ID: 1111844933

View in Genome Browser
Species Human (GRCh38)
Location 13:93496133-93496155
Sequence CAGTCTGAGATCAAACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6913
Summary {0: 3663, 1: 1439, 2: 732, 3: 491, 4: 588}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844933_1111844938 28 Left 1111844933 13:93496133-93496155 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1111844938 13:93496184-93496206 GGCGTAGGACCCTCCGAGCCAGG 0: 878
1: 1519
2: 1252
3: 938
4: 674
1111844933_1111844934 6 Left 1111844933 13:93496133-93496155 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1111844934 13:93496162-93496184 TAGCAATCAGCGAGAGTCCGTGG 0: 2
1: 1411
2: 1161
3: 881
4: 953
1111844933_1111844935 7 Left 1111844933 13:93496133-93496155 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844933_1111844936 13 Left 1111844933 13:93496133-93496155 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111844933 Original CRISPR CAGTCTGAGATCAAACTGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr