ID: 1111844932

View in Genome Browser
Species Human (GRCh38)
Location 13:93496130-93496152
Sequence TCTGAGATCAAACTGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4985
Summary {0: 2869, 1: 1007, 2: 456, 3: 293, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844932_1111844935 10 Left 1111844932 13:93496130-93496152 CCTCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844932_1111844936 16 Left 1111844932 13:93496130-93496152 CCTCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844932_1111844934 9 Left 1111844932 13:93496130-93496152 CCTCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1111844934 13:93496162-93496184 TAGCAATCAGCGAGAGTCCGTGG 0: 2
1: 1411
2: 1161
3: 881
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111844932 Original CRISPR TCTGAGATCAAACTGCAAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr