ID: 1111844929

View in Genome Browser
Species Human (GRCh38)
Location 13:93496117-93496139
Sequence TGCAAGGAGGCAGCAAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6064
Summary {0: 10, 1: 430, 2: 2217, 3: 2057, 4: 1350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844929_1111844934 22 Left 1111844929 13:93496117-93496139 CCCAGCCTTGCTGCCTCCTTGCA 0: 10
1: 430
2: 2217
3: 2057
4: 1350
Right 1111844934 13:93496162-93496184 TAGCAATCAGCGAGAGTCCGTGG 0: 2
1: 1411
2: 1161
3: 881
4: 953
1111844929_1111844935 23 Left 1111844929 13:93496117-93496139 CCCAGCCTTGCTGCCTCCTTGCA 0: 10
1: 430
2: 2217
3: 2057
4: 1350
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844929_1111844936 29 Left 1111844929 13:93496117-93496139 CCCAGCCTTGCTGCCTCCTTGCA 0: 10
1: 430
2: 2217
3: 2057
4: 1350
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111844929 Original CRISPR TGCAAGGAGGCAGCAAGGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr