ID: 1111844936

View in Genome Browser
Species Human (GRCh38)
Location 13:93496169-93496191
Sequence CAGCGAGAGTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3916
Summary {0: 2, 1: 1065, 2: 989, 3: 833, 4: 1027}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111844929_1111844936 29 Left 1111844929 13:93496117-93496139 CCCAGCCTTGCTGCCTCCTTGCA 0: 10
1: 430
2: 2217
3: 2057
4: 1350
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844931_1111844936 24 Left 1111844931 13:93496122-93496144 CCTTGCTGCCTCCTTGCAGTTTG 0: 10
1: 384
2: 2118
3: 2005
4: 1354
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844928_1111844936 30 Left 1111844928 13:93496116-93496138 CCCCAGCCTTGCTGCCTCCTTGC 0: 9
1: 431
2: 2157
3: 2093
4: 1624
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844932_1111844936 16 Left 1111844932 13:93496130-93496152 CCTCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844930_1111844936 28 Left 1111844930 13:93496118-93496140 CCAGCCTTGCTGCCTCCTTGCAG 0: 12
1: 424
2: 2155
3: 2012
4: 1426
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027
1111844933_1111844936 13 Left 1111844933 13:93496133-93496155 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1111844936 13:93496169-93496191 CAGCGAGAGTCCGTGGGCGTAGG 0: 2
1: 1065
2: 989
3: 833
4: 1027

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111844936 Original CRISPR CAGCGAGAGTCCGTGGGCGT AGG Intronic
Too many off-targets to display for this crispr