ID: 1111844930

View in Genome Browser
Species Human (GRCh38)
Location 13:93496118-93496140
Sequence CTGCAAGGAGGCAGCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6029
Summary {0: 12, 1: 424, 2: 2155, 3: 2012, 4: 1426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844930_1111844936 28 Left 1111844930 13:93496118-93496140 CCAGCCTTGCTGCCTCCTTGCAG 0: 12
1: 424
2: 2155
3: 2012
4: 1426
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844930_1111844934 21 Left 1111844930 13:93496118-93496140 CCAGCCTTGCTGCCTCCTTGCAG 0: 12
1: 424
2: 2155
3: 2012
4: 1426
Right 1111844934 13:93496162-93496184 TAGCAATCAGCGAGAGTCCGTGG 0: 2
1: 1411
2: 1161
3: 881
4: 953
1111844930_1111844935 22 Left 1111844930 13:93496118-93496140 CCAGCCTTGCTGCCTCCTTGCAG 0: 12
1: 424
2: 2155
3: 2012
4: 1426
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111844930 Original CRISPR CTGCAAGGAGGCAGCAAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr