ID: 1111844935

View in Genome Browser
Species Human (GRCh38)
Location 13:93496163-93496185
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4373
Summary {0: 2, 1: 1411, 2: 1145, 3: 878, 4: 937}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844932_1111844935 10 Left 1111844932 13:93496130-93496152 CCTCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844928_1111844935 24 Left 1111844928 13:93496116-93496138 CCCCAGCCTTGCTGCCTCCTTGC 0: 9
1: 431
2: 2157
3: 2093
4: 1624
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844931_1111844935 18 Left 1111844931 13:93496122-93496144 CCTTGCTGCCTCCTTGCAGTTTG 0: 10
1: 384
2: 2118
3: 2005
4: 1354
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844933_1111844935 7 Left 1111844933 13:93496133-93496155 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844926_1111844935 28 Left 1111844926 13:93496112-93496134 CCTCCCCCAGCCTTGCTGCCTCC 0: 7
1: 379
2: 2049
3: 2270
4: 2470
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844927_1111844935 25 Left 1111844927 13:93496115-93496137 CCCCCAGCCTTGCTGCCTCCTTG 0: 9
1: 413
2: 2113
3: 2104
4: 1596
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844929_1111844935 23 Left 1111844929 13:93496117-93496139 CCCAGCCTTGCTGCCTCCTTGCA 0: 10
1: 430
2: 2217
3: 2057
4: 1350
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844925_1111844935 29 Left 1111844925 13:93496111-93496133 CCCTCCCCCAGCCTTGCTGCCTC 0: 7
1: 394
2: 2112
3: 2297
4: 2217
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844924_1111844935 30 Left 1111844924 13:93496110-93496132 CCCCTCCCCCAGCCTTGCTGCCT 0: 8
1: 395
2: 2089
3: 2275
4: 2204
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937
1111844930_1111844935 22 Left 1111844930 13:93496118-93496140 CCAGCCTTGCTGCCTCCTTGCAG 0: 12
1: 424
2: 2155
3: 2012
4: 1426
Right 1111844935 13:93496163-93496185 AGCAATCAGCGAGAGTCCGTGGG 0: 2
1: 1411
2: 1145
3: 878
4: 937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr