ID: 1111848866

View in Genome Browser
Species Human (GRCh38)
Location 13:93546822-93546844
Sequence GTGATTTTGACTTGTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111848866 Original CRISPR GTGATTTTGACTTGTGTCTC TGG Intronic
900092486 1:926451-926473 GTGTGAGTGACTTGTGTCTCTGG + Intronic
901757941 1:11452664-11452686 GTGATTGGGACATGTGTCTTGGG + Intergenic
903922639 1:26811687-26811709 ATCTTGTTGACTTGTGTCTCAGG + Intergenic
904630617 1:31839282-31839304 GTGACTTTGACATGTGTATATGG - Intergenic
906433536 1:45775639-45775661 GGGATTTTGCCTTGTTTGTCAGG + Intergenic
906538742 1:46568652-46568674 GTGCTTTTGGTTTGTGTCGCTGG - Intronic
906578858 1:46917769-46917791 GTGATTATGACCTTTGTCTTTGG + Intergenic
907696612 1:56736605-56736627 GGGATTTTGCCATGTTTCTCAGG + Intronic
908338512 1:63152002-63152024 GGGAGTTAGACTGGTGTCTCAGG - Intergenic
909272480 1:73641676-73641698 GTGGATTTTACTTGTGTCTCTGG + Intergenic
913979132 1:143492729-143492751 GTGATTTTGCCTTGTTGCCCAGG + Intergenic
914073537 1:144318379-144318401 GTGATTTTGCCTTGTTGCCCAGG + Intergenic
914105618 1:144647981-144648003 GTGATTTTGCCTTGTTGCCCAGG - Intergenic
915778791 1:158521979-158522001 GTTATTTTGAATTCTTTCTCAGG - Intergenic
921512433 1:216048761-216048783 ATGTTTTTGATTTCTGTCTCTGG - Intronic
922601696 1:226860404-226860426 GTGATTCAGACTTGTGTATTTGG + Intergenic
1063568860 10:7196159-7196181 GTGATTTGGACTTGAATCTATGG - Intronic
1065421607 10:25550908-25550930 GAGATATTGACTTGGGTCTGTGG + Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065704443 10:28459146-28459168 GTTATTTTGAATTCTTTCTCAGG + Intergenic
1066319023 10:34281235-34281257 GTGCCTCTGACTTGTGTTTCAGG - Intronic
1067580311 10:47440937-47440959 GTGATTTTTACTTTTCTCTAAGG - Intergenic
1067668418 10:48298690-48298712 GTGATTATTAATTGTGTGTCTGG - Intergenic
1068660738 10:59620862-59620884 TTGACTTTGTCTTGTGTATCAGG + Intergenic
1070503300 10:77091310-77091332 GTGGTTTGGACTTCTGTTTCTGG + Intronic
1071149844 10:82620893-82620915 GTGCTTTTGACTGGTCTCTGTGG + Intronic
1075083817 10:119400881-119400903 GGGCTTTTGTCTTGAGTCTCTGG + Intronic
1075720168 10:124580423-124580445 TTGAATTTGACTTGTGTATATGG + Intronic
1077426025 11:2478159-2478181 GTGGGTTTGCCCTGTGTCTCCGG - Intronic
1077599932 11:3567488-3567510 CTGATTCTCATTTGTGTCTCTGG - Intergenic
1077970265 11:7181863-7181885 GTGATTTTGTCTTGCATCTTAGG + Intergenic
1078563568 11:12394285-12394307 TTGACTTTGAATTGTGTCTCTGG - Intronic
1080655746 11:34256680-34256702 GTGATTTTGCCTTGAGTGTTTGG - Intronic
1080760625 11:35245551-35245573 GTGAATTTGAATTTTGTCACTGG + Intergenic
1081852350 11:46282393-46282415 GGGATTTGAACTTGTGGCTCAGG + Intronic
1082098280 11:48149376-48149398 GTGCTTTTCCCTTGTGTATCTGG - Intronic
1084255843 11:67942107-67942129 CTGATTCTCATTTGTGTCTCTGG - Intergenic
1084816917 11:71653220-71653242 CTGATTCTCATTTGTGTCTCTGG + Intergenic
1085540476 11:77263699-77263721 CTGATTTTTCCTTTTGTCTCAGG + Intronic
1086192433 11:84095379-84095401 GTGAGTTTAACTTGTGTCCAAGG + Intronic
1088058780 11:105618676-105618698 GAGATTTGGACATGTGTGTCTGG + Intronic
1091569938 12:1676121-1676143 GTTCTTTTGTCTTCTGTCTCTGG + Intergenic
1092426080 12:8376847-8376869 CTGATTCTCATTTGTGTCTCTGG - Intergenic
1092549777 12:9485858-9485880 GATGTTTTGAGTTGTGTCTCTGG + Intergenic
1095712988 12:45309823-45309845 ATGACTTTGCCTTGTGTCTTTGG + Intronic
1096274159 12:50191332-50191354 GTGATTTTGCCATGTTTCCCAGG - Intronic
1098352897 12:69582559-69582581 GGGATTTTGCCATGTTTCTCAGG - Intergenic
1099570608 12:84312656-84312678 GTAATTTAGGCTTGTTTCTCTGG + Intergenic
1100550290 12:95640650-95640672 GTGCTCTAGACTTGTGTATCTGG + Intergenic
1101450210 12:104769356-104769378 CTGATGGAGACTTGTGTCTCTGG - Intergenic
1101631985 12:106504104-106504126 GTGATGGTGGCTTGCGTCTCGGG + Exonic
1104286736 12:127430989-127431011 GTGATTAGGACTTGTGTCCCAGG + Intergenic
1104536974 12:129627039-129627061 GTGATTGTGACTAGTGTGACAGG + Intronic
1105583431 13:21722008-21722030 GTGACTGTGACTTGTGTTTTGGG - Intergenic
1107247517 13:38314489-38314511 GGGATTTTGCCATGTTTCTCAGG + Intergenic
1109363402 13:61325257-61325279 GTGAATCTGACATGTGTCTTGGG - Intergenic
1111791189 13:92857741-92857763 GTGATTTTGATTTGCATTTCTGG - Intronic
1111848866 13:93546822-93546844 GTGATTTTGACTTGTGTCTCTGG + Intronic
1111954829 13:94745003-94745025 GTGAATGTGAATTGTTTCTCAGG - Intergenic
1112347344 13:98601290-98601312 GGGATTTTGACTTGAGCCACTGG - Intergenic
1113393365 13:109919301-109919323 CTCTTTTTGACTTGTGTGTCAGG - Intergenic
1113510083 13:110846795-110846817 GTGTTTTTGCCTTGTGTATGTGG - Intergenic
1113513589 13:110873872-110873894 GTGAATGTGACTTGTGTATCTGG - Intergenic
1113552330 13:111202347-111202369 GGCATTTTGATTTGAGTCTCTGG + Intronic
1122321125 14:100856511-100856533 GTGATTTTGAACTGTGATTCTGG + Intergenic
1122834778 14:104425301-104425323 GTGCTTTGGACGTGTGGCTCAGG - Intergenic
1130447999 15:84021978-84022000 GTGTTTTTCACTAGTGCCTCTGG - Intronic
1137633751 16:49967524-49967546 GTGATTTTGTCTTTAGTCTGGGG - Intergenic
1138941533 16:61796816-61796838 GTGACATTGGCTTGTGTCTGTGG - Intronic
1138971705 16:62152011-62152033 GTGGTTTTGATTTGTTTCCCCGG + Intergenic
1141877831 16:86838310-86838332 GTCCTTGTGAGTTGTGTCTCAGG + Intergenic
1143356123 17:6330145-6330167 GTGATTTTGACTAATCACTCTGG - Intergenic
1143356226 17:6330872-6330894 GTCATTTTGCCTGGGGTCTCTGG - Intergenic
1143861442 17:9893872-9893894 GTGGTTTTGATTTGCGTTTCCGG + Intergenic
1145021324 17:19433768-19433790 GTGATTTTGATTTTTGTTCCTGG + Intergenic
