic
1190389523 X:49918325-49918347 TGAAAATACAAAAATTAGGTGGG - Intergenic
1191746126 X:64489462-64489484 AGAAATAACCAAGATCAGATAGG - Intergenic
1191821874 X:65319065-65319087 AGAAATAACCAAAATCAGAGTGG + Intergenic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1192347861 X:70326450-70326472 AGAAAAAAGAAAAATGAGGTAGG - Intronic
1192593009 X:72376713-72376735 AGAAATAATAAAAATTAGGTGGG - Intronic
1192955549 X:76066266-76066288 AGAAATATGCAAAATGAGCTTGG + Intergenic
1193272457 X:79545208-79545230 TGAAATTACAAAAATTAGCTGGG - Intergenic
1194517766 X:94877803-94877825 AGAAATAACCAAAATCAGAGTGG + Intergenic
1194774992 X:97952397-97952419 AGAAATAACCAAAATCAGAGTGG + Intergenic
1195409853 X:104558086-104558108 TGCAATAACACAAATGAAGTGGG + Intergenic
1195746739 X:108126210-108126232 TGTAAGAACCCAGATGAGGTAGG + Intronic
1195910342 X:109882981-109883003 TGAAAATACAAAAATTAGGTGGG - Intergenic
1195982119 X:110590522-110590544 TGACATAGACAAAATGAGGCAGG + Intergenic
1196323814 X:114377430-114377452 TGAAATAATAAAAATGAAATAGG + Intergenic
1196405105 X:115353098-115353120 TGAAATTACAAAAATTAGCTAGG + Intergenic
1198859244 X:141051920-141051942 TGAAAATACAAAAATGAGCTGGG - Intergenic
1199199991 X:145075894-145075916 TCGAATTGCCAAAATGAGGTGGG - Intergenic
1199346287 X:146745255-146745277 TGAAATAACCAAAAAGACAAGGG - Intergenic
1200214358 X:154360884-154360906 TAAAATTACCAAAATTAGCTGGG + Intronic
1201770691 Y:17614622-17614644 TTCTATAACCAAAAAGAGGTTGG + Intergenic
1201830864 Y:18291364-18291386 TTCTATAACCAAAAAGAGGTTGG - Intergenic