ID: 1111852741

View in Genome Browser
Species Human (GRCh38)
Location 13:93597520-93597542
Sequence TTCAAACATATGTTGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1806
Summary {0: 2, 1: 3, 2: 69, 3: 621, 4: 1111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111852741 Original CRISPR TTCAAACATATGTTGCTCAA GGG (reversed) Intronic
900961612 1:5925492-5925514 TTCATAATTATGTTTCTCAAAGG + Intronic
902108039 1:14054199-14054221 TTCAAACTTATGTTGTTCTAAGG + Intergenic
902492251 1:16791828-16791850 TTCAAACCCATGTTGCTCAAGGG + Intronic
902568229 1:17329673-17329695 TTCAAACCTGTGCTGTTCAAGGG + Intronic
903410488 1:23139395-23139417 TTCAAACCCATGTTGTTCAAGGG - Intronic
904087680 1:27921213-27921235 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
904257721 1:29266854-29266876 TTCAAACCTGTGATGTTCAAAGG - Intronic
904801513 1:33096346-33096368 TTCAAACCTGTGTTGTTTAAGGG + Intronic
905418937 1:37825597-37825619 TTCAAATGCATGTTGTTCAAGGG - Intronic
905567141 1:38974562-38974584 TTGAAACCTGTGTTGCTCAAGGG + Intergenic
905848043 1:41250369-41250391 TTCAAAACCATGTTGTTCAAGGG + Intergenic
905948581 1:41925608-41925630 TTCAAGCTCATGTTGTTCAAGGG + Intronic
906229056 1:44145236-44145258 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
906277668 1:44529259-44529281 TTCAAATATATGTTTTTAAATGG - Intronic
906397733 1:45481465-45481487 TTCAAACCCGTGTTGTTCAAGGG - Intronic
906452964 1:45967762-45967784 TTCAAACCTGTGTTGTTCAAAGG + Intronic
906503689 1:46361245-46361267 TTCAAACATGTGCTACTCACTGG - Intronic
907020555 1:51062450-51062472 CTCAAACCCATGTTGTTCAAGGG + Intergenic
907039939 1:51250454-51250476 TTCAACTCTATGTTGTTCAAAGG - Intronic
907118192 1:51988112-51988134 TTCAAACCCATGCTGTTCAAAGG + Intronic
907168017 1:52432143-52432165 TTCAAACCTGTTTTGTTCAAGGG + Intronic
907643430 1:56215879-56215901 TTCAAACCCATGTTGTTCAAGGG + Intergenic
907775974 1:57515508-57515530 TTCAAATATTTGTTGCTCTGAGG - Intronic
907887809 1:58609799-58609821 TTCAAACCCATGTTGCTTAAGGG - Intergenic
907967191 1:59343576-59343598 TGCAGACATATGTTGCTTAAGGG + Intronic
908264627 1:62366074-62366096 TTCAAACCTGGGTTGTTCAAGGG + Intergenic
908281465 1:62541392-62541414 TTCAAACCCATGCTGTTCAAGGG - Intronic
908371689 1:63487298-63487320 TTCAAACCCATGTTGTTCAAGGG + Intronic
908514046 1:64874237-64874259 TTCAAACCCATGCTGTTCAAGGG - Intronic
908579587 1:65500403-65500425 TTCAAACTCATGTTGTTTAAGGG - Intronic
908963056 1:69725341-69725363 TTCAAACCTGTGTTGTTCAAGGG + Intronic
909142570 1:71887324-71887346 TTCAAATTTATGTTGTTCAAGGG + Intronic
909218207 1:72919657-72919679 CTCAAACCTGTGTTGTTCAATGG - Intergenic
909283313 1:73785048-73785070 TTCAGTCATTTGTTGCTCCAGGG - Intergenic
909320092 1:74274376-74274398 TTCAAACCTGTGTTGTTCAAGGG + Intronic
909487359 1:76188900-76188922 TTCAATCCCATGCTGCTCAAGGG + Intronic
909816644 1:80002686-80002708 TTGAAACCCATGTTGCTCAAGGG - Intergenic
909835358 1:80247888-80247910 TTCAAACCTGTGTTGTTGAAGGG + Intergenic
909854559 1:80512024-80512046 TTCAAACCCATGTTGTTCTAAGG - Intergenic
910052712 1:82994508-82994530 TTCAAACCTATGTTGCTCAAGGG + Intergenic
910274790 1:85437339-85437361 TTCAAACCCATGTTGTTCAAGGG - Intronic
910315624 1:85879860-85879882 TTCAAACCCGTGTTGTTCAAGGG + Intronic
910412211 1:86958526-86958548 TTCAAACCCATGTTGTTCAAGGG + Intronic
910421562 1:87069227-87069249 TTCAAATCCATGTTGTTCAAGGG + Intronic
910457896 1:87417432-87417454 TTCAAACCCATGTTGTTCAAGGG + Intergenic
910484285 1:87695337-87695359 TTCAAACCCATGTTGTTCAAGGG - Intergenic
910733709 1:90427955-90427977 TTCAATCCTGTGTTGTTCAAGGG + Intergenic
910781999 1:90948720-90948742 TTCAAGCTCATGTTGTTCAAGGG + Intronic
910892050 1:92028772-92028794 TTCAAACACATGTTGTTTGAGGG - Intergenic
911076602 1:93881628-93881650 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
911143818 1:94533580-94533602 TTCAAACCCATGTTGTTCAGGGG - Intronic
911258514 1:95660479-95660501 TTCAGAAATATGTTTCTAAAAGG + Intergenic
911266309 1:95748621-95748643 TTCAAACCCATGTTGTTCAAAGG - Intergenic
911349343 1:96733717-96733739 TTCAAAATCATGTTGTTCAAGGG - Intronic
911590567 1:99743323-99743345 TTCAAACCTGTGTTGTTCAAGGG - Intronic
911646609 1:100343674-100343696 TTCAAATCAATGTTGTTCAAGGG - Intergenic
911722030 1:101201909-101201931 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
911812754 1:102304526-102304548 TTCAAACCCATGTTGTTCAAGGG - Intergenic
911989253 1:104671316-104671338 TTCAATAATATATTGTTCAATGG - Intergenic
912279144 1:108294925-108294947 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
912289082 1:108399432-108399454 TTCAAACCTGTGTTGTTCAAGGG - Intronic
912500451 1:110118573-110118595 TTCAAACCCATGTTGTTCAAGGG + Intergenic
912536659 1:110378540-110378562 TTCAAAAAGCTGATGCTCAATGG - Intronic
912538324 1:110393061-110393083 TTCAAACATATGTTTCATAGAGG + Intergenic
912840831 1:113037743-113037765 TTCAAACCCATGTTGTTCAAGGG - Intergenic
912859560 1:113201204-113201226 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
913127049 1:115801452-115801474 TTCAAACTCCTGTTGTTCAACGG - Intergenic
913206848 1:116546799-116546821 CTCAAACCCATGTTGTTCAAGGG - Intronic
913296365 1:117324593-117324615 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
914315162 1:146503909-146503931 TTCAAACCCATGTTGTTCAAGGG + Intergenic
914329397 1:146652180-146652202 TTCAAACTCATGTTGTTCAAGGG + Intergenic
914499192 1:148229467-148229489 TTCAAACCCATGTTGTTCAAGGG - Intergenic
914732815 1:150387212-150387234 TTCAAACTTGTGTTGTTCAAGGG + Intronic
915067324 1:153236281-153236303 TTCAAACCGATGTTGTTCAAGGG + Intergenic
915834118 1:159160817-159160839 TTCAAATCCATGTTGTTCAAGGG + Intergenic
916152173 1:161805186-161805208 TTTAAAAATATGTAGGTCAACGG - Intronic
916157163 1:161864222-161864244 TTCAAACTTGTGTTGTTCAAGGG - Intronic
916726873 1:167531520-167531542 TTCAAACTCATGTTGCTCAAGGG + Intronic
916772429 1:167924729-167924751 TTCAAACCTGTGTTATTCAAGGG - Intronic
916784542 1:168076389-168076411 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
916951822 1:169788187-169788209 TTCAAATTCATGTTGTTCAAGGG - Intronic
917016278 1:170534285-170534307 TTCAAACTTGTGTTGTTCAAGGG - Intronic
917071342 1:171154629-171154651 TTCAAACCTGTGTTGTTCAAAGG - Intronic
917381505 1:174414287-174414309 TTCAAACTCATGTTGTTCAAGGG + Intronic
917736739 1:177928111-177928133 TTCAAACTCATTTTGTTCAAGGG + Intronic
917824478 1:178803006-178803028 TTCAAACCCATGTTGTTCAAGGG + Intronic
917984909 1:180306324-180306346 TTCACACCTATGTTGTTCAAGGG + Intronic
918002043 1:180506540-180506562 TTCAAACTTGTGTTGTTCCAGGG - Intergenic
918023749 1:180721618-180721640 ATCACATCTATGTTGCTCAAGGG - Intronic
918033263 1:180838397-180838419 TTCAAACCCATATTGTTCAAGGG + Intronic
918170519 1:181992441-181992463 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
918271871 1:182909533-182909555 TTCAAACCCATGTTGTTCAAGGG - Intronic
918275224 1:182947521-182947543 TTGGAACATGTGTTGTTCAAGGG - Intronic
918826615 1:189331998-189332020 TTCAAACCTGTGTCACTCAAGGG + Intergenic
918999870 1:191816640-191816662 TTCAAACCAGTGTTGCTCAAGGG - Intergenic
919331056 1:196172351-196172373 TTCAAACTCATGTTGTTCAAGGG - Intergenic
919365622 1:196657365-196657387 TTCAAGCACATATTGGTCAAGGG - Intronic
919422964 1:197394036-197394058 TTCAAACCCATGTTGTTCTAGGG - Intronic
919426353 1:197436439-197436461 TTCAAACATGTGTTGTTCAAGGG + Intronic
919458989 1:197854505-197854527 TTCAAACCCATGTTGTTCAAGGG + Intergenic
919479522 1:198070622-198070644 TTCAAACCTGTGTTGCACAAGGG + Intergenic
919507051 1:198412334-198412356 TTCAAACCCATGTTGCTCCTGGG + Intergenic
919538047 1:198812916-198812938 TTCAGACTCATGTTGTTCAAGGG - Intergenic
919649139 1:200128292-200128314 TTCAAACCTGTGTTGTGCAAGGG + Intronic
919717462 1:200794243-200794265 TTCAAACTCATGTTGTTCAAGGG - Intronic
920277339 1:204816317-204816339 TTCAAACCCATGTTATTCAAGGG + Intergenic
920533531 1:206722671-206722693 TTCAAACCTGGGTTGTTCAAGGG + Intronic
920733658 1:208512010-208512032 TTCACACCCATGTTGTTCAAGGG + Intergenic
920788719 1:209067722-209067744 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
920799182 1:209171687-209171709 ATAAAACACATGTTCCTCAAAGG - Intergenic
920894171 1:210027603-210027625 TTCAAACTCCTGTTGTTCAAGGG + Intronic
921003779 1:211071829-211071851 TTCAAACCCATGTTATTCAAGGG + Intronic
921148173 1:212378757-212378779 TTCAAACCTGTGTTGTTCAAGGG - Intronic
921155627 1:212436131-212436153 TTCAAACCTGTGTTGTTCAAGGG + Intronic
921387346 1:214583640-214583662 TTCAAACCCATGTTGTTCAAGGG - Intergenic
921484115 1:215696360-215696382 TTCAAACCTGTGTTGTTCAAGGG + Intronic
921539995 1:216402405-216402427 TTCAAACCTGTGTTGTTCAAAGG - Intronic
921597957 1:217075173-217075195 TTCAAACCCATGTTGTTCGAGGG + Intronic
921778408 1:219130586-219130608 TTCTTTCATATGTTGCTGAAAGG + Intergenic
921812628 1:219531875-219531897 TTCAAACTCATGTTGTTCAAGGG - Intergenic
922238644 1:223740227-223740249 TTCAAACAGAGGTGACTCAATGG - Intronic
922773548 1:228203926-228203948 TGCAAACCTATGTTGTTCAAGGG - Exonic
922793314 1:228322725-228322747 TTCAAATGCATGTTGTTCAAAGG + Intronic
922857767 1:228789830-228789852 TTCAAACCCGTGTTGTTCAAGGG + Intergenic
922939916 1:229454046-229454068 TTCAAGCTCATGTTGTTCAAGGG + Intronic
922949385 1:229545740-229545762 TTCAGACCAATGTTGTTCAAAGG - Intronic
922986290 1:229868424-229868446 TTCAAACCCGTGTTGCTCAAAGG - Intergenic
923093429 1:230756565-230756587 TTCAAACTCATGTTGTTAAAGGG - Intronic
923095161 1:230769698-230769720 TTCAAGCCTGTGTTGCTCAAGGG - Intronic
923113686 1:230914195-230914217 TTCGAACCCATGTTGTTCAAGGG - Intronic
923161263 1:231316833-231316855 CTCAAACCTATGTTGCTCACTGG - Intergenic
923330465 1:232918872-232918894 TTCAAACCCATGTTGTTCAAGGG + Intergenic
923378431 1:233390257-233390279 TTCAAACTTCTGTTGTTCAAGGG - Intergenic
923399813 1:233605948-233605970 CTCAAACTCATGTTGTTCAAAGG + Intergenic
923424594 1:233856173-233856195 CTCAAACCCATGTTGTTCAAGGG - Intergenic
923474838 1:234322620-234322642 TTCAAACCCATGTTGTTCAAGGG + Intronic
923507939 1:234622612-234622634 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
923510777 1:234650591-234650613 TTCAAGCCCATGTTGTTCAAGGG + Intergenic
923528197 1:234790709-234790731 TTCAAACCCATGTTGCTCAAGGG - Intergenic
923689024 1:236175379-236175401 TTCAAACCTGTATTGCTCAAGGG + Intronic
923802505 1:237224104-237224126 TTCAAACATACGTTACTCAAGGG - Intronic
923815264 1:237370592-237370614 TTGAAACCTGTGTTGTTCAAGGG + Intronic
923880231 1:238095738-238095760 TTCCAACATGTGTTGTTCAATGG - Intergenic
923920662 1:238560985-238561007 TTGAAACCCATGTTGCTCAAGGG - Intergenic
923993472 1:239465748-239465770 TTCAAACCCACGTTGTTCAAGGG - Intronic
924029744 1:239874337-239874359 TTCAAACCTGTGTTGTTCGAGGG - Intronic
924071814 1:240288471-240288493 TTCCAACTTGTGTTGCTCTATGG - Intronic
924143561 1:241050582-241050604 TTCAAACCCATGTGGTTCAAGGG - Intronic
924226299 1:241924487-241924509 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
924389621 1:243539120-243539142 TTCAATCTCATGTTGTTCAAGGG - Intronic
924495032 1:244579585-244579607 TTCAAACATGTGTTGTTCAAGGG + Intronic
924810612 1:247398346-247398368 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1063085239 10:2811373-2811395 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1063195468 10:3737650-3737672 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1063350556 10:5350628-5350650 TTCAAATTTGTGTTGTTCAAGGG + Intergenic
1063584417 10:7338709-7338731 TTCAAACTCGTGTTGTTCAAGGG + Intronic
1063644783 10:7868144-7868166 TTCAAAGCCATGTTGTTCAAGGG + Intronic
1063818030 10:9799404-9799426 TTCAAACCTGTATTGTTCAAGGG + Intergenic
1063832343 10:9968086-9968108 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1064576959 10:16756369-16756391 TTCAAACCCATGTTGCTCAAGGG - Intronic
1064700182 10:18010787-18010809 TTCAAACCCATGTTGTTCTAGGG - Intronic
1064729166 10:18311779-18311801 TTCAAATCTGTGTTGTTCAAGGG + Intronic
1064859658 10:19814555-19814577 TTCAAACCCCTGTTGTTCAAGGG + Intergenic
1064963775 10:20994958-20994980 TTCAAACCCTTGTTGCTCAAGGG + Intronic
1065171116 10:23030468-23030490 TTCAATCTCATGTTGCTCAAGGG + Intronic
1065223535 10:23520229-23520251 TTCAAACCCAAGTTGTTCAAGGG + Intergenic
1065397799 10:25259164-25259186 TTCAAACATGTGTTGTTCAAGGG + Intronic
1065446295 10:25805025-25805047 TTCAAACACATGTTGTTCAAGGG - Intergenic
1065505569 10:26427048-26427070 TTCAAAGCCATGTTGTTCAAGGG - Intergenic
1065506352 10:26433763-26433785 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1065572504 10:27085709-27085731 TTCAAACCTATATTGTTCAAGGG - Intronic
1065628177 10:27652553-27652575 TTCAAGCCTGTGTTGTTCAAGGG + Intergenic
1065646192 10:27836132-27836154 TTCAAACTCATGCTGTTCAAGGG + Intronic
1065648038 10:27857062-27857084 TTTAAACTTTTGTTGTTCAAGGG - Intronic
1065679900 10:28218540-28218562 TTCAAACATATGTTAGTCACAGG + Intronic
1065707593 10:28484984-28485006 TTCAAACCCATGTTTTTCAAGGG + Intergenic
1065794209 10:29291456-29291478 TTCAAACCCATGTTGTTCAAGGG + Intronic
1065911704 10:30312212-30312234 TTGAAACCCATGTTGTTCAATGG - Exonic
1065948347 10:30627305-30627327 TTCAAACCCATGATGTTCAAGGG - Intronic
1066011564 10:31199056-31199078 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1066120641 10:32283133-32283155 TTCAAACCCATGTTATTCAAGGG - Intronic
1066129759 10:32381451-32381473 CTCAAACCTGTGTTGTTCAAGGG + Intergenic
1066221868 10:33343143-33343165 TTCTAACCTGTGTTGTTCAAGGG + Intergenic
1066304576 10:34128200-34128222 TTCAAACTCATGGTGTTCAAGGG - Intronic
1066340897 10:34532360-34532382 TTCAAACACAAGTTGTTCAAGGG + Intronic
1066514591 10:36143462-36143484 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
1066578502 10:36852946-36852968 TTCAAACTTGTGTTGTTCAGGGG - Intergenic
1066627504 10:37422546-37422568 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1066648781 10:37636589-37636611 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1067025858 10:42843631-42843653 TTCAGACTTGTGTTGTTCAAGGG + Intergenic
1067031674 10:42882287-42882309 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1067164241 10:43852610-43852632 TTGAAACCTGTGTTGTTCAAGGG + Intergenic
1067169054 10:43890955-43890977 TTCAAACCTATTTTGTTCAAGGG - Intergenic
1067506785 10:46860586-46860608 TTCAAACCTATATGGTTCAAAGG + Intergenic
1067933464 10:50587157-50587179 TTCAAACCAGTGTTGTTCAAGGG - Intronic
1068267698 10:54674807-54674829 TTCAAACTCATGTTGTCCAAGGG + Intronic
1068393517 10:56430060-56430082 TTCAAACCTATGTTGTTCAAAGG - Intergenic
1068584249 10:58778677-58778699 TTCAAATCCATGTTGTTCAAGGG + Intronic
1068588260 10:58825259-58825281 TTCAAATCCATGTTGTTCAAGGG - Intronic
1068680293 10:59811868-59811890 TTCAAACCCGTGTTGTTCAAGGG + Intronic
1068806542 10:61200982-61201004 TTCAAGCCTGTGTTGTTCAAGGG + Intergenic
1068824562 10:61420452-61420474 TTCAAACTCATGTTATTCAAAGG + Intronic
1069021932 10:63498857-63498879 TTCAGAGAGTTGTTGCTCAATGG - Intergenic
1069023084 10:63511344-63511366 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1069074478 10:64024005-64024027 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1069096475 10:64265535-64265557 TTCAAACCTGTGTTGTTAAAGGG + Intergenic
1069116943 10:64519084-64519106 TTCAAACTTGTGTTGTTCAGGGG + Intergenic
1069185062 10:65412001-65412023 GTCAAACTCATGTTGTTCAAAGG + Intergenic
1069225740 10:65942035-65942057 TTAAAATATATGTTTCACAAGGG + Intronic
1069243699 10:66174539-66174561 TTCAAACCCATGTTGTTCAAGGG - Intronic
1069266040 10:66458944-66458966 TTCAGACCCATGTTGTTCAAGGG - Intronic
1069357794 10:67607618-67607640 TTCAAACCAGTGTTGTTCAAAGG + Intronic
1069612099 10:69780866-69780888 TTCAAACCCATGTTCTTCAAGGG - Intergenic
1069677889 10:70261510-70261532 TTCAAACCCATGTTGTTCAAGGG + Intronic
1069732697 10:70629071-70629093 TTCAAACCTGTCTTGTTCAAAGG - Intergenic
1069890582 10:71649793-71649815 TTCAAACAGGTGCTGTTCAAGGG + Intronic
1070061451 10:72987322-72987344 TTCAAACCCATGTTGTTTAAGGG + Intergenic
1070119157 10:73559042-73559064 TTCAAACCCGTGTTGTTCAACGG + Intronic
1070353787 10:75619260-75619282 TTGAAACCCATGTTGTTCAAGGG + Intronic
1070367175 10:75748982-75749004 TTCAAACCCATGTTGTTTAAGGG - Intronic
1070578756 10:77702634-77702656 TTCAAACCCATGTTGTTTAAAGG - Intergenic
1070858940 10:79633278-79633300 TTCAAACCTATATTGTTCAAAGG + Intergenic
1071174052 10:82902747-82902769 TTCAAACCCATGTTGTTCAAGGG - Intronic
1071466371 10:85943654-85943676 TTCAAACTCATGCTGTTCAAGGG + Intronic
1072171449 10:92866067-92866089 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1072472750 10:95729142-95729164 TTCAAACTTGAGTTGTTCAAAGG + Intronic
1072478752 10:95789517-95789539 TTCAAACCTGTGTTGTGCAAGGG - Intronic
1073078863 10:100843951-100843973 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1073173138 10:101530135-101530157 TACTAACAAATGTTGCTCACTGG + Intronic
1073640150 10:105244303-105244325 TTCAAACCCTTGTTGTTCAAGGG - Intronic
1073709933 10:106024883-106024905 TTCAAACCCATGTTTTTCAAGGG - Intergenic
1073965439 10:108983651-108983673 TTCAAATTTGTGTTGTTCAAAGG + Intergenic
1074026510 10:109641367-109641389 TTCCAATATATTTTTCTCAAAGG - Intergenic
1074179041 10:111041122-111041144 TTCAAACCCATGTGGTTCAAGGG + Intergenic
1074589734 10:114801445-114801467 TTCAAACCCATGTTGTTTAACGG + Intergenic
1074593219 10:114834804-114834826 TTCAAACCCATGTTGTTCAAGGG - Intronic
1074676477 10:115856908-115856930 TTCAAACCCATGTTGTTCAAGGG - Intronic
1074910234 10:117901865-117901887 TTCAAATCTATGTTTTTCAAAGG + Intergenic
1074934725 10:118166713-118166735 TTCAAAGCCATGTTGTTCAAGGG - Intergenic
1074969614 10:118525253-118525275 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1075133549 10:119762142-119762164 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1075218330 10:120559572-120559594 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1075238529 10:120755651-120755673 TTTAAAAATATGTTGCTCCCAGG - Intergenic
1075288376 10:121206757-121206779 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1075300709 10:121321402-121321424 TTCGAACCCATGTTGTTCAAGGG + Intergenic
1075573882 10:123564406-123564428 TTTAAACTTGTGTTGTTCAAGGG - Intergenic
1075749483 10:124753676-124753698 TTCAAACCCATGTTGTTCAAGGG - Intronic
1075833642 10:125433555-125433577 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1076098910 10:127758105-127758127 TTCAAACCCAGGTTGTTCAAGGG - Intergenic
1076464392 10:130668401-130668423 TTCAAAAATAGCTTGCTTAATGG - Intergenic
1077622508 11:3739819-3739841 TTCAAACTTGTGTTGTTCAAAGG - Intronic
1077699719 11:4430375-4430397 TTCAAACCCATGTCGTTCAAAGG - Intergenic
1078207520 11:9243414-9243436 TTGAAACCCATGTTGTTCAAGGG - Intronic
1078434409 11:11312594-11312616 TTCAAACCCATGTTGTTCAAGGG + Intronic
1078477837 11:11647964-11647986 TTTAAACCTGTGTTGTTCAAGGG - Intergenic
1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG + Intronic
1078781036 11:14439745-14439767 TTCAATCCCATGTTGTTCAAGGG - Intergenic
1078820263 11:14872905-14872927 TTCGAACCCATGTTGTTCAAGGG + Intergenic
1078825158 11:14922935-14922957 TTCACACCCATGTTGTTCAAGGG + Intronic
1078906123 11:15689489-15689511 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1079227843 11:18623225-18623247 TTCAAACCTATGTTGTTGAAGGG + Intronic
1079233663 11:18671608-18671630 TTTAAACTCATGTTGTTCAAGGG - Intergenic
1079449627 11:20588531-20588553 TTCAAAGCCATGTTGTTCAAGGG + Intergenic
1080106119 11:28513050-28513072 TTCAAACTCATGTTTTTCAAGGG + Intergenic
1080106480 11:28516612-28516634 TTAAATCATATGTTCCTCAAGGG - Intergenic
1080272481 11:30465725-30465747 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1080591735 11:33729897-33729919 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1081015231 11:37870075-37870097 TTCAAACCTGTGTTGCTCAAAGG - Intergenic
1081362978 11:42202758-42202780 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1081441260 11:43084050-43084072 TTCAAACCTGTGTTGTTAAAGGG + Intergenic
1081479772 11:43475100-43475122 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1081514281 11:43810004-43810026 TTTAAAAATATGTTGCCTAATGG - Intronic
1081922070 11:46787805-46787827 TTCAAACCCATGTTGTTCAAGGG - Intronic
1081925986 11:46829136-46829158 TTCAAATCCATGTTGTTCAAGGG - Intronic
1081942701 11:46957954-46957976 TTCAAATCCATGTTGTTCAAGGG - Intronic
1082171706 11:49012743-49012765 TTCAAACCCTTGTTGCTTAAGGG - Intergenic
1082232951 11:49791590-49791612 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1082730922 11:56796517-56796539 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1082759395 11:57112531-57112553 TTCAAACCTGTATTGTTCAAGGG - Intergenic
1082930465 11:58598437-58598459 TTCAAAGCTTTGTTGTTCAAGGG + Intronic
1082954357 11:58853239-58853261 TTCACACCTATGTTGTTCAAGGG - Intronic
1083010465 11:59392641-59392663 TTCAAAACCATGTTGTTCAAGGG - Intergenic
1083016194 11:59456910-59456932 TTCTAACATATCTTCATCAAAGG + Intergenic
1083370675 11:62177120-62177142 TTCAAACCCATGTTGCTCAAGGG - Intergenic
1084058449 11:66653190-66653212 TTCAAACCCTTGTTGTTCAATGG - Intronic
1084158433 11:67329682-67329704 TTCAAACCCATGCTGTTCAAGGG - Intronic
1084471781 11:69365868-69365890 TTCAAACCCCTGTTGTTCAAGGG + Intronic
1084702039 11:70793163-70793185 TTCAAACCCATGTTGTTCAAGGG - Intronic
1084754978 11:71232429-71232451 TTCAAACCTGTGTTGCTTAAGGG - Intronic
1085973347 11:81621481-81621503 TTCAAACTGATATTGTTCAAGGG - Intergenic
1086078896 11:82882253-82882275 TTCAAACCCATGTTGTTCTAGGG + Intronic
1086478381 11:87204839-87204861 TTCATACTCATGTTGTTCAAGGG + Intronic
1086566907 11:88237637-88237659 TTTAAACTTGTGTTGTTCAAGGG - Intergenic
1086587372 11:88470450-88470472 TTTAAACCCATGTTGTTCAAGGG + Intergenic
1086617676 11:88842324-88842346 TTCAAACTCATGTTGTTCAAGGG + Intronic
1087140793 11:94763853-94763875 TTCAAACCTGTGTTGTGCAAGGG + Intronic
1087241159 11:95782266-95782288 TTCAAACCTGGGTTGTTCAAGGG - Intronic
1087344631 11:96955913-96955935 TTCAAACCTATGTTGTTCAGGGG + Intergenic
1087392196 11:97550776-97550798 TTCTTTCATATGTTGCTAAAGGG - Intergenic
1087417919 11:97882430-97882452 TTTAAACCTATGTTGTTCAAGGG - Intergenic
1087785923 11:102354103-102354125 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1087853421 11:103060358-103060380 TTCAAACTCATGCTGTTCAAGGG - Intergenic
1087876148 11:103360135-103360157 TTATAGAATATGTTGCTCAAAGG + Intronic
1087939377 11:104076705-104076727 TTCAAACCTATGTTGTTCAAGGG - Intronic
1088158363 11:106837719-106837741 TTCAAATCTGTGTTGCTCAATGG + Intronic
1088295035 11:108283848-108283870 TTCAAACCCATGTTTTTCAAGGG + Intronic
1088544036 11:110942016-110942038 TTCAAACCCATGTTGCTCAAAGG + Intergenic
1088860784 11:113797342-113797364 TTCAAACCTGTGTTTTTCAAGGG - Intergenic
1088940580 11:114451265-114451287 TTCAAACCTGTGTTGTCCAACGG - Intergenic
1088965224 11:114713625-114713647 TTCAAACCCCTGTTGTTCAAGGG + Intergenic
1089029617 11:115311582-115311604 TTCAAACACATGTTGTTCAAGGG + Intronic
1089545867 11:119224962-119224984 TTCAAACCCATGTTGTTGAAGGG + Intronic
1089661176 11:119986549-119986571 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
1090108626 11:123879781-123879803 TTCAAACCTGTGTTGCTCAAGGG + Intergenic
1090491853 11:127170417-127170439 TTCAAATATGAGTTTCTCAAGGG + Intergenic
1090685503 11:129113685-129113707 TTCAAACCCATGTTGTTCAAGGG + Intronic
1090849250 11:130557362-130557384 TTCAAACCTGTGTTGTTCAGCGG + Intergenic
1091107729 11:132938533-132938555 TGCACACATATGTTGCTTTATGG + Intronic
1091371276 11:135060842-135060864 TTCAAATCCATGTTGTTCAAAGG + Intergenic
1091411380 12:242167-242189 TTCAGATCCATGTTGCTCAAGGG - Intronic
1092248829 12:6880173-6880195 GTCAAACATTTGTTGCTAAAAGG + Intronic
1092266635 12:6986154-6986176 TTCAAAATTGTGTTGATCAAGGG - Intronic
1092812081 12:12280934-12280956 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1093125262 12:15321800-15321822 TTCAAACCCGTGTTGTTCAAGGG + Intronic
1093144607 12:15550447-15550469 TTCAAACTCATTTTGTTCAAGGG + Intronic
1093204297 12:16228554-16228576 TTCAAACCCATGTTGTTCAAGGG - Intronic
1093442804 12:19219040-19219062 TTCAAATCTGTGTTGTTCAAGGG - Intronic
1093508058 12:19892408-19892430 TTTAAACATATGTTGTGAAAGGG + Intergenic
1093601210 12:21025993-21026015 TTCAAACCTGTGCTGTTCAAAGG - Intronic
1093682573 12:22019699-22019721 TTCAAACACATGCTGCTCAAAGG - Intergenic
1093684022 12:22036011-22036033 TTCAAACATGTGTTGTTCAAGGG - Intergenic
1093698405 12:22189650-22189672 TTCAAACTTTTGTTGTTCAAGGG - Intronic
1093762562 12:22926325-22926347 TTCAAATCTGTGTTGTTCAAGGG - Intergenic
1093805253 12:23424353-23424375 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1093957038 12:25232120-25232142 CTCAAACGCATGTTGTTCAAGGG + Intronic
1094190201 12:27690129-27690151 TTCAAACTCATGTTCTTCAAGGG - Intronic
1094377593 12:29807197-29807219 TTCAAACTTTTGTTGTTCAAGGG + Intergenic
1094678515 12:32646615-32646637 TTCAATCCTGTGTTGTTCAAGGG + Intergenic
1095120165 12:38407594-38407616 TTCAAACGCATGTTGTTCAAGGG - Intergenic
1095333252 12:40994590-40994612 TACAAACATATGCAGCTCTAGGG + Intronic
1095429711 12:42120077-42120099 TTCAAATCTATCTTTCTCAATGG - Intronic
1095433131 12:42155998-42156020 TTAAAACCCATGTTGTTCAAGGG + Intergenic
1095471739 12:42544144-42544166 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1095529054 12:43163135-43163157 TCCAAACCCATGTTGTTCAAGGG - Intergenic
1095610410 12:44121326-44121348 TTCAAACCCATGTTGTTCAATGG - Intronic
1095769049 12:45930958-45930980 TTAAAACCTATGTTGTTCAAGGG + Intronic
1095769874 12:45941797-45941819 TTCAAACACATGTTGTTCAAGGG - Intronic
1096568765 12:52505676-52505698 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1096899561 12:54861277-54861299 TTCAAACCTGTGTTGTTCCAGGG + Intergenic
1097354427 12:58585693-58585715 TTCAAACCTGTGTTATTCAAAGG - Intronic
1097533886 12:60840406-60840428 CTCAATCACATGTTGCTTAAGGG - Intergenic
1097564081 12:61246484-61246506 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1097730878 12:63126776-63126798 TTCAAACCTATATTGTTCAGTGG - Intergenic
1098061052 12:66563089-66563111 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1098353738 12:69590067-69590089 TTCAAACCCATGTTGTTCAATGG - Intronic
1098365374 12:69698080-69698102 TTCAAATATATATTGGCCAATGG - Intronic
1098450889 12:70617068-70617090 TTCAAAACCATGTTGTTCAAGGG + Intronic
1098487415 12:71037511-71037533 TTCAAACTACTGTTCCTCAAAGG - Intergenic
1098542544 12:71673397-71673419 TTCAAACCTATGTTGTTAAAGGG + Intronic
1098635240 12:72775975-72775997 TTCAAACCTGTGCTGTTCAAGGG + Intergenic
1098701993 12:73640165-73640187 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1098869386 12:75800217-75800239 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1098876081 12:75867621-75867643 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1098884504 12:75946704-75946726 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
1098986050 12:77013578-77013600 TTCAAACCCATGTTGTTCTAGGG - Intergenic
1099460392 12:82914010-82914032 TTCAAACCTATGTTGTTCAAGGG + Intronic
1099466385 12:82993325-82993347 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1099730794 12:86498277-86498299 TTCAAACCTCTGTTGTTCAAGGG - Intronic
1099745613 12:86699999-86700021 TTCAAATCTATGTTGTTCAGGGG + Intronic
1099783584 12:87232194-87232216 TGCAAACATATGTTCATAAATGG - Intergenic
1099890407 12:88582710-88582732 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1099999384 12:89814657-89814679 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1100144139 12:91656634-91656656 TTCAAACCCATGTTGTTCAGTGG - Intergenic
1100821332 12:98433393-98433415 TTTAAACCTGTGTTGTTCAAGGG - Intergenic
1101009259 12:100432027-100432049 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1101076765 12:101138081-101138103 TTCAAACCTGTGTTGTTCCAAGG - Intergenic
1101367610 12:104089561-104089583 TTCAAACTCATGTTGTTGAAGGG + Intronic
1101773598 12:107774372-107774394 TTCCAACATATGTTGTTTTATGG - Exonic
1102226021 12:111228791-111228813 TTCAAACTTACGCTGTTCAAGGG + Intronic
1102773833 12:115501901-115501923 TTCAAGTATATGTAGCTCAAGGG + Intergenic
1102938019 12:116913746-116913768 TTCAAACCCATGTTGTTCAAGGG + Intronic
1103160326 12:118723776-118723798 TTCAAGCCTGTGTTGTTCAAAGG - Intergenic
1103806850 12:123580489-123580511 TTCAAACCTGCGTTGTTCAAGGG - Intergenic
1103985585 12:124765306-124765328 CTCAAACATCTGTTCCTGAAAGG + Intergenic
1104093697 12:125537238-125537260 TCCAAACCCATGTTGTTCAAGGG + Intronic
1104135019 12:125929414-125929436 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1104184403 12:126415870-126415892 GTCAAACCCATGTTGTTCAAGGG - Intergenic
1104195525 12:126533734-126533756 TTCAAATATTTATTGCTCAATGG + Intergenic
1104826995 12:131718977-131718999 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1104982228 12:132578533-132578555 TTCAAACCCATGTTGTTCAAGGG + Intronic
1105397651 13:20054945-20054967 TTCAAATCCATGTTGTTCAAGGG - Intronic
1105398034 13:20059635-20059657 TTCAAACTCTTGTTGTTCAAGGG - Intronic
1105398643 13:20066730-20066752 TTCAAACCCATGTTGCTCAAGGG + Intronic
1105457185 13:20552078-20552100 TTCAAACTCATGTTGTTCAGAGG + Intergenic
1105486242 13:20835700-20835722 TTCAAACCTGTGTTATTCAAGGG - Intronic
1105775926 13:23660050-23660072 TTCAAACCCGTGTTGCTTAAGGG + Intronic
1105888776 13:24666768-24666790 TTCAAACTGATGTTGTTCAAGGG + Intergenic
1106219998 13:27738533-27738555 TTCAAATCCATGTTGTTCAAGGG - Intergenic
1106373431 13:29160188-29160210 GTCAAAGCTGTGTTGCTCAAGGG - Intronic
1106625451 13:31416551-31416573 TTCAAACCTGTGTTGTTCCAAGG - Intergenic
1107053875 13:36082052-36082074 TTCAAACCTGTGTTTTTCAAGGG - Intronic
1107136266 13:36947244-36947266 TTCAAACCTGTGTTATTCAAGGG + Intergenic
1107251453 13:38368363-38368385 TTCAAACCTGTTTTGTTCAAGGG + Intergenic
1107303995 13:38998536-38998558 AGTAAACATATGTTGCTTAATGG - Intergenic
1107367868 13:39704630-39704652 TTTAAACATGTGTTGTTTAAGGG + Intronic
1107539182 13:41370143-41370165 TTCAAACCTATGTTGTTCAAAGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107703510 13:43074811-43074833 TTCAAACCCAGGTTGTTCAAGGG - Intronic
1107778234 13:43871128-43871150 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1107813823 13:44226088-44226110 TTGAAACATATTTAACTCAAGGG - Intergenic
1107866980 13:44712706-44712728 TTCACACCCATGTTGTTCAAGGG - Intergenic
1107897556 13:44981193-44981215 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1107993884 13:45842037-45842059 GTCTAACAAATGTGGCTCAAGGG - Intronic
1108045091 13:46375831-46375853 TTCAAATCCATGTTGTTCAAGGG - Intronic
1108050210 13:46427470-46427492 TTCAAATCTGTATTGCTCAAGGG - Intronic
1108149027 13:47512284-47512306 TTCAAACTTATGCTGTTCAAGGG - Intergenic
1108450105 13:50553333-50553355 TTCAAACTCATGTTGCTTAAGGG - Intronic
1108467382 13:50730281-50730303 CTCAAACCCATGTTGTTCAAGGG + Intronic
1108584160 13:51853603-51853625 TTCACACCTGTGTTGTTCAAGGG + Intergenic
1108804330 13:54135242-54135264 TTCTAACCTGTGTTGTTCAAGGG + Intergenic
1108961079 13:56230452-56230474 GTCAAACCCATGTTGTTCAAGGG + Intergenic
1109048306 13:57441567-57441589 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1109200066 13:59420461-59420483 TTCAAACACATGTTGTTCAAGGG + Intergenic
1109338160 13:61019173-61019195 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1109433621 13:62269613-62269635 TTCAAACATATATTGCTTAGTGG - Intergenic
1109521535 13:63518096-63518118 TTCAAACTTGTGTTGTTCAAAGG + Intergenic
1109542730 13:63800788-63800810 TTCAAATCTGTATTGCTCAAGGG - Intergenic
1109921884 13:69074667-69074689 TTCAAACTGATGTTGTTGAAGGG + Intergenic
1110180026 13:72605706-72605728 TTCAAACCCCTGTTGTTCAAGGG - Intergenic
1110268793 13:73569693-73569715 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
1110314267 13:74087049-74087071 TTCACACCTGTGTTGTTCAAGGG + Intronic
1110442521 13:75541184-75541206 TTCAAACCCATGTTGTTCAAGGG + Intronic
1110563312 13:76932740-76932762 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1110807548 13:79774491-79774513 TTCAAACCAGTGTTGTTCAAGGG + Intergenic
1110953507 13:81523362-81523384 TTCAAATTTATGTTGTTCAAGGG - Intergenic
1111131923 13:83987910-83987932 TTCAAACCCATGTTGTTCAGAGG - Intergenic
1111346378 13:86960172-86960194 TACAAACACATGATGTTCAAAGG + Intergenic
1111366665 13:87255896-87255918 TTCAAACCTACGTTGTTCAGGGG - Intergenic
1111502923 13:89147581-89147603 TTCAAACCCATGTTGTTAAAGGG - Intergenic
1111574583 13:90135533-90135555 TTAAAACTTATGTTTTTCAATGG + Intergenic
1111633140 13:90868915-90868937 ATCAAACCCATGTTGTTCAAGGG + Intergenic
1111771933 13:92607823-92607845 TTCAAACCCATGTTGTTCAAGGG - Intronic
1111852741 13:93597520-93597542 TTCAAACATATGTTGCTCAAGGG - Intronic
1111929356 13:94497845-94497867 TTCAAACCCATGTTGTTCAGGGG + Intergenic
1111985615 13:95063648-95063670 TTGACACAAATGTTTCTCAAGGG - Intronic
1112006427 13:95257724-95257746 TTCAAACCCTTGTTGTTCAAGGG + Intronic
1112067594 13:95810684-95810706 TTCAAACCTGTGTTGTTAAAGGG + Intronic
1112096646 13:96139906-96139928 TTCAAACCCATGTTGTTTAAGGG - Intronic
1112160430 13:96861279-96861301 TTCAAACCCATGTTGCTCGAGGG - Intergenic
1112232119 13:97599582-97599604 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1112301681 13:98236464-98236486 TTCAAACCTGTGTTGTTCAATGG - Intronic
1112400666 13:99075320-99075342 TTCAAACCCATGTTGTTCAAAGG + Intronic
1112437742 13:99403720-99403742 TTGACACACATGTTGCTCCATGG + Intergenic
1112542099 13:100324349-100324371 TTCAAACCAGTGTTGTTCAAAGG - Intronic
1112638686 13:101246951-101246973 TTCAAACATACTGTGATCAAAGG + Intronic
1112879993 13:104095476-104095498 TTCAAACTTGTGTTGTTCCAGGG - Intergenic
1112957113 13:105073457-105073479 TTCAAACCCATGTTGTGCAAGGG - Intergenic
1113012503 13:105786122-105786144 TTCAAACCCATGTAGTTCAAGGG + Intergenic
1113160804 13:107378732-107378754 TTCTAACCTATATTGTTCAACGG - Intronic
1113163874 13:107415959-107415981 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1113235900 13:108273846-108273868 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1113243346 13:108365108-108365130 TTCAAACTTCTGTTGTTCAAGGG - Intergenic
1113358192 13:109602995-109603017 TTCAAACACGTGTTGTTGAAGGG - Intergenic
1114480527 14:23031051-23031073 TTCAAACCCATGTTGCTCAAGGG + Intronic
1114775032 14:25472300-25472322 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1114967638 14:27983074-27983096 TTCAAATCTGTGTTGTTCAAGGG - Intergenic
1115303098 14:31906329-31906351 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1115578475 14:34734512-34734534 TTCAAACCCATGTTGCTCAAAGG + Intergenic
1115864801 14:37733031-37733053 TTCAAACCCATGTTATTCAAGGG + Intronic
1116116536 14:40658737-40658759 TTTAAACATGTGTTGTTCAAGGG + Intergenic
1116273476 14:42801629-42801651 CTCAAATATATGTTTCTGAAAGG + Intergenic
1116309426 14:43304297-43304319 TCCAAATCTATGTTGTTCAAGGG + Intergenic
1116564118 14:46423224-46423246 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1116665143 14:47765008-47765030 TTCAAACTTGTGTTGTTCAATGG + Intergenic
1116698736 14:48209609-48209631 ATCAAACCTGTGTTGTTCAAGGG + Intergenic
1117263507 14:54061617-54061639 TTCAAACCTGTGTTGCTTAAGGG - Intergenic
1117282551 14:54255156-54255178 TTTAAACCTGTGTTGTTCAAGGG + Intergenic
1117422660 14:55562208-55562230 TTCAAACCCATGTTGTTCGAGGG + Intronic
1117425601 14:55592448-55592470 TTCAAACCCATGTTGTTCAAGGG - Intronic
1117608171 14:57453567-57453589 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1117683902 14:58233337-58233359 TTCAAACCCATGTTGTTCAAGGG - Intronic
1117923684 14:60753281-60753303 TTCAAACTCATGTTGTTTAATGG - Intronic
1118052433 14:62044008-62044030 TTCAAATCTATGTTATTCAAGGG - Intronic
1118116091 14:62778377-62778399 TTCAAACCTGTGTTATTCAAGGG + Intronic
1118168944 14:63366293-63366315 TTCAAACCCATGTTGTTCAATGG - Intergenic
1118388184 14:65274164-65274186 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1118530422 14:66698917-66698939 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1118773744 14:68960268-68960290 TTCAAACCTGTGATGTTCAAGGG + Intronic
1118832236 14:69445142-69445164 TTCAAACTCATATTGTTCAAAGG - Intronic
1119070599 14:71579404-71579426 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1119118511 14:72050690-72050712 TTCAAACCCGTGTTGTTCAAGGG - Intronic
1119384222 14:74247114-74247136 TTCAGGCATGTGGTGCTCAAAGG - Intronic
1119578366 14:75750397-75750419 TTCAAATCCATGTTGCTTAAGGG - Intronic
1120064096 14:80019516-80019538 TTGAAACTTATGTTGTTCAAGGG + Intergenic
1120147397 14:80993891-80993913 TTCAAACTTGTGTTGCTCAAGGG - Intronic
1120319818 14:82945212-82945234 TTGAAACACATGTTGTTCAAAGG + Intergenic
1120484859 14:85100321-85100343 TTGAAACCTGTGTTGTTCAAAGG + Intergenic
1120581845 14:86261398-86261420 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1121149700 14:91620898-91620920 TTCAAACTGGTGTTGTTCAAGGG + Intronic
1121393025 14:93592612-93592634 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1121755081 14:96395480-96395502 TTCAAACCGGTGTTGTTCAAGGG + Intronic
1121804279 14:96801950-96801972 TTCACACTCATGTTGTTCAAGGG + Intronic
1121877451 14:97466428-97466450 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1121905936 14:97744597-97744619 TTCAAACTCATGTTGTCCAAGGG + Intergenic
1121978112 14:98425005-98425027 TTCAAACCTGGGTTGGTCAATGG - Intergenic
1122185541 14:99990960-99990982 TTCAAACCCATGTTGTTCAAGGG - Intronic
1122189888 14:100033083-100033105 CACAAACAGATGTTGCTCACTGG - Intronic
1122391496 14:101390619-101390641 CTCAAACCCATGTTGGTCAAGGG - Intergenic
1122608296 14:102962886-102962908 TTCAAATATATTTTCCCCAAAGG - Intronic
1123426473 15:20174962-20174984 TTCAGACTTGTGTTGTTCAAGGG + Intergenic
1123454311 15:20405405-20405427 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1123535704 15:21181489-21181511 TTCAGACTTGTGTTGTTCAAGGG + Intergenic
1123927398 15:25130277-25130299 TTCAAACTTGTGCTGTTCAAAGG + Intergenic
1124033948 15:26036284-26036306 TCCAAAACCATGTTGCTCAAAGG + Intergenic
1124095086 15:26641822-26641844 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1124228938 15:27924361-27924383 TTCAAATCCATGTTGTTCAAGGG + Intronic
1124437213 15:29660764-29660786 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1124506435 15:30279858-30279880 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1124639596 15:31389021-31389043 TTCAAACCCATGTTGTTCAATGG - Intronic
1124704184 15:31947907-31947929 TTCAAACCCATGTCGTTCAAGGG - Intergenic
1124737122 15:32258778-32258800 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1124881943 15:33650825-33650847 TTCAAACCCATGTTTTTCAAGGG + Intronic
1125086384 15:35735029-35735051 ATCAAACCTATGTTGTTCAAGGG - Intergenic
1125118832 15:36128476-36128498 TTCAAACCTGTATTGTTCAAAGG - Intergenic
1125160283 15:36635335-36635357 TTCAAACCCATGTTGTTCAAGGG - Intronic
1125311488 15:38383617-38383639 CTCAAACCCATGTTGTTCAAGGG - Intergenic
1125493977 15:40172683-40172705 TTCAGACCTGTGTTGTTCAAGGG + Intronic
1125807634 15:42507842-42507864 TTCAAGCCCATGTTGTTCAAGGG - Intronic
1125814258 15:42570952-42570974 TTCAAGCTTATATTGTTCAAGGG - Intergenic
1126129307 15:45325054-45325076 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1126139397 15:45424895-45424917 TTTAAACTTGTGTTGTTCAAGGG - Intergenic
1126342362 15:47655066-47655088 TTCAAACCCATGTTGTTCAAAGG + Intronic
1126548583 15:49901728-49901750 TTAAAAAATATGTTTCTCAGAGG - Intronic
1126560945 15:50043364-50043386 TTCAAATTTATGTTGTTCAAGGG - Intronic
1126776184 15:52102545-52102567 TTCAAACCTGTGTTGCTCAAGGG + Intergenic
1127079976 15:55368049-55368071 TTCAAACTCATGTTGCTCAAGGG - Intronic
1127080760 15:55377058-55377080 TTCTAACTTAGGTGGCTCAAGGG + Exonic
1127101876 15:55574615-55574637 TTCAAACCCATGTTGTTCAAAGG + Intronic
1127230116 15:56982037-56982059 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1127747826 15:61998746-61998768 TTCAAACCCATGTTGTTCAAGGG - Intronic
1127796810 15:62445484-62445506 TTCAAACAAATGCTACTTAAGGG - Intronic
1127830648 15:62748084-62748106 TGCAAACCCATGTTGTTCAAAGG + Intronic
1127990929 15:64116362-64116384 TTGAAACCTGTGTTGTTCAAGGG + Intronic
1128761669 15:70220248-70220270 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1129006763 15:72380340-72380362 TTCAAACCCACGTTGTTCAAGGG - Intergenic
1129131582 15:73502701-73502723 TTCAAACCTGTGTTGTTGAAGGG + Intronic
1129569796 15:76668707-76668729 CTCAAACATAAGTTTCCCAAGGG + Intronic
1129625812 15:77197798-77197820 TTCAAACCCATGTTGTTCAAGGG - Intronic
1129627676 15:77220399-77220421 TCCAATCATATGTTGATAAAAGG - Intronic
1129743923 15:78004892-78004914 TTCAAACCCACGTTGTTCAAGGG + Intronic
1129849789 15:78786813-78786835 TTCAAATCCATGTTGTTCAAAGG - Intronic
1130235933 15:82133457-82133479 TCCAAACATAAATTGCACAATGG + Intronic
1130644738 15:85714387-85714409 TTCAAACCCATGTTGTTCAGGGG + Intronic
1130821828 15:87503904-87503926 TTCACAGCTATGTTGCGCAAAGG + Intergenic
1130957159 15:88635941-88635963 TTCAAGCCCATGTTGTTCAAGGG + Intergenic
1131077785 15:89506817-89506839 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1131126390 15:89861248-89861270 TTGAAACATATGCTTCTGAATGG - Intronic
1131409337 15:92193297-92193319 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1131575213 15:93582656-93582678 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1131579798 15:93631817-93631839 TTCAAACTCATGTGGTTCAACGG + Intergenic
1131623942 15:94098030-94098052 TTCAAACACATGTTCTTCAAGGG - Intergenic
1131728736 15:95256301-95256323 TTCAAACCTGTGTTGTTCGAGGG + Intergenic
1131930044 15:97431720-97431742 CTCAAACATATTTTTCTGAATGG - Intergenic
1132257989 15:100394490-100394512 TTCAAACCTGTATTACTCAAGGG - Intergenic
1132425355 15:101711387-101711409 TTCTAACCTTTGTTGTTCAAGGG - Intronic
1132824734 16:1898442-1898464 TTCAAACCTGTGTTGGTCACAGG + Intergenic
1133148850 16:3811271-3811293 TTCAAACCCATGTTGGTCATGGG - Intronic
1133628390 16:7593619-7593641 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1134139638 16:11706856-11706878 TTCAAACCCATGTTGTTCAAGGG - Intronic
1134331242 16:13252874-13252896 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1134379821 16:13713456-13713478 CTCAAACATCATTTGCTCAATGG + Intergenic
1134426396 16:14151450-14151472 TTCAAAGTCATGTTGTTCAAGGG + Intronic
1134428854 16:14181792-14181814 TACAAACAAATGCAGCTCAAGGG - Intronic
1134573408 16:15311291-15311313 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1134728975 16:16444671-16444693 TTCAAATCCATGTTGTTCAAGGG - Intergenic
1134821962 16:17254148-17254170 TTCAAACCTGTGCTGTTCAAGGG - Intronic
1134938460 16:18267195-18267217 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1135132913 16:19867637-19867659 TTTTAACATATGTTTCTCTAGGG - Intronic
1135532079 16:23263461-23263483 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1135688641 16:24518668-24518690 TTCAAACCCAGGTTGTTCAAGGG + Intergenic
1136923223 16:34348528-34348550 TGAAAACATATGCTGCTTAATGG + Intergenic
1136981350 16:35063278-35063300 TGAAAACATATGCTGCTTAATGG - Intergenic
1137250823 16:46739457-46739479 TTCAAACCTGTGTTGCTCAAGGG - Intronic
1137388505 16:48061693-48061715 TTCAATCCCATGTTGTTCAAGGG - Intergenic
1137451034 16:48574023-48574045 TTCAAACCCACGTTGTTCAAGGG + Intronic
1137524872 16:49226045-49226067 TTCAAACCTGTGTTGTTGAAGGG + Intergenic
1137916822 16:52440591-52440613 TTTAAACATATGGTACTCAATGG - Intronic
1137941405 16:52691142-52691164 TTCAAACTCATGTTGTTTAAGGG - Intergenic
1138026530 16:53526583-53526605 TTCAAACCCACGTTGTTCAAGGG + Intergenic
1138237291 16:55395233-55395255 TTCAAACCTGTGTTGTTCAATGG - Intronic
1138609753 16:58113421-58113443 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1138759434 16:59523386-59523408 TTCAAACCCATGTTGTTCGAGGG + Intergenic
1138857299 16:60709793-60709815 TTCAGACCTGTGTTGTTCAAGGG + Intergenic
1138876330 16:60955229-60955251 TTCAAAGATATCTGACTCAATGG + Intergenic
1138890335 16:61135481-61135503 TTCAAACTCATGCTGTTCAAGGG + Intergenic
1138948681 16:61884167-61884189 ATCAAATCTGTGTTGCTCAAAGG - Intronic
1139321646 16:66119121-66119143 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1140004164 16:71058754-71058776 TTCAAACTCATGTTGTTCAAGGG - Intronic
1140523759 16:75604889-75604911 TTCAAACCTGTGTTGTCCAAGGG - Intronic
1140553175 16:75890107-75890129 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1141073669 16:80982030-80982052 TTCAAATCCATGTTGTTCAAGGG - Intronic
1141310471 16:82908825-82908847 TTCAAACCCATGTAGTTCAAGGG - Intronic
1141737816 16:85866563-85866585 TTCAAACTCATGCTGTTCAAGGG - Intergenic
1142067264 16:88069798-88069820 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1143233892 17:5381393-5381415 TTCAAACATTAGTTGTTCAACGG - Exonic
1143677756 17:8448718-8448740 TTCAAACCCATGTTGTTCAAGGG - Intronic
1143762052 17:9111928-9111950 TTCAAACCCATGTTGTTCAATGG + Intronic
1143992381 17:10977156-10977178 TTCAAATACATATTGTTCAAGGG + Intergenic
1144096937 17:11908245-11908267 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1144119613 17:12138596-12138618 TTGAAATCTGTGTTGCTCAAGGG + Intronic
1144285010 17:13765546-13765568 TTCAAATCCATGTTGCTCAAGGG + Intergenic
1144353141 17:14418487-14418509 TTCAAACCTGTATTGTTCAAGGG - Intergenic
1144398531 17:14870567-14870589 TTCAAACCTGGGTTGTTCAAGGG + Intergenic
1144521443 17:15955104-15955126 TTCAAACCCAAGTTGTTCAAGGG - Intronic
1144523222 17:15968195-15968217 TTCAAACCTGTGCTGTTCAAGGG - Intronic
1144530151 17:16030345-16030367 TTCAAACCCGTGTTGTTCAAGGG + Exonic
1145024366 17:19456751-19456773 TTCAAACCTGTGTTGTTCGAGGG - Intergenic
1145221649 17:21094350-21094372 TTCAAACCTGTATTGTTCAAAGG + Intergenic
1145283165 17:21483138-21483160 TTCAAACTTCTGCTGTTCAAAGG - Intergenic
1145394318 17:22482662-22482684 TTCAAACCTCTGTTGTTCAAAGG + Intergenic
1145857623 17:28177250-28177272 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1146128793 17:30252114-30252136 CACACAGATATGTTGCTCAAGGG + Intronic
1146246812 17:31292607-31292629 TTCAAACCCATGTTGTTCAAGGG + Intronic
1146541260 17:33697431-33697453 TTCAAACTCATGTTGTTCAAGGG + Intronic
1146754644 17:35418291-35418313 TTCAAACCCATGTTGTTCAAGGG - Intronic
1147126393 17:38372062-38372084 TTCAAACCCAGGTTGTTCAAGGG - Intronic
1147298653 17:39505673-39505695 TTCAAACCTGCGTTGTTCAACGG - Intronic
1147330027 17:39693139-39693161 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1148384911 17:47227435-47227457 TTCAAGCCTATGTTGTTCAAGGG - Intergenic
1149068356 17:52507646-52507668 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1149165756 17:53750046-53750068 TTCAAACCCATGTTGTTCAAAGG - Intergenic
1149250074 17:54758001-54758023 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1149259138 17:54859892-54859914 TCCAAACTCATGTTGTTCAAGGG + Intergenic
1149275635 17:55031869-55031891 TTCAAGCCTATGTTGTTCAGGGG + Intronic
1149669433 17:58392953-58392975 TTCAAACCTGTGTTGTTTAAGGG - Intronic
1149819875 17:59765816-59765838 TTCAAATCCATGTTGTTCAAGGG + Intronic
1149944942 17:60914581-60914603 TTCAAACCCATGTTGTTCAATGG - Intronic
1150241233 17:63634649-63634671 GTCAAACTTATGTTGCACGAAGG + Intronic
1150261732 17:63798509-63798531 TTCAAACCTGTGTTGTTCAAAGG - Intronic
1150442224 17:65200707-65200729 TTCAAACCAGTGTTGGTCAAGGG - Intronic
1150448831 17:65248673-65248695 TTCAAATCTGTGTTGTTCAAAGG - Intergenic
1150512323 17:65768417-65768439 TTCAAACCTGTGTCGTTCAAGGG + Intronic
1151230509 17:72681641-72681663 TTCAAACCTGTGTTGCTCAAGGG - Intronic
1151295938 17:73186209-73186231 TTTAAACACGTGTTGCTGAAAGG - Intergenic
1151332161 17:73416537-73416559 TTCCAACCTGTGTTGTTCAAGGG - Intronic
1151636601 17:75353383-75353405 CTCAAACCTCTGTTGCTCAAGGG + Intronic
1151860850 17:76760462-76760484 TTCAAACCCATGTTGTTCAAGGG + Intronic
1152007630 17:77692527-77692549 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1153206850 18:2712422-2712444 TTCAAACCCATGTTTTTCAACGG - Intronic
1153319139 18:3754351-3754373 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1153343536 18:4002328-4002350 TTCAAACCTGTGTTCTTCAAAGG - Intronic
1153369525 18:4298297-4298319 GTCAAACCCATGTTGTTCAAGGG + Intronic
1153401843 18:4690591-4690613 CTCAAACCTGTGCTGCTCAAGGG + Intergenic
1153499706 18:5735893-5735915 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1153731196 18:8013634-8013656 TTCAAATCTGTGTTGTTCAAGGG + Intronic
1153781511 18:8499135-8499157 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1153794104 18:8607167-8607189 TTCAAACCCATGTTGTTCTAGGG + Intergenic
1153997903 18:10457098-10457120 TTAAAACTAATGTTGCTCAAAGG + Intronic
1154299265 18:13178705-13178727 TTCAAACCTGTGTTGTGCAAAGG - Intergenic
1154357917 18:13636364-13636386 TTTAAACACATGTTGTTCAACGG + Intronic
1154984682 18:21537866-21537888 TTCAAACTTTTGTTGTTCGAGGG - Intronic
1155076756 18:22364163-22364185 TTCAAACCCATGTTGTCCAAGGG - Intergenic
1155104168 18:22644245-22644267 TTCAAACCCATGTTATTCAAGGG - Intergenic
1155106577 18:22672732-22672754 TTCAAATCTGTGTTGTTCAAGGG - Intergenic
1155322029 18:24629155-24629177 TGCAAATATATGTTGCACAAAGG + Intergenic
1155717346 18:28961463-28961485 TTCAAAAACATGTTGAGCAAGGG - Intergenic
1155935848 18:31752882-31752904 TTCGAACCTGTGTTGTTCAAGGG + Intergenic
1156216847 18:35007776-35007798 TTCAAACCCATGTTGTTCAAGGG - Intronic
1156322859 18:36044284-36044306 TTCAAACCCATATTGTTCAAAGG + Intronic
1156323522 18:36051102-36051124 GTCAGACCTATGTTGTTCAATGG + Intronic
1157157064 18:45278779-45278801 TTCAAACCCGTGTTGTTCAAGGG + Intronic
1157398952 18:47370625-47370647 TTCAAACCCGTGTTGTTCAAGGG + Intergenic
1157542345 18:48520373-48520395 TTGAAACCCATGTTGTTCAAGGG - Intergenic
1157837107 18:50915007-50915029 TTCACACCTGTGTTGTTCAAGGG - Intronic
1157904118 18:51552173-51552195 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1157928628 18:51794215-51794237 CTCAAACCTATGTTATTCAAGGG - Intergenic
1158129424 18:54136400-54136422 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1158381737 18:56938140-56938162 TTCAAACCCATGTTGTTCATGGG + Intronic
1158731172 18:60024038-60024060 TTCAAACCTATGCTGTTCAAGGG - Intergenic
1158785971 18:60712262-60712284 CTCAAACCTATGCCGCTCAAGGG + Intergenic
1158809574 18:61016590-61016612 GTCAATCTGATGTTGCTCAAGGG + Intergenic
1158884857 18:61817393-61817415 TTCAAACCTGTGTTGTTCATGGG - Intronic
1159163058 18:64669220-64669242 TTCAAATCTCTGTTGTTCAAGGG - Intergenic
1159400603 18:67928017-67928039 TTCAAACACATGTTGTTCAAGGG + Intergenic
1159457638 18:68681419-68681441 TTCAAACTTATGTTGTTCAACGG + Intronic
1159751746 18:72311263-72311285 TTCAAACCCATGTTGTTTAAGGG + Intergenic
1159834619 18:73324027-73324049 TTCAGACCTGTGTTGTTCAAGGG - Intergenic
1160480313 18:79234046-79234068 TTCAAACCCTTGTTGTTCAAGGG + Intronic
1160490371 18:79332693-79332715 TTCAAACCCATGTTGTTTAAGGG + Intronic
1161485481 19:4533409-4533431 TTCAAACCCATGTTGTTGAAGGG + Intronic
1163163890 19:15482184-15482206 GTCAAACCCATGTTGTTCAAGGG - Intronic
1163286542 19:16351957-16351979 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1163342051 19:16715048-16715070 TTCAAACTCGTGTTGTTCAAGGG - Intergenic
1163347958 19:16756459-16756481 TTCAAACCTGTGTTCTTCAAGGG + Intronic
1163383921 19:16987287-16987309 TTCAAACCTGTATTTCTCAAGGG - Intronic
1164173851 19:22750620-22750642 CTCAAACCTATGTCACTCAAAGG + Intergenic
1164895380 19:31872674-31872696 TTCAAACCCATGTTGTTCAGGGG + Intergenic
1164909904 19:32000556-32000578 TTCAAGCTTGTGTTGTTCAAGGG - Intergenic
1164922387 19:32098435-32098457 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1164987842 19:32661867-32661889 TTCAAACCCATATTGTTCAAGGG + Intronic
1165615508 19:37196477-37196499 TTCAAACCCATGTGGTTCAAAGG - Intronic
1165720425 19:38075078-38075100 TTCCAACCCATGTTGTTCAAGGG - Intronic
1166607290 19:44155594-44155616 GTCAAACCTGTGTTGTTCAACGG + Intronic
1166621810 19:44307835-44307857 TTCAAACCTGTTTTGTTCAAAGG + Intergenic
1167870528 19:52365761-52365783 TTCAGACAGATGTGCCTCAAGGG - Exonic
1167968780 19:53172249-53172271 TTCAAACCTGTGCTGTTCAAGGG + Intronic
1168111926 19:54197443-54197465 TTCAGACCCATGTTGCTCAAGGG - Intergenic
1168337234 19:55603519-55603541 TTCAAACCCCTGTTGTTCAAGGG + Intergenic
1168431090 19:56281323-56281345 TTCAAACCTGTATTGTTCAAGGG + Intronic
925263620 2:2548922-2548944 GTCAAACCTGTGTTGTTCAAGGG + Intergenic
925439364 2:3870635-3870657 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
925495457 2:4443840-4443862 TTCAAACTCATGTTGTTCAAGGG + Intergenic
926019381 2:9481966-9481988 TTCAAACCTGTGTTGTTCAAGGG + Intronic
926267429 2:11337423-11337445 TTCAAACAGATGCTTCACAAAGG + Intronic
926301425 2:11606253-11606275 TTCAAACCTGTGTTATTCAAGGG + Intronic
926350883 2:11993328-11993350 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
926544147 2:14218050-14218072 TTCAAAACCATGTTGTTCAAAGG + Intergenic
926613049 2:14966596-14966618 TTCAAACCTGTGTTACTCAAAGG + Intergenic
926662866 2:15487547-15487569 TTCAAACCCATGTTGCTGTAGGG + Intronic
926668568 2:15552329-15552351 TTGAAACCTGTGTTGTTCAAGGG - Intronic
926954077 2:18274384-18274406 TTCAAACTCATGTTCTTCAAGGG - Intronic
926998346 2:18764272-18764294 TTCAAACCCATATTGCTCAAGGG - Intergenic
927101672 2:19792302-19792324 TTCAAACCCATGTTGTTCACGGG - Intergenic
927280424 2:21300203-21300225 TTCAAACCTGTGTTGTTTAAGGG + Intergenic
927351076 2:22116026-22116048 TTCGAACCCATGTTGCTCAAGGG + Intergenic
927370921 2:22354445-22354467 TTCAAACCCATGTTGTTCAAGGG - Intergenic
927397031 2:22664479-22664501 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
927397223 2:22666673-22666695 TTCAAGCCCATGTTGTTCAAGGG + Intergenic
927524641 2:23726615-23726637 TTCAAACCCATGTTGTTCAAGGG + Intergenic
928011648 2:27613732-27613754 TTCAAACTCATGTTGTTCAAGGG + Intronic
928014046 2:27637406-27637428 TTCAAACCTATGTTGTTTAAGGG + Intronic
928568135 2:32574726-32574748 TTCAAACCTGTGTTGTTCAAGGG + Intronic
928822714 2:35381342-35381364 TTCAAACCCATGTTGTTCAAGGG + Intergenic
928848812 2:35716368-35716390 ATTCAACATATGTTGCTAAATGG - Intergenic
929094800 2:38253167-38253189 TTCAAACCCATGTTGTTCAAGGG + Intergenic
929214249 2:39393909-39393931 TTCAAGCCTGTGTTGTTCAAGGG + Intronic
929237129 2:39617238-39617260 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
929427519 2:41858311-41858333 TTCAAACCTGTGTTTCTCAAGGG + Intergenic
929473337 2:42219207-42219229 TTCAAACTGGTGTTGTTCAAGGG - Intronic
929474068 2:42227596-42227618 TTCAAACCTGTGTTGTTCAAGGG - Intronic
929727752 2:44448310-44448332 TTCAAACCTGTGTTGTTCAAGGG + Intronic
929845636 2:45522581-45522603 TTCAAACCCATGTTGTTCAAGGG - Intronic
929912821 2:46106170-46106192 TTGAAACTCATGTTGTTCAAGGG + Intronic
930266504 2:49205956-49205978 TTCAAATCCATGTTGTTCAAGGG - Intergenic
930289102 2:49471155-49471177 TTCAAATACATGTTGTGCAAGGG - Intergenic
930325207 2:49907798-49907820 CACAAACATCTGATGCTCAAGGG + Intergenic
930353106 2:50282376-50282398 TTCCAACTTGTATTGCTCAAGGG - Intronic
930537361 2:52660151-52660173 TTCAAACTTGTGTTCCTTAAAGG + Intergenic
930609937 2:53530889-53530911 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
930945693 2:57072233-57072255 TTCAAACCTATGTTGTTCAAGGG - Intergenic
931029935 2:58162450-58162472 TTCAAACCCATGTTGTTCAAGGG - Intronic
931162402 2:59706264-59706286 TTCAAACCCATGTTGTTCAAGGG - Intergenic
931225863 2:60330867-60330889 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
931331315 2:61287455-61287477 TTCAGACCTGTGTTGTTCAAGGG - Intronic
931414698 2:62070191-62070213 TTCAAACCCGTGTTGTTCAAGGG - Intronic
931831258 2:66053748-66053770 TTCAAACCCGTGTTGTTCAAGGG + Intergenic
931954668 2:67407919-67407941 TTCAAGCCCATGTTGTTCAAGGG + Intronic
932223017 2:70015360-70015382 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
932318848 2:70805436-70805458 TTCACACTTAGGTTGCTCATGGG - Intergenic
932384130 2:71315504-71315526 TTCAGACCCATGTTGTTCAAGGG + Intronic
932617682 2:73245308-73245330 TTCTAAAATATGTTGTTAAATGG - Intronic
932864095 2:75323577-75323599 TTCAAACCCATGTTGTTCAAGGG - Intergenic
932880194 2:75494139-75494161 TTCAAACCCATGTTGTCCAAGGG - Intronic
932921855 2:75925045-75925067 TTCAAAGTTAGGTTGCTCAAGGG + Intergenic
932955010 2:76341432-76341454 TTCAAACCCATGTTGTTCAAGGG + Intergenic
932996233 2:76857059-76857081 TTCAAACCTATGTTGTTCAAGGG - Intronic
933018450 2:77161679-77161701 TTCAAACCCATGTTGTTCAGTGG + Intronic
933061006 2:77736131-77736153 TTCAAACCCATGTTGCCCAAGGG + Intergenic
933077321 2:77945257-77945279 TTCACAAATATGTGCCTCAATGG + Intergenic
933337847 2:80982861-80982883 GTCAAACTTCTGTTGTTCAAGGG + Intergenic
933346976 2:81099876-81099898 TTCAAACCGTTGTTGTTCAAGGG + Intergenic
933378881 2:81517433-81517455 TTCATCCATTTGTTCCTCAATGG - Intergenic
933448760 2:82418170-82418192 TTCAAACCTGTTTTGTTCAAGGG + Intergenic
933485488 2:82917228-82917250 TTCAAACCCATGTTGTCCAAGGG + Intergenic
933693908 2:85201582-85201604 TTCAAACCTGTTTTGTTCAAGGG + Intronic
933830683 2:86205535-86205557 TTCAAACCCATGTTGTTCAAGGG + Intronic
933910986 2:86941572-86941594 TTCAAACCCATGTTATTCAAGGG - Intronic
934021744 2:87961838-87961860 TTCAAACCCATGTTATTCAAGGG + Intergenic
934719506 2:96563740-96563762 TTCAAACCCATGTTGTTCAAGGG + Intergenic
934975022 2:98795901-98795923 TTCAAACCCGTGTTGTTCAAGGG + Intronic
934995968 2:98960720-98960742 TTCAGACCCATGTTGTTCAAGGG - Intergenic
935198927 2:100838911-100838933 TTCAAACCTCTGTTGTTCAAGGG - Intronic
935230644 2:101092918-101092940 TTCAAACCCGTGTTGTTCAAGGG - Intronic
935308174 2:101758379-101758401 TTCAAATCCATGTTGTTCAAAGG - Intronic
935323774 2:101915497-101915519 TTCAAACACATGTTGTTCAAGGG - Intergenic
935473489 2:103488514-103488536 TTCACACTCATGTTGTTCAAGGG - Intergenic
935556035 2:104510489-104510511 TTCAAACCTGTGATGCTCAAGGG + Intergenic
935821669 2:106899037-106899059 TTCAAATCTATGTTGTTCATTGG + Intergenic