1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG + Intronic
1147950657 17:44105904-44105926 GTGATTTAAACTCATGTCTCAGG - Intronic
1151041620 17:70868158-70868180 GTTATTTTGCCTTATTTCTCAGG + Intergenic
1152359607 17:79825502-79825524 TTGATGTTGACTTTTGTCTTTGG + Intergenic
1152889850 17:82874169-82874191 GTGAGTGTGACTTCTGTCTGGGG + Intronic
1153151082 18:2094118-2094140 GGGATTTTTATTTGTCTCTCAGG - Intergenic
1153182811 18:2454860-2454882 AAGATTGTGACTTCTGTCTCAGG - Intergenic
1153191385 18:2543589-2543611 GTGATTTTGAATCCTGGCTCTGG - Intronic
1154050379 18:10950510-10950532 GTGAATATTACTTGTGTCTTTGG + Intronic
1155233324 18:23794822-23794844 ATGATTTTGATTTGTTTCTAGGG + Intronic
1156060182 18:33064490-33064512 GTGATTTTGATTTGTCTGACTGG - Intronic
1156269279 18:35516162-35516184 TTGTTTTTGACTGGTGTGTCTGG - Intergenic
1157012103 18:43662242-43662264 GTGATTTTTACTTTTCTCTGAGG - Intergenic
1157874638 18:51261002-51261024 GTGATTTTGGCCTGTCTCTAAGG + Intergenic
1158411012 18:57206219-57206241 GTGATTATGAGCTGTGTCTCTGG + Intergenic
1159283722 18:66321558-66321580 GGGATTTTGCCTTGTATCCCAGG - Intergenic
1160156004 18:76434238-76434260 GTGACTTGAACTTGTTTCTCTGG - Intronic
1163638652 19:18449625-18449647 GTGCTTTTGGGTTGTGTCTCTGG - Intronic
1165504098 19:36213810-36213832 GTGATTGTGTCCTGTGTCTCAGG - Intronic
1165708913 19:37995742-37995764 GTGAATTTGTCTTATGTCACTGG + Intronic
1165802888 19:38563695-38563717 GTGATTTTGAATTAACTCTCTGG - Intronic
1166307286 19:41941848-41941870 CTCATTTTGACTTGAGTCTGAGG - Intergenic
1166408329 19:42539658-42539680 GGGACTTTGTCTTGTGCCTCAGG - Intronic
1166800186 19:45451775-45451797 GTGGTTTGCACTTGTGTATCTGG + Intronic
926792181 2:16585121-16585143 GTGATTTCTCCTTGAGTCTCTGG - Intronic
930583082 2:53235770-53235792 GAGATTTTAACTGCTGTCTCAGG + Intergenic
931186864 2:59961001-59961023 GTCATTTAGAGTTGTGCCTCAGG - Intergenic
933155985 2:78975149-78975171 GTGATTTTGATTTGCATTTCAGG + Intergenic
934183850 2:89653810-89653832 GTGATTTTGCCTTGTTGCCCAGG + Intergenic
934294138 2:91727981-91728003 GTGATTTTGCCTTGTTGCCCAGG + Intergenic
934474502 2:94585382-94585404 TCTATTTTGACTTGTGCCTCAGG + Intergenic
934962675 2:98690591-98690613 GTGATTTTCAGTTGTGTCCAAGG - Intronic
935398065 2:102630448-102630470 ATTAATTTGACTTATGTCTCTGG + Intronic
936623582 2:114124718-114124740 GGGATTTTGACTTATGGCTGTGG - Intergenic
936819445 2:116501035-116501057 GTTATTTTGCATTGTGTATCAGG + Intergenic
942419151 2:175790366-175790388 CTGATTTAGACTTGTGTCCTAGG + Intergenic
944730285 2:202508868-202508890 ATTCTTTTGACTTTTGTCTCTGG - Intronic
947075388 2:226338242-226338264 TTTTTCTTGACTTGTGTCTCTGG - Intergenic
947322253 2:228933449-228933471 GTTATTTTGAATTCTTTCTCAGG - Intronic
