ID: 1111840419

View in Genome Browser
Species Human (GRCh38)
Location 13:93442688-93442710
Sequence CCAGCAAAAATGTATATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111840419 Original CRISPR CCAGCAAAAATGTATATAGC TGG (reversed) Intronic
904248652 1:29206478-29206500 TCAGCAAAAATGTGTTGAGCTGG - Intronic
908599630 1:65724922-65724944 CCAGCAAAAATGACAAAAGCAGG + Intergenic
908688376 1:66750189-66750211 CAAGCAGTAATGTATACAGCTGG + Intergenic
909409639 1:75335205-75335227 CCTGCAGAAATGTACATAACTGG - Intronic
913024675 1:114825195-114825217 ACAGCAAAACTGTATAGTGCTGG + Intergenic
913272077 1:117104171-117104193 CCAGCAAGAATGTACAAACCTGG + Exonic
916431268 1:164731375-164731397 CAAACAAAAATATAAATAGCAGG - Intronic
920876998 1:209845734-209845756 CGAGCAAAAAATTCTATAGCTGG - Intronic
921423790 1:214979021-214979043 CCAGGAAAAATGCATATGGCAGG + Intergenic
922525285 1:226297403-226297425 CCTGCAAAAATATATATATGTGG - Intronic
923155120 1:231271652-231271674 CCAGGAAATATGAATATAGAGGG + Intronic
924811883 1:247410154-247410176 CCAGAAAAAATGTGACTAGCAGG - Intergenic
1063465940 10:6244500-6244522 CCAGAAAAGCTGTATTTAGCAGG + Intergenic
1065809389 10:29427517-29427539 TCAGCAAAAAGGAATGTAGCAGG - Intergenic
1068236338 10:54238287-54238309 TCAGCAAAAATGTATAGTGATGG + Intronic
1071306896 10:84307384-84307406 CCAGGACAAGTGTTTATAGCTGG - Intergenic
1071884965 10:89939752-89939774 ACAGCAAAAATGTATGTTGGGGG + Intergenic
1073383980 10:103107284-103107306 CCATCAAAATTGTATTTTGCAGG + Intronic
1077982332 11:7312843-7312865 CATGCAAAAATGTATATGACTGG - Intronic
1078872045 11:15356761-15356783 CCTGGAAGAATGTATATAGATGG + Intergenic
1081019812 11:37931372-37931394 TCAGCAAAAAGGAATATAGTAGG - Intergenic
1082267138 11:50131341-50131363 TCAGCAAAAATGAATGTAGTAGG + Intergenic
1082288951 11:50347227-50347249 TCAGCAAAAATGAATGTAGTAGG - Intergenic
1085545727 11:77316420-77316442 CCAGCCCAGATGTATATAGAGGG + Intergenic
1085796299 11:79543085-79543107 GGAGGAAAAATGTATATACCTGG + Intergenic
1085847124 11:80078586-80078608 ACAGCAAAAAGGTATAAAGAAGG + Intergenic
1088009367 11:104980847-104980869 CCAGCAAGAGTGGATATAGGGGG - Intergenic
1088158427 11:106838622-106838644 CCAGAAAATTTGTATATAGTAGG - Intronic
1093654470 12:21678627-21678649 CCACCAGAAATGTATTCAGCTGG - Intronic
1096089012 12:48886003-48886025 CCAGAAACAAAGTTTATAGCAGG + Intergenic
1096164533 12:49410374-49410396 CCATCAAACATGTATAGAACAGG - Intronic
1096187402 12:49590544-49590566 CCATCCAAAATGTATAGACCTGG - Intronic
1099781981 12:87207339-87207361 CCAGAAAAACTGGATATAGAAGG + Intergenic
1100338327 12:93654474-93654496 TCTGCAGAACTGTATATAGCTGG + Intergenic
1100728755 12:97440442-97440464 CCAGGAAAACTGTTTCTAGCTGG - Intergenic
1103379288 12:120481401-120481423 CCAACAAAAATGTGGGTAGCTGG - Intronic
1109118293 13:58418977-58418999 AAAGCAAACATTTATATAGCTGG + Intergenic
1111376550 13:87386467-87386489 ACAGCCAAAATGAATCTAGCAGG + Intergenic
1111677032 13:91399651-91399673 CCAGCAAAGGGGTATATCGCAGG - Intronic
1111758393 13:92428836-92428858 TAAACAAAAATATATATAGCTGG + Intronic
1111840419 13:93442688-93442710 CCAGCAAAAATGTATATAGCTGG - Intronic
1113186647 13:107694302-107694324 CAAAAAAAAATGTATAAAGCAGG - Intronic
1115828450 14:37305769-37305791 CCAGGAAAAAAATATATAACTGG - Intronic
1118633611 14:67727798-67727820 CCAGCTAAAGAGTATATGGCAGG + Intronic
1120290199 14:82559286-82559308 TCACCAAAAATATATATAGATGG - Intergenic
1122045677 14:99021451-99021473 CCTGAAAAAATGTATATATTTGG + Intergenic
1124077856 15:26462552-26462574 TCAGCCAAAATGTTTATAGTGGG - Intergenic
1126248920 15:46543721-46543743 CCAGGGAAAATCTATACAGCTGG + Intergenic
1128507766 15:68288467-68288489 CCAGCAAAAATCTACTTATCAGG + Intronic
1128607990 15:69051673-69051695 ACATCAAAAATGTATGTTGCAGG - Intronic
1129749139 15:78048252-78048274 ACAGCAAAAATGTATTAAGCTGG - Intronic
1129778228 15:78251151-78251173 CCAGCCAACATGTAGCTAGCAGG + Intergenic
1130138493 15:81202069-81202091 CCAGATAAAATGTATAAAGTAGG - Intronic
1130396647 15:83508321-83508343 CCAGCAGATATCTACATAGCCGG - Intronic
1131283139 15:91037003-91037025 CTATTAAAAATGTATATAGAAGG + Intergenic
1131965984 15:97842775-97842797 CCAGCTAAAATCTGAATAGCTGG + Intergenic
1134052918 16:11149625-11149647 CCACTAAAAATATAAATAGCTGG + Intronic
1137302812 16:47169709-47169731 CCAGTAAAAAGGTGAATAGCAGG + Intronic
1138657216 16:58498406-58498428 CCAGCAATAGTGTACATAGCAGG + Intronic
1145347298 17:22049126-22049148 CCAGGAAAATGGTATATACCTGG + Intergenic
1149798872 17:59547858-59547880 CCTACAAAAATGTTTATAGTGGG + Intergenic
1150000248 17:61431441-61431463 GCAGAAAAAATGTCTATAGATGG - Intergenic
1153752744 18:8250165-8250187 CCAGCCCTAATGTATAGAGCTGG + Intronic
1156000689 18:32380756-32380778 CCACCAAAAATGTCTCTAGATGG + Intronic
1156214147 18:34978480-34978502 TCAGCAAAAGTGTAAATCGCGGG - Intronic
1161423169 19:4186840-4186862 TCAGCACATATTTATATAGCAGG + Intronic
1163365334 19:16872958-16872980 GCAGCAGAAATGTACATAGACGG - Intronic
1164055698 19:21620412-21620434 TCAGCAAAAATGAATGTAGTAGG + Intergenic
1164754948 19:30682371-30682393 CCAGCACAAATGTATATTCTGGG - Intronic
1165210745 19:34233879-34233901 TCAGCAAAAATGGATTTGGCCGG + Intergenic
931006718 2:57858107-57858129 CCAGCAAACATGGATGTAGTTGG - Intergenic
934095641 2:88601051-88601073 CCAGTAAACAAGTATATAGTAGG - Intronic
934592439 2:95567961-95567983 TCAGCAAAAAGGAATGTAGCAGG - Intergenic
935590241 2:104841688-104841710 ACAGAAAAAATGTATATAACAGG + Intergenic
937001185 2:118468901-118468923 CCAGCAATAATGATTATAACAGG - Intergenic
938659787 2:133473877-133473899 AGAGCAAAAATGCATAAAGCAGG + Intronic
940610415 2:155983487-155983509 ACAGCTAAAAAATATATAGCAGG - Intergenic
943924062 2:193748478-193748500 TCATCAAAAAAGTATATATCAGG - Intergenic
944206941 2:197166633-197166655 CCATGAAAAATGCTTATAGCAGG - Intronic
944449443 2:199826061-199826083 CCAGGAAACATGTATTTAGTAGG - Intronic
945531086 2:210953233-210953255 CCACCAAAAATGTTTATTGAAGG - Intergenic
1169843074 20:9960972-9960994 CCAGCAAAAGAGTAAATAGGAGG + Intergenic
1171350138 20:24495572-24495594 CCAGCAGCAATGTGCATAGCTGG + Intronic
1171520260 20:25770387-25770409 CCAGGAAAATGGTATATACCTGG - Intronic
1171556659 20:26086106-26086128 CCAGGAAAATGGTATATACCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173862968 20:46296408-46296430 CCAGCTAAAATGTATCCAACAGG + Intronic