935990871 2:108718195-108718217 TTCAAACCCATGTTATTCAAGGG - Intergenic
936023707 2:109015215-109015237 TTCAAACCCAGGTTGTTCAAGGG - Intergenic
936031863 2:109079074-109079096 TTTAAACGCATGTTGTTCAAGGG - Intergenic
936682962 2:114795595-114795617 TTCAAAACTCTGTTGTTCAAGGG - Intronic
936916354 2:117642789-117642811 TGCAAATATATGTTATTCAAAGG + Intergenic
937088485 2:119188684-119188706 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
937474174 2:122200152-122200174 TTCAAACCCATGTTATTCAAGGG + Intergenic
937766836 2:125671255-125671277 TTCAAATCTATGTTGTTCAAGGG - Intergenic
937776446 2:125782508-125782530 TTCAAAACCATGTTGTTCAAGGG + Intergenic
937777613 2:125798413-125798435 TTCAAACCCATGTTGTTCAAGGG + Intergenic
937860557 2:126705130-126705152 TTCAAATCTGTGTTGTTCAAGGG - Intergenic
938556925 2:132432953-132432975 TTCAAATCCATGTTGTTCAAGGG - Intronic
939081578 2:137668981-137669003 TTCAAACCTGTGTTGTTCAAGGG + Intronic
939223319 2:139332545-139332567 TTCAAACCCATGTTGTTCAAAGG + Intergenic
939574781 2:143883020-143883042 TTCAGACCCATGTTGTTCAAAGG + Intergenic
939680775 2:145129421-145129443 TTCAAGCCCATGTTGTTCAAGGG - Intergenic
939719848 2:145634956-145634978 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
939723502 2:145684747-145684769 TTCAAACCCATGTTGTTCAAGGG - Intergenic
939749565 2:146026449-146026471 TTCAAACCCATGTTGTTCAAGGG - Intergenic
939814095 2:146872533-146872555 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
939831635 2:147079655-147079677 TTCAAACCCATGTTTTTCAAGGG + Intergenic
940017987 2:149126658-149126680 TTCAAACCTGTGTCGTTCAAGGG + Intronic
940142785 2:150512657-150512679 TTCAAAATCATGTTGTTCAAGGG + Intronic
940477379 2:154180876-154180898 TTCAAACTCATGTTGTTCAAGGG - Intronic
940715639 2:157220209-157220231 TTTAAACATATGATGCTCTCTGG - Intergenic
940875978 2:158897554-158897576 TTCAAACCTATGTTGTTCAAGGG - Intergenic
940930939 2:159430152-159430174 TTCAAACCCATATTGTTCAAGGG - Intronic
940952569 2:159692740-159692762 TTCAAACTTGTTTTGCTCAAGGG + Intergenic
941128800 2:161620802-161620824 CTCAAACCTCTGTTGTTCAAGGG - Intronic
941144155 2:161822579-161822601 TTCAAACCCATATTGTTCAAGGG - Intronic
941231980 2:162921555-162921577 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
941280806 2:163548395-163548417 TTCAAACCAATGTTGTTCAAGGG - Intergenic
941737776 2:168998687-168998709 TACAAACATATGTGGATTAAGGG + Intronic
941819845 2:169833201-169833223 TTCAAACTAGTGTTGTTCAAGGG + Intronic
942009336 2:171743379-171743401 TTCAAACCTATATGGTTCAAGGG + Intronic
942146932 2:173035998-173036020 TTCAAACCTGTGTTGTTCAAAGG + Intronic
942245784 2:174006509-174006531 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
942266628 2:174233950-174233972 TTCAAACCAGTGTTGTTCAAGGG - Intronic
942344309 2:174986544-174986566 TTCAAACCCATGTTGTTTAAGGG - Intronic
942361348 2:175175245-175175267 TTCAAACCCATGTTGTTCAGGGG + Intergenic
942478983 2:176361952-176361974 TTCAAACCCATGTTGTTCGAGGG + Intergenic
942615950 2:177792543-177792565 TTCAAACATAAAATGCTCCATGG - Intronic
942991120 2:182204392-182204414 TTCAAACTTATGTTGTTCAAGGG - Intronic
943024059 2:182607639-182607661 TTCAAACCCATGTTGTTCAGGGG + Intergenic
943296028 2:186140389-186140411 TTCAAACCCATTTTGGTCAAGGG + Intergenic
943638531 2:190333412-190333434 TTCAAATCCATGTTGTTCAAGGG - Intronic
943820139 2:192311853-192311875 TGCAAACATATATTGGCCAAAGG - Intergenic
944052368 2:195485097-195485119 TTCGAACCTGTGTTGTTCAAGGG + Intergenic
944100361 2:196019836-196019858 TTCAAACCTGTGTTATTCAAGGG - Intronic
944168226 2:196745818-196745840 TACAGTCATATGTTGCTTAATGG + Intronic
944208515 2:197182818-197182840 TTCAAAGCTGTGTTGTTCAAGGG + Intronic
944247597 2:197547260-197547282 TTCAAACCTGTGTTGTTCAAGGG + Intronic
944303555 2:198153558-198153580 TTTCAACATATCTTTCTCAATGG + Intronic
944658897 2:201903847-201903869 TTCAAACCCATGTTGTTCAAGGG + Intergenic
944952743 2:204770853-204770875 TCTAAACATATCTTGGTCAATGG - Intronic
945138819 2:206661440-206661462 TTCAAACCTGTATTGTTCAAGGG - Intronic
945146168 2:206740535-206740557 TTCAAACCCATGCTGTTCAAGGG + Intronic
945467802 2:210190281-210190303 TTCAAACATTTTTTTCTGAACGG + Intronic
945625245 2:212196517-212196539 TTCAAATCTGTGTTGTTCAAAGG + Intronic
945643917 2:212466215-212466237 TTCAAACCTGTGTTGTTCAAGGG - Intronic
945692412 2:213054284-213054306 CTAAAATATATGTTTCTCAAAGG + Intronic
945796942 2:214376867-214376889 TTCAAACCTGTGTTGTTCCAGGG - Intronic
945971560 2:216236276-216236298 TTCAAACTCATGTTGTTCAAGGG + Intergenic
946098499 2:217297700-217297722 TTCAAACCTGTGTTGTTTAAGGG - Intronic
946677936 2:222182217-222182239 TTCAAACCCATGTTGTTCAAGGG - Intergenic
946911031 2:224460939-224460961 TTCAAACCCATGTTGTGCAAGGG + Intergenic
946915234 2:224512873-224512895 TTCAAACTTGTGTTGTTCAAGGG - Intronic
946970502 2:225085836-225085858 TTCAAACCTATGTTGTTCAAGGG - Intergenic
947120600 2:226810763-226810785 TTCAAACCCCTGTTGTTCAAGGG + Intergenic
947250414 2:228096603-228096625 TTCAAACCCATGTTGTTCAGGGG + Intronic
947339285 2:229120562-229120584 TTCAAACCCATGCTGTTCAAGGG + Intronic
947467376 2:230363462-230363484 TTCAAACAGATATTTCTCAAAGG - Intronic
947605874 2:231484778-231484800 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
947762584 2:232614224-232614246 TTCAAACCTGTGTTGTTCAAGGG - Intronic
947973410 2:234343805-234343827 TTCAAACTTGTGTTGTACAAGGG + Intergenic
948342539 2:237266346-237266368 TTCAAACCCATGTTGTTCAAGGG - Intergenic
948451158 2:238073669-238073691 TTCAAACCCATGTTGTTCAAGGG - Intronic
948548672 2:238752748-238752770 TTGAAACCCATGTTGTTCAAGGG + Intergenic
948926240 2:241100291-241100313 TTCAAACCCTTGTTGTTCAAGGG - Intronic
1168741100 20:192138-192160 TTCAAACCTACGCTGCTCAAGGG - Intergenic
1168908470 20:1426000-1426022 TTCAAACACGTGTTGTTTAAGGG + Intergenic
1168989813 20:2085499-2085521 TTCAAATCTGTGTTGGTCAAGGG - Intergenic
1169058788 20:2645416-2645438 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1169070664 20:2727554-2727576 TTCAAACCTGTGTTTTTCAAGGG + Intronic
1169202877 20:3722319-3722341 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1169451536 20:5716172-5716194 TTCAAACCAGTGTTGTTCAAGGG + Intergenic
1169536346 20:6546002-6546024 TCCAAACCTATGTTGTTCAAGGG + Intergenic
1169776238 20:9256676-9256698 TAAAAAGATATGTTCCTCAAGGG - Intronic
1169818040 20:9678971-9678993 TTCAAACCTGTTTTGTTCAAGGG - Intronic
1169877842 20:10317158-10317180 TTCAAACCCAGGTTGTTCAAGGG + Intergenic
1169894307 20:10486068-10486090 TTCAAACTCATGTTGTTCAAGGG + Intronic
1170114397 20:12840946-12840968 TTCAAACCTGTGTTGTTTAAGGG + Intergenic
1170227981 20:14013237-14013259 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1170419317 20:16176844-16176866 TCCAAACTCATGTTGTTCAAGGG - Intergenic
1170440402 20:16373771-16373793 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1170602744 20:17854151-17854173 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1170702686 20:18717651-18717673 TTCAAACCTGTGTTATTCAAAGG + Intronic
1170879187 20:20279641-20279663 TTCAAATCCATGTTGCCCAAGGG + Intronic
1170903407 20:20488190-20488212 TTCAAACCCATGTTGCTGAAAGG + Intronic
1171418111 20:24997333-24997355 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1172532235 20:35640159-35640181 TTAAAGGAAATGTTGCTCAAAGG - Intronic
1172651524 20:36505975-36505997 TGCAAACCTGTGTTGTTCAAGGG + Intronic
1172679155 20:36698638-36698660 TTCAAACCTGTGTTGGTCAAGGG + Intronic
1172724701 20:37029432-37029454 TGCAAAAACATGTTGTTCAAGGG + Intronic
1172760768 20:37319857-37319879 TTCAAACCCATGTTGCTCAAGGG - Intergenic
1172858551 20:38028088-38028110 TTCAAATCTGTGTTGTTCAAGGG + Intronic
1172921018 20:38482343-38482365 TTGAAACCCATGTTGTTCAAGGG + Intronic
1172922934 20:38501735-38501757 TTCAAATACATGTTGTTCAATGG - Intronic
1172960173 20:38793489-38793511 TTCAAACCCATGTTGCCTAAGGG - Intergenic
1173289888 20:41705382-41705404 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1173312322 20:41908466-41908488 TTCAAACTTGTGTTATTCAAAGG + Intergenic
1173342799 20:42168264-42168286 TTCAAACCCATGTTGTTCAAGGG + Intronic
1173675392 20:44830579-44830601 TTCAAACCTGTGTTGTTCAGGGG + Intergenic
1173944446 20:46939463-46939485 TTCAGACATAGCTTGATCAAGGG - Intronic
1174523054 20:51147593-51147615 TTCAAACCCACGTTGTTCAAGGG + Intergenic
1174768836 20:53279236-53279258 TTCAAGCTCATGTTGTTCAAGGG + Intronic
1174839643 20:53889600-53889622 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1174950334 20:55035420-55035442 TTCAACCTTATCTTGGTCAAGGG - Intergenic
1177056518 21:16310837-16310859 TGCAAACAAAAATTGCTCAAAGG - Intergenic
1177122743 21:17158162-17158184 TTAAAACCCATGTTGCTTAAGGG - Intergenic
1177259150 21:18706679-18706701 TTCAAACGTGTGGTGTTCAATGG - Intergenic
1177303369 21:19280424-19280446 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
1177345534 21:19863715-19863737 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1177375243 21:20262041-20262063 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
1177478850 21:21659924-21659946 TTCAAACTTGTGTTGTTTAAGGG - Intergenic
1177499099 21:21927839-21927861 TTCAAACCTGTGTTGTGCAAGGG - Intergenic
1177877693 21:26654239-26654261 TTCAAATCTGTGTTGTTCAAGGG - Intergenic
1177910762 21:27028441-27028463 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1177946566 21:27478168-27478190 TTCAAACCTACCTTGTTCAAGGG - Intergenic
1178153346 21:29822000-29822022 TTCAAACTTGTGTTGTTCAAAGG + Intronic
1178261348 21:31102692-31102714 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
1178449837 21:32687707-32687729 TTCAAACCTGTGTTGTTGAAAGG - Intronic
1178869039 21:36356456-36356478 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1179004510 21:37499806-37499828 TTCAAACCTGTATTGTTCAAGGG - Intronic
1179161336 21:38902056-38902078 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1179206816 21:39288922-39288944 TTCAAACCCATATTGTTCAAGGG + Intronic
1179345909 21:40557079-40557101 TTCAAACCCATGTTGTTGAAGGG + Intronic
1181020202 22:20096387-20096409 TTCAAATCCATGTTGTTCAAGGG + Intronic
1181394842 22:22613777-22613799 TTCAAACCAATGTTATTCAAGGG - Intergenic
1182138961 22:27935385-27935407 TTCAAATCCATGTTGCTCAAGGG - Intergenic
1182404233 22:30110747-30110769 CTCAAACCCATGTTGTTCAAAGG - Intronic
1182866575 22:33609565-33609587 TTCAACCCCATGTTACTCAACGG - Intronic
1184008402 22:41728185-41728207 TTCAAGCCTGTGTTGTTCAAGGG + Intronic
1184072466 22:42154579-42154601 TCCTAACATATGCTGCCCAATGG + Intergenic
949247253 3:1939923-1939945 TTTAAACATATTTTGTTCACTGG + Intergenic
949248707 3:1957152-1957174 TTCAAACTCACGTTGTTCAAAGG - Intergenic
949340818 3:3028811-3028833 CTCAAACCTGTGTTGTTCAAGGG - Intronic
949365229 3:3273422-3273444 TTCAAACCCGTGTTGTTCAAGGG + Intergenic
949443731 3:4111317-4111339 TTCAAACCCATGTTGTTCAAGGG + Intronic
949522058 3:4866442-4866464 TTCAAACCCATGTTGTTCAAGGG + Intronic
949557121 3:5164191-5164213 TTCAAACCTGTGTAGTTCAAGGG + Intronic
949587366 3:5454955-5454977 TTTAAACCCATGTTGTTCAAGGG + Intergenic
949684807 3:6556638-6556660 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
950066798 3:10118447-10118469 TTCAAACATGTATTGTTCAAGGG - Intronic
950413376 3:12853739-12853761 TTCAAACATTTGCTGAGCAAAGG + Intronic
950571774 3:13804826-13804848 TTCAAACCCGTGTTGCTCAAAGG - Intergenic
950955467 3:17048272-17048294 TTCAAACTTGTGTTGTCCAAGGG - Intronic
950976665 3:17253822-17253844 TTCAAACCTGTGTTGTTCAAGGG - Intronic
950997703 3:17521212-17521234 TTCAAACCCATGTTGTTCAAGGG - Intronic
951015159 3:17723579-17723601 TTCAAACCCATGTTGTTCAAGGG - Intronic
951082162 3:18465590-18465612 TTCAGACTTGTGTTGTTCAAGGG - Intergenic
951170518 3:19536687-19536709 TTCAAACCCATGTTGTTGAAGGG + Intergenic
951704660 3:25531556-25531578 TTCAAACATACATTGCTCTTGGG - Intronic
951725280 3:25750998-25751020 TTCAAACCCATGTTCTTCAAGGG + Intronic
951875173 3:27416648-27416670 TTCAAACTCATATTGTTCAAGGG + Intronic
951959168 3:28295922-28295944 CTCAAACCCATGTTGTTCAAGGG + Intronic
951965630 3:28381535-28381557 TTCAAACCTATGTTATTCAAGGG + Intronic
952030191 3:29132185-29132207 TTCAAACAGAAGATGCTAAAGGG + Intergenic
952229791 3:31418082-31418104 TTCAAACTTGTGTTGCTCAAGGG - Intergenic
952388177 3:32858164-32858186 TTCAAACCCGTGTTGTTCAAGGG + Intronic
952488437 3:33840419-33840441 TTCAAATCTGTGTTGTTCAAGGG + Intronic
952563963 3:34633297-34633319 TTCAAACTCATGTTGTTTAAGGG - Intergenic
952908370 3:38159657-38159679 TCCAAACCTGTGTTGTTCAAGGG + Intergenic
953085153 3:39658614-39658636 CTCAAACCTATGCCGCTCAAGGG + Intergenic
953268701 3:41418464-41418486 TTCAAACCCGTGTTGTTCAAGGG + Intronic
953274357 3:41480400-41480422 TTCAAACCCATGTTGTTCAGGGG - Intronic
953545234 3:43859595-43859617 CTCAATCAAATGTTGCTCAGGGG - Intergenic
953618804 3:44514718-44514740 TTCAAATCCATGTTGTTCAAGGG - Intergenic
953662766 3:44903074-44903096 TTCAAACCGATGCTGTTCAAGGG - Intronic
953866306 3:46586101-46586123 TTCAAACATATGTTGCTCAAGGG + Intronic
953868618 3:46606724-46606746 TTCAAACCCAAGTTGTTCAAGGG + Intronic
953938248 3:47065981-47066003 TTCAAACTCATGTTGTTCAAGGG - Intronic
953955124 3:47226106-47226128 TTCAAACCCGTGTTGTTCAAGGG + Intergenic
954761308 3:52876467-52876489 TTCAAACTCATGTTCTTCAAGGG - Intronic
954884556 3:53860623-53860645 TCCAAACCTGTGTTGTTCAAGGG - Intronic
955141538 3:56274550-56274572 TTCAAGCCCATGTTGTTCAAAGG + Intronic
955152427 3:56381507-56381529 TTCAAACCCATGTAGTTCAAGGG + Intronic
955257308 3:57345986-57346008 TTGAAACCCATGTTGTTCAAGGG + Intronic
955261882 3:57399629-57399651 TTCAAACCTGTGTTGTTCAGTGG - Intronic
955425862 3:58788986-58789008 TTCAAACCCATGTTGTTCAAGGG + Intronic
955504959 3:59622964-59622986 TTCAAACTCATGTTGTTCAAGGG + Intergenic
955574114 3:60340660-60340682 TTAAAACCTGTGTTGTTCAAGGG - Intronic
955689812 3:61579875-61579897 TTCAAACCCATGTTGTTCGAGGG - Intronic
955750565 3:62182246-62182268 TTCGAACCTGTGTTGTTCAAGGG + Intronic
955817453 3:62860580-62860602 TTCAAACCCACGTTGGTCAAGGG + Intronic
955959625 3:64326922-64326944 TTCAAACCTGTGTTGTTCCAGGG + Intronic
956085509 3:65605105-65605127 TTCAAACATTTATTGTACAAGGG + Intronic
956180724 3:66515740-66515762 TTCAAACTCATGTTATTCAAGGG + Intergenic
956361907 3:68457519-68457541 TTCAAATTCATGTTGCTCAAGGG + Intronic
956460757 3:69469605-69469627 TTCAATTATATTTTGCTCACTGG + Intronic
956794523 3:72705654-72705676 TTCAAACCCATGTTGTTCAAGGG - Intergenic
956806569 3:72819697-72819719 TTCAAACATGTTTTGTTCAAGGG + Intronic
956986274 3:74704485-74704507 TACAAACATCAGTTTCTCAATGG + Intergenic
956999982 3:74874270-74874292 CTCAAACCTATGCTGCTCGAGGG - Intergenic
957347845 3:78984837-78984859 TTCAAACTCATGTTGTTTAAGGG - Intronic
957423522 3:80004569-80004591 TTCAAATATTTGTCTCTCAAGGG - Intergenic
957428159 3:80066851-80066873 TTCAAATGCATGTTGTTCAAGGG + Intergenic
957460023 3:80504497-80504519 TTTAAACCCATGTTGTTCAAAGG + Intergenic
957849444 3:85787671-85787693 TTCAAACCCATCTTGTTCAAGGG + Intronic
958075821 3:88676903-88676925 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
958119879 3:89271818-89271840 TTCAAACCCATGTTGTTCGAGGG - Intronic
958602738 3:96318674-96318696 TTTAAACCCATGTTGCTCAAGGG + Intergenic
958661184 3:97069435-97069457 TTCAAACTTGTATTGTTCAAGGG + Intronic
958781179 3:98544440-98544462 TTCAAAAGTATGTTGCACATAGG + Intronic
958915883 3:100049601-100049623 TTCAAAACCATGTTGTTCAAGGG - Intronic
959014952 3:101123257-101123279 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
959109368 3:102103746-102103768 TTCAAGCCTATGTTGTCCAAGGG - Intronic
959152785 3:102628002-102628024 TTCAAACCCATATTGTTCAACGG - Intergenic
959267026 3:104155477-104155499 CTCAAATTTGTGTTGCTCAATGG + Intergenic
959349364 3:105241550-105241572 TTCAAACCCATGTTATTCAAGGG - Intergenic
959444163 3:106417137-106417159 TCCAAACCTATGTTGTTCAAGGG - Intergenic
959531970 3:107443269-107443291 CCCAAACATCTGTTGCTAAACGG + Intergenic
959596994 3:108139627-108139649 TTGAAACCTGTGTTGTTCAAGGG - Intergenic
959603256 3:108212867-108212889 TTCAAACCCGTGTTGTTCAAGGG - Intronic
959668446 3:108947431-108947453 TTCAAACCTGTGTTGTTCAAGGG + Intronic
959768687 3:110066763-110066785 TTCAAACTTGTGTTGCATAAGGG - Intergenic
959773494 3:110128003-110128025 TTCAAACCTATGTGGTTCAAAGG + Intergenic
959847452 3:111050736-111050758 TCCAAACCCATGTTGTTCAAGGG - Intergenic
960004619 3:112769332-112769354 TTCAAACCCATGTTGTTCAAGGG + Intronic
960077581 3:113505233-113505255 CTCAAACTCATGTTGTTCAAAGG + Intronic
960369765 3:116820180-116820202 TTCAAATCTGTGTTGTTCAACGG + Intronic
960489458 3:118296599-118296621 ATTATACATATGTAGCTCAATGG + Intergenic
960865654 3:122197091-122197113 TCCAAAGAGATGTTGGTCAAAGG - Intronic
961841563 3:129717952-129717974 TTCAGACCTTTGTTGTTCAAGGG - Intronic
961983620 3:131107771-131107793 TTCAAACCCATGTTATTCAAGGG + Intronic
962068213 3:132005821-132005843 TTCAAACCCATATTGTTCAAGGG + Intronic
962194141 3:133343902-133343924 TTTAAACGTATGTTGTTCAAGGG - Intronic
962256597 3:133874173-133874195 TTCAAACCCATCTTGTTCAAGGG + Intronic
962347923 3:134634648-134634670 TTCAAACCCATGTTGTTCAAGGG - Intronic
962523305 3:136216732-136216754 TTCAAACCCATGTTGTTCAAGGG - Intergenic
962545079 3:136426013-136426035 TTCCAAACTATGTTGTTCAAGGG - Intronic
962551666 3:136499146-136499168 TTCAAACCCATGTTGTTCAAAGG + Intronic
963015930 3:140823851-140823873 TTCAAACCGATGTTGTTCACGGG - Intergenic
963031612 3:140983926-140983948 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
963146333 3:141999051-141999073 TTCAAGCCCATGTTGTTCAAGGG - Intronic
963190016 3:142459595-142459617 TTCAAACTCATGTTGTTCAAGGG - Intronic
963335315 3:143968773-143968795 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
963490795 3:145998027-145998049 TTCAAACCCATGTTGTTCAGGGG - Intergenic
963809182 3:149757905-149757927 CTCAAACCTATGCCGCTCAAGGG - Intergenic
963810269 3:149769907-149769929 TTCAAACTCATGTTGTTCAAAGG - Intronic
963982240 3:151551533-151551555 TTCAAACTCATGTTGTTCAAGGG + Intergenic
964007116 3:151844515-151844537 TTGAATTATATGTTGATCAATGG - Intergenic
964063702 3:152556452-152556474 AAGTAACATATGTTGCTCAAGGG - Intergenic
964182049 3:153900328-153900350 TTCAAACTCATGTTGTACAAAGG - Intergenic
964372531 3:156015945-156015967 TTCAAACCCATGTTGTTTAAGGG + Intergenic
964578491 3:158202488-158202510 TTGAAACCCATGTTGTTCAAGGG + Intronic
964592548 3:158380896-158380918 TTTAAACACATGTTGTTTAAGGG - Intronic
964740794 3:159963717-159963739 TTCAAACTGATGTTGTTCAAGGG + Intergenic
964791456 3:160456595-160456617 TTCAAACCTGTCTTGTTCAAGGG - Intronic
964833975 3:160916701-160916723 TAGAAACATATGTTTCTCAAAGG - Intronic
964836566 3:160945673-160945695 TTCAAACCCAGGTTGTTCAAGGG - Intronic
964956444 3:162363818-162363840 TTCAAACCCATGTTGTTCAAAGG - Intergenic
965187120 3:165479181-165479203 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
965319810 3:167239346-167239368 TTCAAACCTATGTTTTTCAAGGG - Intergenic
965330951 3:167373907-167373929 TTCAAACCTATGATGTTCAAGGG + Intronic
965392585 3:168122867-168122889 TTCGAACTTGTGTTGTTCAAGGG + Intergenic
965523723 3:169695236-169695258 TTCCAAAATATGTAGGTCAAAGG + Intergenic
965782097 3:172296743-172296765 TTCAGACCTGTGTTGTTCAAGGG - Intronic
966370954 3:179250239-179250261 TTCAAACCCATGTTGTTCAAAGG + Intronic
966401748 3:179554574-179554596 TTCAAATCCATGTTGTTCAAGGG + Intergenic
966699774 3:182835230-182835252 TACAAACCTGTGTTGTTCAAGGG + Intronic
966760525 3:183413976-183413998 TTCAAACCTATGTTGTTCAAGGG + Intronic
966981486 3:185140196-185140218 TTCAAACCCATGTTGTTCAAGGG + Intronic
967232554 3:187354075-187354097 TTCAAACCTGTGCTGTTCAAGGG + Intergenic
967620930 3:191632864-191632886 TTCAAATTCATGATGCTCAAGGG - Intergenic
967720048 3:192806466-192806488 CTCAAACCTGTGTTGTTCAAGGG + Intronic
968242170 3:197100041-197100063 TTCAAACCTGTGTTGTTCAAGGG + Intronic
968344941 3:197995006-197995028 TTCCAACCTATGTTGTTCAAGGG - Intronic
968644543 4:1733246-1733268 TAAAAACATAAGTGGCTCAATGG - Intronic
969625838 4:8305174-8305196 TTCAGACCCATGTTGTTCAAGGG + Intronic
969665519 4:8555037-8555059 TTCAAATCCATGTTGTTCAAGGG - Intergenic
969968567 4:11022456-11022478 TTCAAAAATCTGTTGTTCAATGG - Intergenic
970071689 4:12166607-12166629 TTCAAACCTGTGTTGCTCAAGGG + Intergenic
970113957 4:12671654-12671676 TTCAAATCCATGTTGTTCAAGGG + Intergenic
970127846 4:12834380-12834402 TTAAAACCTGTGTTGTTCAAGGG - Intergenic
970156430 4:13146069-13146091 TTCAAACCCATGTTGATCAACGG - Intergenic
970236517 4:13964279-13964301 CTCAAATCTCTGTTGCTCAAGGG - Intergenic
970393488 4:15641289-15641311 TTCAAACCTGTGTTGTTCAAGGG - Intronic
970422358 4:15917030-15917052 TTCAAACCTGTGTAGTTCAAGGG - Intergenic
970490510 4:16568800-16568822 TTCAAACTGATGTTGTTCAAGGG + Intronic
970898758 4:21134124-21134146 TTCAAACCCATGTTGTTCAAAGG - Intronic
971070529 4:23086186-23086208 TTCAAACACATATCGTTCAAGGG + Intergenic
971278372 4:25219643-25219665 TTCAAACCCATGTTCTTCAAAGG + Intronic
971407198 4:26333039-26333061 TTCAAATCTGTGTTGTTCAAGGG - Intronic
971621716 4:28862923-28862945 TTCAAGCCCATGTTGTTCAAGGG + Intergenic
971862981 4:32132450-32132472 TTCAAACCCATGATGTTCAAGGG + Intergenic
971983819 4:33793308-33793330 TTCAAATTTATGTTGTTCAAGGG - Intergenic
972076585 4:35097336-35097358 TTCAAACCTGTGCTGGTCAAGGG + Intergenic
972166866 4:36297228-36297250 TTCAAACCTATGTTGTTCAAGGG + Intronic
972362676 4:38342853-38342875 TTCAAACCGATGTTGTTGAAGGG - Intergenic
972392901 4:38629877-38629899 TTCAAGCCCATGTTGCTCAAGGG + Intergenic
972696718 4:41453654-41453676 TTCAAACCTGTGTTATTCAAGGG + Intronic
972897463 4:43641168-43641190 TTCATATCTATGTTGTTCAAGGG - Intergenic
972925869 4:44006420-44006442 TTCAGATCTATGTTGCTCAAAGG - Intergenic
973061279 4:45729004-45729026 TTCAAATACATGTTGTTCAAGGG - Intergenic
973064129 4:45766249-45766271 TTCAAACACATATTGTTCAAGGG - Intergenic
973133877 4:46682040-46682062 TTCAAACCTATTTTGTTCAAGGG - Intergenic
973575371 4:52282637-52282659 TTCAAACTTGTGTTGTTTAAAGG - Intergenic
974506128 4:62774553-62774575 ATCAAACCTGTGTTGTTCAAAGG + Intergenic
974536134 4:63178340-63178362 TTCAAACCCATGTTGTTTAAGGG + Intergenic
974853820 4:67435274-67435296 TTTAAACCTGTGTTGTTCAAGGG - Intergenic
974900280 4:67988207-67988229 TTCAAATCCATGTTGTTCAAGGG + Intergenic
975045853 4:69803056-69803078 TTCAAATATATCTTGCTGATAGG + Intergenic
975068376 4:70098925-70098947 TTCAAACCTATGCTGTTCAAGGG + Intergenic
975174674 4:71274370-71274392 TTCAAACCTGTGTTGTTCAGTGG + Intronic
975509634 4:75180108-75180130 TTCAAACCTGTGTTGCTCAAGGG + Intergenic
975527089 4:75362713-75362735 CTCAAACCCATGTTGTTCAAGGG + Intergenic
975540419 4:75504271-75504293 TTCAAATTTGTGTTGTTCAAGGG - Intronic
975601979 4:76110702-76110724 TTCAAACCTGTGTTGTTCAAGGG - Intronic
975663066 4:76706663-76706685 TTCAAGCTTCTGTTGTTCAAGGG + Intronic
975728828 4:77318382-77318404 TTCAGACATGTTTTGTTCAATGG + Intronic
975795248 4:78000237-78000259 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
975814025 4:78198636-78198658 TTGAAACCCATGTTGTTCAAGGG - Intronic
975908239 4:79241056-79241078 TTCAAACCTATGTTATTCAAGGG - Intronic