1168994284 20:2121142-2121164 GAGATTTTGGCTTGTGTTTTTGG + Intronic
1169763123 20:9118673-9118695 ATGATTTTTCCCTGTGTCTCAGG - Intronic
1169939782 20:10924527-10924549 GTGGGTGTGACTTGAGTCTCTGG + Intergenic
1170217300 20:13905160-13905182 GTGATTTTGAATTAATTCTCTGG + Intronic
1170795367 20:19542324-19542346 GTCATTTTGAAATCTGTCTCTGG + Intronic
1171395508 20:24830304-24830326 GTGATATCCACTTGTGTGTCTGG - Intergenic
1173126726 20:40342897-40342919 GTTATTTTGAATTCTGTGTCAGG - Intergenic
1174554701 20:51385763-51385785 GTGATTTTGACTTTCGATTCAGG + Intergenic
1174701706 20:52616074-52616096 GAGATATTGACATGTGTGTCTGG - Intergenic
1175736996 20:61394122-61394144 GTGATGTTGGTTCGTGTCTCAGG + Intronic
1176419422 21:6502037-6502059 GTGATTTTCACTTCTGTCTGAGG + Intergenic
1176726271 21:10436736-10436758 GTGATTTTGACTTGCATTTGTGG + Intergenic
1176877270 21:14144639-14144661 GTGATTTTAACATGAGACTCTGG + Exonic
1177072664 21:16529885-16529907 GTGATGTCTACCTGTGTCTCTGG + Intergenic
1178010074 21:28274822-28274844 GTGTTTTCCACTTTTGTCTCTGG + Intergenic
1179694915 21:43110359-43110381 GTGATTTTCACTTCTGTCTGAGG + Intergenic
1180288104 22:10770371-10770393 GTGATTTTGACTTGCATTTGTGG - Intergenic
1181661982 22:24358052-24358074 GTAATTTTGAGTTGTGTCTTGGG + Intronic
949692725 3:6658890-6658912 GAGATGCTTACTTGTGTCTCAGG - Intergenic
950750697 3:15125665-15125687 CTGATTCTCATTTGTGTCTCTGG + Intergenic
950989966 3:17423552-17423574 ATAATTTTGAACTGTGTCTCTGG + Intronic
953895661 3:46797955-46797977 GTGATCTTAACTTTTGTCTTTGG - Intronic
957324164 3:78670965-78670987 ATCATTTTGACTTGTCTCTTTGG - Intronic
960322913 3:116259301-116259323 GTGTTTTTAACTCCTGTCTCTGG - Intronic
961070378 3:123918850-123918872 GTGCTATTGACTGGTCTCTCTGG - Intronic
961283341 3:125780420-125780442 CTGATTCTCATTTGTGTCTCTGG + Intergenic
963688589 3:148470248-148470270 GTGAACTTGACTTGGGTCACAGG - Intergenic
964299375 3:155271149-155271171 GTGATTATGACCTTTGTCTTTGG - Intergenic
964643529 3:158934530-158934552 GTGATTTTGAGATGTTCCTCTGG - Intergenic
964761354 3:160137532-160137554 GTGTCTTTGATTTGTGGCTCAGG - Intergenic
965020048 3:163217742-163217764 ATGACTTTGTCTTGTGGCTCGGG - Intergenic
968564451 4:1303577-1303599 GTGATGTGGACTTTTGTATCTGG - Intronic
968805838 4:2771896-2771918 GGGATTTGAACTTGTGCCTCGGG + Intergenic
969014363 4:4093813-4093835 CTGATTCTCATTTGTGTCTCTGG - Intergenic
969683575 4:8656671-8656693 GTGATTTCTACCTGTGTGTCAGG - Intergenic
969739601 4:9014608-9014630 CTGATTCTCATTTGTGTCTCTGG + Intergenic
970567597 4:17347652-17347674 GTTATTTTGGCTTTTGTCTTGGG - Intergenic
975803187 4:78084397-78084419 GTGGTTTTGACTTATTTATCAGG + Intronic
975803251 4:78085411-78085433 GTGGTTTTGACTTATTTATCAGG - Intronic
976290637 4:83413941-83413963 GTGCTTCTCACTTGGGTCTCAGG - Intronic
976608496 4:87005530-87005552 GTTATTCTGACTTGGGTATCTGG - Intronic
977002127 4:91518216-91518238 GAGATTTTCACTTGTCTCTTGGG + Intronic
977390241 4:96399859-96399881 GTGATTTTGGCTTATAACTCAGG + Intergenic
978539240 4:109798915-109798937 GAGATTTTGATTTGTTTTTCTGG - Intronic
978705758 4:111708505-111708527 GTGATATTTACTTGTGTGTACGG - Intergenic
980937310 4:139238231-139238253 GGGATATTGAATTGTGTATCAGG - Intergenic
980989082 4:139723284-139723306 GTGACTTTAATTTTTGTCTCTGG + Intronic
981162319 4:141513296-141513318 GGGGTTTTGAATTCTGTCTCTGG + Intergenic
984869165 4:184311480-184311502 GTAATTCTGACTTGTCCCTCTGG + Intergenic
985611931 5:893969-893991 GTGATTATGCCTAGCGTCTCTGG - Intronic
986775444 5:11009613-11009635 TTGATTCTGCCTTTTGTCTCTGG + Intronic
986893849 5:12341522-12341544 GAGGTTTTGACTTCTCTCTCAGG - Intergenic
987145977 5:14992269-14992291 GACATTCTGACTTTTGTCTCAGG + Intergenic
987581925 5:19805136-19805158 GGGATTTTGCCCTGTTTCTCAGG + Intronic
988244319 5:28659495-28659517 CTGATTTTTACTTTTGTGTCAGG + Intergenic
988765789 5:34374531-34374553 CAGACTTTTACTTGTGTCTCAGG - Intergenic
989073163 5:37533569-37533591 GAGATTTTGACCTTTGTCTTTGG + Intronic
991089683 5:62682248-62682270 GTTATTTTAACTTGTTTATCAGG - Intergenic
993932141 5:93953831-93953853 AGGACTTTGTCTTGTGTCTCGGG - Intronic
994530764 5:100967407-100967429 GTCAATTTGGCTTGTGGCTCAGG + Intergenic
995412346 5:111872957-111872979 GCCATTTTAACTTGGGTCTCAGG + Intronic
995443272 5:112215195-112215217 GTCCTTTTGACATGCGTCTCAGG - Intronic
995549390 5:113265833-113265855 GTGAATTTGACCTGTCTCCCGGG - Intronic
997672532 5:135687623-135687645 GAAATTGTGACTTGTGTCTAAGG - Intergenic
999479351 5:151932289-151932311 ATGATTTTAAGTTGTGTTTCAGG + Intergenic
999585852 5:153088800-153088822 CTGATTTTTCCTTTTGTCTCTGG - Intergenic
1000375563 5:160577826-160577848 GTGATTTAGAATTGTCTCTCTGG + Intronic
1001363606 5:171113710-171113732 GTGATTTTAACTTCTGTGCCAGG + Intronic
1002377098 5:178796623-178796645 GTGTTTTTGACGTGTGACTGTGG - Intergenic
1007918106 6:45580009-45580031 GTTGTTTTGATTTGTTTCTCTGG + Intronic
1008392712 6:50971442-50971464 GTGATTATGGCTTGGGCCTCTGG + Intergenic
1011923936 6:92618188-92618210 GAGATTATGACTTTTGTCTTTGG + Intergenic
1012620619 6:101339724-101339746 GGGACTTTGTCTTGTATCTCAGG - Intergenic
1013129412 6:107217675-107217697 GTGAATTTGCCCTGTGACTCAGG + Intronic
1013668543 6:112373664-112373686 AAGATTTTCACTTCTGTCTCTGG - Intergenic
1014099430 6:117494313-117494335 TTGATATTGACTTTTCTCTCTGG - Intronic
1015320666 6:131870074-131870096 GTGTGTTTTACTTGTGTGTCAGG + Intronic
1015333469 6:132007981-132008003 GTGATTTTGTCCTGTGATTCAGG - Intergenic
1018043793 6:159948384-159948406 GTGATTTTCACTTTTCTCTGAGG + Intergenic
1018236465 6:161728753-161728775 GTGGTTTTGCCTTGTGCCCCAGG - Intronic
1020989097 7:15173475-15173497 TTAATTTTGACTTGTGTTACAGG - Intergenic
1022036694 7:26541447-26541469 GTGATTCTGAAGTATGTCTCAGG - Intergenic
1022184079 7:27949897-27949919 ATAATTTTGACCTGTGTCTGAGG - Intronic
1023922521 7:44640626-44640648 GTGACTTTGCCCTGTGTTTCTGG + Intronic
1024599487 7:50967483-50967505 GGGATGTTGAATTGTGTATCAGG + Intergenic
1026609439 7:71844739-71844761 CTGCTTTTGACATTTGTCTCAGG - Intronic
1027465800 7:78513507-78513529 CTGATTTTCACCTGTGTCCCTGG - Intronic
1028265725 7:88722196-88722218 GTAATTTAGAATTGTGTCTGGGG + Intergenic
1029073035 7:97915450-97915472 GTGATTCTCATTTGTGTCTCTGG - Intergenic
1032230352 7:130068708-130068730 GTGGTTTTGCCTTGTTGCTCCGG - Intergenic
1032393689 7:131573965-131573987 TTGATTCTGGCTTGGGTCTCTGG - Intergenic
1033506422 7:142006811-142006833 GTGGTTTTGACTATTGTTTCTGG + Intronic
1034324115 7:150214159-150214181 GTGATTTTGAATTTTATCTTGGG - Intergenic
1034603835 7:152291328-152291350 GTGATTTTGACTTGCATTTGTGG - Intronic
1034660104 7:152761201-152761223 CTGATTTTGGCTTGTGTTTTAGG - Intronic
1034769080 7:153755077-153755099 GTGATTTTGAATTTTATCTTGGG + Intergenic
1035332703 7:158106719-158106741 ATGATTTTCACTAGTGTCCCAGG + Intronic
1036244644 8:7105818-7105840 CTGATTCTCATTTGTGTCTCTGG + Intergenic
1036256088 8:7207898-7207920 CTGATTCTCATTTGTGTCTCTGG - Intergenic
1036361398 8:8079601-8079623 CTGATTCTCATTTGTGTCTCTGG + Intergenic
1036889577 8:12587422-12587444 CTGATTCTCATTTGTGTCTCTGG - Intergenic
1038294287 8:26276816-26276838 ATGTTTCTGCCTTGTGTCTCTGG - Intergenic
1038452156 8:27646660-27646682 GTGGTTCTGACTGGGGTCTCTGG + Intronic
1038725623 8:30079934-30079956 GTGATTTTGATTTATGAGTCTGG - Intronic
1040611486 8:48987849-48987871 GTGATTTTGAGTATTGACTCTGG + Intergenic
1041076737 8:54175988-54176010 TTGATTTTGACCTGTTTCTACGG - Intergenic
1041156935 8:54997319-54997341 GGGACTTTGACATGTTTCTCTGG - Intergenic
1041961663 8:63624340-63624362 ATGTTTTTGACTTTTGTCTTGGG + Intergenic
1043322156 8:79000940-79000962 GTGATTATGATTTGTGCCTCTGG + Intergenic
1044000157 8:86869599-86869621 GTCTCTTTGACTTCTGTCTCAGG + Intronic
1047533130 8:125695309-125695331 ATGTGTTTGACTTGAGTCTCAGG + Intergenic
1048123062 8:131603335-131603357 GTGACATTTACTTGTGCCTCTGG + Intergenic
1050643079 9:7689944-7689966 CTGATCTTGAATTGTGTCACTGG + Intergenic
1050752585 9:8958099-8958121 GGGATCTTGACTGGTCTCTCAGG - Intronic
1050841548 9:10155904-10155926 GTCTTTTTGTGTTGTGTCTCTGG + Intronic
1050842706 9:10172240-10172262 GAGATTTTGACTTGTCCTTCAGG - Intronic
1051329047 9:16004275-16004297 GAGATTTTAACTAGTGTGTCAGG + Intronic
1052124856 9:24762757-24762779 GTGCTTCTGTCTTGTGTCTTGGG + Intergenic
1052367047 9:27624090-27624112 GTGATTGTAACTGGTTTCTCTGG + Intergenic
1052616011 9:30842918-30842940 GTGATTTTGACTGGTATCTTAGG + Intergenic
1052973957 9:34398592-34398614 GAGATTTTCCCTGGTGTCTCAGG + Exonic
1052999010 9:34567080-34567102 GTGATTTAATCTTTTGTCTCTGG + Intronic
1053039530 9:34857950-34857972 GTTCTTTTGAATTGTTTCTCTGG + Intergenic
1053279953 9:36813836-36813858 CTAATTTTGACTGGTGTTTCAGG + Intergenic
1053683564 9:40500720-40500742 TCTATTTTGACTTGTGCCTCAGG - Intergenic
1053933546 9:43129037-43129059 TCTATTTTGACTTGTGCCTCAGG - Intergenic
1054280149 9:63124201-63124223 TCTATTTTGACTTGTGCCTCAGG + Intergenic
1054296668 9:63336217-63336239 TCTATTTTGACTTGTGCCTCAGG - Intergenic
1054394685 9:64640723-64640745 TCTATTTTGACTTGTGCCTCAGG - Intergenic
1054429333 9:65145923-65145945 TCTATTTTGACTTGTGCCTCAGG - Intergenic
1054501048 9:65875608-65875630 TCTATTTTGACTTGTGCCTCAGG + Intergenic
1055186902 9:73468028-73468050 TTGATTTTTTCTTGTTTCTCTGG + Intergenic
1055363488 9:75520185-75520207 TTGATTTGGACATGTGGCTCAGG - Intergenic
1055940644 9:81646000-81646022 GTGATTTTTACTTGATTCCCTGG - Intronic
1056208790 9:84345098-84345120 GTGATGTTGAATTATGTGTCAGG - Intergenic
1058876562 9:109249878-109249900 GTCATTCTGCCTTTTGTCTCTGG - Intronic
1060266477 9:122114420-122114442 GTGAGTTTGAGTTTTATCTCAGG + Intergenic
1185592076 X:1283928-1283950 GTGGTTTTGATTTGCGTTTCCGG + Intronic
1185952265 X:4450307-4450329 GTGTTTTTCACTTGAGGCTCAGG + Intergenic
1187456033 X:19442061-19442083 GTGGTGTTGACTTGTGTATTAGG - Intronic
1187986537 X:24819423-24819445 GTTATTCTGACTTGGGTATCTGG - Intronic
1188235162 X:27719634-27719656 GGGATTTTGACATGTTGCTCAGG + Intronic
1188501974 X:30837016-30837038 GTCATTTTGCCTTCTGTCTTTGG - Intronic
1189767063 X:44382736-44382758 GTGGTTTTGACATGTTTCCCAGG - Intergenic
1190874837 X:54452438-54452460 GTGATTTTAATGTGTGTATCAGG - Intronic
1193339686 X:80333385-80333407 ATCATTTTGACTTCTGTCTTTGG - Intergenic
1193742399 X:85232734-85232756 ATGACTTTGACTTGTGGCTTGGG + Intergenic
1193917232 X:87379888-87379910 GGGTTTTTTACTTGAGTCTCTGG + Intergenic
1194058419 X:89165709-89165731 GTGATTATGTCTTTTGTCTTTGG - Intergenic
1194493267 X:94577765-94577787 GTGATTTTTCCTTCTGTCCCAGG - Intergenic
1195744702 X:108105055-108105077 GTTATTTTGACTTCTTTTTCAGG + Intronic
1195972806 X:110491874-110491896 GAGATTATGACTTTTGTCTTTGG + Intergenic
1196949021 X:120857410-120857432 GAGATTATGACTTTTGTCTTTGG - Intergenic
1197360024 X:125490291-125490313 TTGATTTTGATGTCTGTCTCAGG + Intergenic
1198256494 X:134928564-134928586 GTTATTTAGACTTGAGTATCTGG + Intergenic
1198510340 X:137344073-137344095 GTGATTTTGAATTGGATTTCTGG + Intergenic