1175435857 20:58947065-58947087 CAATCAAAAGTGTATATACCAGG - Intergenic
1176654396 21:9576674-9576696 CCAGGAAAATGGTATATACCTGG - Intergenic
1176959424 21:15142486-15142508 AATGCAAAAATGTACATAGCAGG + Intergenic
1177707608 21:24728172-24728194 CCAGGCAACATGTACATAGCTGG - Intergenic
1179419617 21:41224932-41224954 ACAGTAAAAATGTATCTAGTCGG + Intronic
1184559482 22:45253651-45253673 CCTGGAAAAATGTTCATAGCAGG + Intergenic
951229323 3:20158434-20158456 ACAAAAAAAATGTTTATAGCAGG - Intergenic
955820544 3:62891518-62891540 CAAGCAGAAGTGTATAAAGCGGG - Intergenic
960295861 3:115943338-115943360 CCAAGAAAGATGTATCTAGCTGG - Intronic
961300776 3:125920699-125920721 TCAGCAAAGATGTATGTAGATGG - Intergenic
961948333 3:130718075-130718097 CTAGCAAAAATGTATATTGATGG - Intronic
964836537 3:160945343-160945365 CCAGCAAAACTTTATAAAGACGG + Intronic
965215519 3:165859600-165859622 CCAGCACAAATGTTTAGAGATGG - Intergenic
965268984 3:166588351-166588373 CAAGCTAAAATGTATTTAACTGG + Intergenic
966467916 3:180252581-180252603 TCATCAAAGATGTATATAGATGG + Intergenic
971216198 4:24664297-24664319 ACAGCAACAATGGATAGAGCCGG - Intergenic
972913106 4:43843306-43843328 CTAGCAGAAATGTTTATATCTGG + Intergenic
973536298 4:51885681-51885703 CTAGGAATAATGTATATAGCAGG + Intronic
977494650 4:97759716-97759738 CCAGCAAACAAGTATTTTGCTGG - Intronic
980020476 4:127703481-127703503 CCAACACACATGTATATAGTTGG + Intronic
982395348 4:154909922-154909944 CCAGCAAATATGTATTGAACTGG - Intergenic
982395353 4:154909973-154909995 CCAGCAAATATGTATTTAACTGG - Intergenic
982403444 4:154994521-154994543 CCAGCCAGAAGGTATGTAGCTGG + Intergenic
983269393 4:165543760-165543782 CCAGCAAAAATCTCTACTGCAGG - Intergenic
985905582 5:2833045-2833067 CCAAAAAAAATTTATATAGTTGG - Intergenic
985950133 5:3216655-3216677 CCAGCCCAAATGTAGATACCTGG - Intergenic
987799098 5:22670018-22670040 CCAGCCAAAATGTATGTAACAGG + Intronic
988588183 5:32526019-32526041 CCAGCAAAATTGTAAAAAGCTGG - Intergenic
989792667 5:45424672-45424694 ACAGCAAAAATATATATAATAGG - Intronic
991109007 5:62876479-62876501 CATGAAAAAATGTATACAGCAGG + Intergenic
994568089 5:101479559-101479581 CCAGCAAATATTTATCTAGGTGG - Intergenic
996850165 5:127942721-127942743 TCAGCAAGAATGTATATTCCTGG + Intergenic
997387541 5:133485595-133485617 CAAGCAAATATGCAAATAGCAGG + Intronic
997506142 5:134418806-134418828 ACAATAAAAATGTATGTAGCAGG - Intergenic
998533943 5:142911601-142911623 TCAGCAAAAATCTATAAAGATGG - Intronic
999980006 5:156949045-156949067 CCAGCAAAAAGGAATAGAACTGG + Intronic
1001655178 5:173343770-173343792 CCAGCCACCATATATATAGCTGG + Intergenic
1004604245 6:17178952-17178974 CCAGCAAATATTCATGTAGCTGG + Intergenic
1004902772 6:20209496-20209518 TCAGCAAAAATGGAAATACCTGG - Intronic
1006274041 6:32986977-32986999 CCAGCAAAAATGCTTATCGCTGG - Intergenic
1008334322 6:50282095-50282117 CCATGAAAAATGTTTAGAGCGGG - Intergenic
1008404891 6:51107896-51107918 CCAGCAAAAATCAATCAAGCTGG - Intergenic
1010292090 6:74149251-74149273 CCAGCAGAATTGAATATTGCAGG - Intergenic
1010301748 6:74268487-74268509 CCAGAAAAAGTATATATAGATGG + Intergenic
1011156022 6:84333654-84333676 CCACCCACCATGTATATAGCTGG - Intergenic
1012176722 6:96095964-96095986 TCAGCAAAAACATATATTGCTGG - Intronic
