ID: 1111844928

View in Genome Browser
Species Human (GRCh38)
Location 13:93496116-93496138
Sequence GCAAGGAGGCAGCAAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6314
Summary {0: 9, 1: 431, 2: 2157, 3: 2093, 4: 1624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844928_1111844935 24 Left 1111844928 13:93496116-93496138 CCCCAGCCTTGCTGCCTCCTTGC 0: 9
1: 431
2: 2157
3: 2093
4: 1624
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844928_1111844936 30 Left 1111844928 13:93496116-93496138 CCCCAGCCTTGCTGCCTCCTTGC 0: 9
1: 431
2: 2157
3: 2093
4: 1624
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844928_1111844934 23 Left 1111844928 13:93496116-93496138 CCCCAGCCTTGCTGCCTCCTTGC 0: 9
1: 431
2: 2157
3: 2093
4: 1624
Right 1111844934 13:93496162-93496184 TAGCAATCAGCGAGAGTCCGTGG 0: 2
1: 1411
2: 1161
3: 881
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111844928 Original CRISPR GCAAGGAGGCAGCAAGGCTG GGG (reversed) Intronic
Too many off-targets to display for this crispr