1013215291 6:108021754-108021776 GCAGCAAAAAAGTATATAAGAGG - Intergenic
1018282305 6:162200041-162200063 ACAGCAAAATTGTATAAACCAGG - Intronic
1020427534 7:8086086-8086108 ACAGCTAAAATGTAAATGGCAGG - Intronic
1020725639 7:11810327-11810349 CCAGTACAAATGTAAATATCAGG + Intronic
1021892901 7:25204402-25204424 CCAGGAACAATCTATATATCAGG - Intergenic
1022186498 7:27974586-27974608 CCTACATAAAAGTATATAGCAGG - Intronic
1024821685 7:53338079-53338101 CTAGCAAAAAGGTAAAAAGCTGG - Intergenic
1025280755 7:57625342-57625364 CCAGGAAAATGGTATATACCTGG - Intergenic
1025303975 7:57840165-57840187 CCAGGAAAATGGTATATACCTGG + Intergenic
1026423885 7:70270233-70270255 CAAGGAAAAATGAATATGGCAGG + Intronic
1030444870 7:109637096-109637118 CTAGAAAAAATTTAAATAGCAGG + Intergenic
1030867568 7:114718150-114718172 CCACCATAAATGTATCTGGCTGG + Intergenic
1031479522 7:122261399-122261421 CCAGCTAAAATGTAGACAGTTGG + Intergenic
1032273089 7:130429317-130429339 TCAGCAAAAATGCATATGTCAGG + Intronic
1032671093 7:134083116-134083138 CCAGCAAATATGTATCTAGAAGG - Intergenic
1032984310 7:137319784-137319806 CCAGCAAAGCTGTATGAAGCTGG - Intronic
1033737924 7:144242943-144242965 CCAGCACAAATGTACAGATCTGG + Intergenic
1033745131 7:144308014-144308036 CCAGCACAAATGTACAGATCTGG - Intergenic
1035462845 7:159055791-159055813 CCAGCAAACATGTATTTGGATGG - Intronic
1036253689 8:7187183-7187205 TCAGCAAAAATGAATGTAGTAGG - Intergenic
1036363803 8:8100297-8100319 TCAGCAAAAATGAATGTAGTAGG + Intergenic
1037911449 8:22746137-22746159 TCAGCAAAAATGTCTCTTGCAGG - Intronic
1041096173 8:54352274-54352296 CCAGTAAAAATGTATCTACAAGG + Intergenic
1042568245 8:70134311-70134333 CCAACAAACATGGATATGGCAGG + Intronic
1042971569 8:74415215-74415237 ACAGCAATAATGTATATACCTGG + Intronic
1043499855 8:80842170-80842192 GCTGCAAAACTGTATAAAGCTGG + Intronic
1044874015 8:96646233-96646255 CCAACAAAAATGGAAATACCAGG - Intronic
1046955551 8:120059548-120059570 ACAGCTAAAATGCATATTGCTGG - Intergenic
1047240028 8:123078510-123078532 CCAGCAGCAATGAATATACCCGG + Intronic
1047330408 8:123881781-123881803 CCAGCAATAATGTAGATTACGGG + Intronic
1049304562 8:141894151-141894173 TTAGCAAAAATGTATTTACCTGG + Intergenic
1051127135 9:13817191-13817213 CCATTAAAAATGTTTGTAGCTGG + Intergenic
1052156297 9:25195430-25195452 CCTGAAAAAATTTATATTGCGGG + Intergenic
1052324351 9:27201146-27201168 CCTGCTAAAATGTAGATTGCTGG + Intronic
1052532290 9:29702181-29702203 TCAGCAAAAATGTACATACTTGG - Intergenic
1058026858 9:100150503-100150525 CCAGCAAATATTTTTATGGCTGG + Intronic
1058274841 9:103027186-103027208 CCACCAAAAATGTACATTGCTGG - Intergenic
1058839431 9:108891907-108891929 GCAGCAGGAATGTGTATAGCAGG + Intronic
1203632117 Un_KI270750v1:80132-80154 CCAGGAAAATGGTATATACCTGG - Intergenic
1186317078 X:8382561-8382583 CCAGCAAAAATGTAAATGTCTGG + Intergenic
1191711197 X:64151671-64151693 CCAGAAAAAATAAACATAGCAGG + Intergenic
1191883874 X:65869487-65869509 GCAGCAAAAATGTAAATGGCTGG + Intergenic
1193399468 X:81025676-81025698 GCAGCAAAAATGGATGGAGCAGG + Intergenic
1193540493 X:82766247-82766269 CCAGCTAAAATGTATATTTAAGG - Intergenic
1199338266 X:146644581-146644603 TCAGCAAAAAGGAACATAGCTGG + Intergenic