976083163 4:81379064-81379086 TTCAAACCTGTGTCGTTCAAGGG + Intergenic
976431780 4:84970525-84970547 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
976617463 4:87093089-87093111 TTCAACTATATTTTGCTAAAAGG - Intronic
976695377 4:87914190-87914212 TTCACATAAATGTTGGTCAAAGG - Intergenic
976883845 4:89962632-89962654 TACAAACCTATGTTGTTCAAGGG + Intergenic
976921266 4:90446673-90446695 TTCCAACCCATGTTGTTCAAGGG - Intronic
977052978 4:92152960-92152982 TTAAAACTCATGTTGTTCAAGGG + Intergenic
977068027 4:92344096-92344118 TTCAAACCTGTGTTACTCAAGGG + Intronic
977099891 4:92797813-92797835 TTGAAACCCATGTTGTTCAAGGG + Intronic
977232089 4:94463703-94463725 TTCAAACCTGTGTTGTTCAAGGG + Intronic
977317614 4:95470326-95470348 TTCAAACGCATGTTGTTCAAGGG + Intronic
977337578 4:95718020-95718042 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977512822 4:97983044-97983066 TTCAAACCCGTGTTGTTCAAGGG - Intronic
977550362 4:98435625-98435647 TTCAAACTTACGTTGTTCAAGGG + Intronic
977552698 4:98458804-98458826 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977552725 4:98459041-98459063 TTCAAACCCATGTTGTTCAAGGG + Intergenic
977601252 4:98936056-98936078 TTCAAACACGTGTTGTTCAAGGG - Intergenic
977698802 4:99997678-99997700 TTCAACCTTGTGTTGTTCAAGGG - Intergenic
977805981 4:101298371-101298393 TTCAAACTTACGTTGTTAAAGGG - Intronic
977878392 4:102176013-102176035 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977923995 4:102678455-102678477 TGCAAATATGTGTTACTCAAGGG - Intronic
978148518 4:105406797-105406819 TTCAAACCCATGTTGTTCAGGGG + Intronic
978155744 4:105488021-105488043 CTCAAACCTATGCTGCTCGAAGG + Intergenic
978219186 4:106249305-106249327 TTTAAACCCATGTTGTTCAAGGG - Intronic
978222707 4:106295981-106296003 TCCAAACCCATGTTGTTCAAGGG + Intronic
978243587 4:106546120-106546142 TTTAAACCTGTGTTGTTCAAGGG + Intergenic
978311967 4:107394610-107394632 TTCAAATCCATGTTGTTCAAGGG + Intergenic
978420200 4:108524184-108524206 TTCAAAGCTGTGTTGTTCAACGG - Intergenic
978556330 4:109984669-109984691 TTCAAACCCGTGTTGTTCAAGGG + Intronic
978566597 4:110089282-110089304 TTCAAACCTATGTTGTTTGAAGG - Intronic
978685395 4:111436324-111436346 GTCAAACTTGTGTTGTTCAAAGG - Intergenic
978712353 4:111799780-111799802 TTCAAACCCATGTTGCTCATGGG + Intergenic
978909859 4:114050363-114050385 CTCAAACATACCCTGCTCAAGGG + Intergenic
978935597 4:114371316-114371338 TTCAAACCCATGTTGTTCAAAGG - Intergenic
979089443 4:116463048-116463070 TACAAAAATATGTGGCTTAATGG - Intergenic
979144955 4:117235192-117235214 TTCAAACTCATGTTGTTCAAGGG - Intergenic
979286860 4:118936063-118936085 TTCAAACCTGTGTTGCTCAAGGG + Intronic
979315889 4:119262724-119262746 TTCAAACCTGTGTTGTTCAAGGG + Intronic
979459712 4:120968047-120968069 TTCAAATCCATGTTGTTCAAGGG - Intergenic
979535756 4:121818645-121818667 TTCAAACCTGTGTTTTTCAAAGG + Intronic
979579427 4:122338796-122338818 TTCAAACCTGTGGTGTTCAAGGG + Intronic
979657604 4:123214458-123214480 TTCAAACCTGTGGTGTTCAAAGG - Intronic
979738203 4:124116259-124116281 TTCAAATGTATGTTGTTCAAGGG - Intergenic
979943724 4:126797811-126797833 TTCAAACTCATGTTGTTCAAGGG + Intergenic
980176879 4:129356604-129356626 TTCAATCATATGTCTCTTAAAGG + Intergenic
980245054 4:130228207-130228229 TTCAAACCTGTATTGCTCAAGGG + Intergenic
980254694 4:130363523-130363545 TTCAAACCCATGTCGCTCAAGGG - Intergenic
980417987 4:132518580-132518602 TTCAAACCCTTGTTGTTCAATGG + Intergenic
980445240 4:132897503-132897525 TTCAAACTTGTGTCGTTCAAGGG - Intergenic
980676796 4:136094857-136094879 TTCTGACATATGATGCTCACAGG + Intergenic
980763994 4:137274708-137274730 TTCAAAGATATGAAGATCAAAGG - Intergenic
980986403 4:139699665-139699687 TTCAAACCCATGTTGTTCAAGGG + Intronic
981056126 4:140363301-140363323 TTCAAACCCATGGTGTTCAAAGG - Intronic
981092421 4:140745375-140745397 TTCAAACCCATGTTGTTTAAAGG - Intronic
981243277 4:142504438-142504460 TTCTAACAGATGTTGCTAGATGG - Intronic
981267630 4:142805493-142805515 TTCAAACCCATGTTGCTCAAGGG - Intronic
981295615 4:143127473-143127495 TTCAAACTCATGTTGTTCATGGG + Intergenic
981421935 4:144560782-144560804 TTTAAACCTATATTGTTCAAGGG + Intergenic
981472848 4:145156840-145156862 TTCAAACCTATGTTGTTCAAGGG - Intronic
981498724 4:145423209-145423231 CTCAAACCCATGTTGTTCAAGGG + Intergenic
981571479 4:146155947-146155969 TTCAAACCCATGTCGTTCAAGGG - Intergenic
981666630 4:147234335-147234357 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
981942156 4:150293720-150293742 TTCAAACCTATGTTGTTCAAGGG - Intronic
982111563 4:152061129-152061151 TTCAAACTTGTGTTGTTTAAGGG + Intergenic
982118980 4:152121132-152121154 TTCAAACCCATATTGTTCAAGGG + Intergenic
982141320 4:152322225-152322247 TCAATGCATATGTTGCTCAAAGG - Exonic
982387725 4:154830228-154830250 TTCAAACAGCTGTTACTTAATGG - Intergenic
982411890 4:155086898-155086920 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
982473930 4:155827211-155827233 TTCAAACCCATGTTGTTCAAAGG - Intergenic
982521660 4:156424918-156424940 TTCAAACCCATGTTCTTCAAGGG - Intergenic
982591214 4:157314128-157314150 TTCAAACCCATGTTGTTCAAGGG + Intronic
982769388 4:159382003-159382025 TTTAAACTCATGTTGTTCAAGGG + Intergenic
982846828 4:160263658-160263680 TTCAAACCTGTGCTGCTCAAGGG + Intergenic
983039520 4:162908591-162908613 TTCAAACCTCTGTTGTTCAAGGG - Intergenic
983112458 4:163769852-163769874 TTCATACCTTTGTGGCTCAAGGG - Intronic
983248590 4:165318721-165318743 TTCAAACCTGTGTTGTCCAAGGG - Intronic
983344853 4:166515150-166515172 TTCAAACCTATGTTGCTCAAGGG + Intergenic
983592464 4:169428987-169429009 TTCAGACCCATGTTGTTCAAGGG - Intronic
983620376 4:169755283-169755305 TTCAAACCCTTGTTGCTCAAGGG - Intronic
983692440 4:170487215-170487237 TTGAAACCCATGTTGCTCAAGGG + Intergenic
983868864 4:172801775-172801797 TTCAAACCCCTGTTGTTCAAGGG - Intronic
983930925 4:173452447-173452469 TTCAAACTTGGGTTGTTCAAGGG + Intergenic
983933768 4:173481482-173481504 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
984071956 4:175126248-175126270 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
984251387 4:177339644-177339666 TTCAAACCCATGTTGTTCAAAGG + Intronic
984284884 4:177716601-177716623 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
984374893 4:178917195-178917217 TTCAAATTCATGTTGTTCAAGGG - Intergenic
984423805 4:179558286-179558308 TTCAAACCCATGTTGTTCAAGGG + Intergenic
984424931 4:179571352-179571374 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
984466316 4:180103177-180103199 TTCACACATTTTTTGCCCAAAGG + Intergenic
984603829 4:181760752-181760774 ATCAACCATATGATTCTCAAGGG - Intergenic
984603840 4:181760836-181760858 ATCAACCATATGATTCTCAAGGG - Intergenic
984669212 4:182463120-182463142 TTCAAGCCTGTGTTGTTCAAGGG + Intronic
984723103 4:182994934-182994956 TTCAAACTTGTGTTATTCAAGGG - Intergenic
984724040 4:183002944-183002966 CTCAAACCTATGCTGCTCTAGGG + Intergenic
984729257 4:183051892-183051914 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
984868133 4:184300464-184300486 TTCAAATTTATGTTGTTCAAGGG + Intergenic
984984422 4:185314103-185314125 CTCAAACTCATGTTGCTCAAGGG + Intronic
985168461 4:187123134-187123156 TTCAAACCTGCGTTGTTCAAGGG - Intergenic
985192014 4:187384657-187384679 TTCAAACCCATGTTGTTCAAGGG + Intergenic
985263279 4:188135157-188135179 TTCAAACCCAGGTTGTTCAAGGG - Intergenic
985307318 4:188557760-188557782 TTCAAACCCATGTTGTTTAAGGG - Intergenic
985771025 5:1810893-1810915 TTCACACCTATGTTGTTCAAGGG - Intronic
985917708 5:2936907-2936929 TTCAAACCCATGTTGCTCATGGG - Intergenic
986309108 5:6538264-6538286 TTCAAACCCATGTTTTTCAAGGG - Intergenic
986366945 5:7041948-7041970 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
986473624 5:8100887-8100909 TTCAAACCCATGTAGTTCAAGGG + Intergenic
986585030 5:9307314-9307336 GTCAAACATATGTTAAACAAGGG + Intronic
986874815 5:12095105-12095127 TTCAAACCCATGTTGTTCAACGG - Intergenic
987202143 5:15588149-15588171 TCCAAAGATTTATTGCTCAATGG + Intronic
987591021 5:19926172-19926194 TTCAAGCCTATGTTGTTAAAGGG + Intronic
987752816 5:22064045-22064067 TTCAAACTTGTGTTGCTCAATGG - Intronic
987843460 5:23251965-23251987 TTTAAACATGTGTTGTTCAAGGG - Intergenic
987994642 5:25261058-25261080 TTCAAACTTTTGTTGTTCAAAGG - Intergenic
988112917 5:26846731-26846753 TTCAAACATGTGTTGTTCACGGG + Intergenic
988118685 5:26930540-26930562 TTCAAACCCATGTTGTTCAAGGG + Intronic
988373205 5:30399866-30399888 TTAAAACATATATTGCTCCCTGG + Intergenic
988381573 5:30503273-30503295 TTCAAACCCAGGTTGTTCAAGGG + Intergenic
988445315 5:31279782-31279804 TTCAAATTCATGTTGTTCAAAGG + Intronic
988573443 5:32395581-32395603 TTCAAACCCCTGTTGTTCAAGGG - Intronic
988822478 5:34901286-34901308 TTCAAACCCATGTTGTTCAAGGG + Intergenic
989084258 5:37658258-37658280 TTCAAACCTGTGCTGTTCAAAGG + Intronic
989352668 5:40504379-40504401 TTCAAACCCATGTTGTTCAAGGG + Intergenic
989462638 5:41718358-41718380 TTCAAACCTATGTTGTTCAAGGG + Intergenic
989650078 5:43678264-43678286 CTCAAACCCATGTTGTTCAAGGG + Intronic
989714488 5:44445259-44445281 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
990000816 5:50890458-50890480 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
990363519 5:55046017-55046039 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
990364580 5:55057192-55057214 TTCAAACGCATGTTGTTCAAGGG + Intergenic
990403081 5:55459717-55459739 TTCAAACCTGAGTTGTTCAAGGG - Intronic
990414868 5:55576408-55576430 GTCAAACAGATCTTGCCCAACGG + Intergenic
990467327 5:56082606-56082628 TTCAAACCTGTGTTGTTCGAGGG - Intergenic
990786829 5:59430508-59430530 TTCAGACATATGCTGCTCACTGG + Intronic
990833377 5:59985928-59985950 TTCAAACCTGTATTGTTCAAGGG + Intronic
991098380 5:62763786-62763808 TTCAAACCCATGTTGTTCAAGGG + Intergenic
991399484 5:66238083-66238105 TTCAAACACATGAGGCTTAAGGG - Intergenic
991954546 5:71979846-71979868 TTCAAACCCATGTTGTTCAAGGG - Intergenic
992237661 5:74728527-74728549 TTTAAACCCATGTTGTTCAAGGG + Intronic
992267948 5:75036194-75036216 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
992359739 5:76024883-76024905 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
992427707 5:76675133-76675155 TTCAAACCTGTGTTAATCAAGGG - Intronic
992542939 5:77782335-77782357 TTCAAACCTATGTTGTACAAGGG + Intronic
992715226 5:79503929-79503951 TTCAAACCTGTGTTGTTCAAGGG + Intronic
992956102 5:81910027-81910049 CTTAAACCTATGTTGTTCAAGGG - Intergenic
993020565 5:82585504-82585526 TTCAAACCCATGTTGTTTAAGGG - Intergenic
993076796 5:83242124-83242146 TTCAAATCCATGTTGCCCAAGGG + Intronic
993134899 5:83947946-83947968 TTAAAACAGATGTTAGTCAATGG - Intronic
993261683 5:85665378-85665400 TTCAAACCCATGTTATTCAAAGG - Intergenic
993348404 5:86815055-86815077 TACAAACATATGATACTGAAAGG + Intergenic
993456587 5:88134072-88134094 TTCAAACCCATGTTGTGCAAGGG + Intergenic
993811265 5:92479584-92479606 TTCAAACCTCTGTTGCGTAAGGG + Intergenic
993929468 5:93920401-93920423 TTCAAACCCATATTGTTCAAGGG - Intronic
993970404 5:94412796-94412818 TTCAAACCCATGTTGTTCAAGGG - Intronic
994004503 5:94821877-94821899 TTCAAACTTATGTTGTTTGAGGG + Intronic
994104147 5:95927147-95927169 TTCATACATATGTGCCACAATGG - Intronic
994441488 5:99811098-99811120 TTCTAAGTCATGTTGCTCAAGGG - Intergenic
994478352 5:100299687-100299709 TTCAAACCTATGTTGTTCAAGGG + Intergenic
994628245 5:102249140-102249162 TTCAAACCTGTGTTGTTCAAGGG - Intronic
994701283 5:103138866-103138888 TTCAAACACATGCTGTTCCAGGG - Intronic
994703425 5:103167019-103167041 TTCAAACCTGTGGTGTTCAAGGG + Intronic
994727711 5:103455933-103455955 TTCAAACCTGTGATGTTCAAGGG - Intergenic
994922273 5:106062520-106062542 TTCAAACCCATGTTGTTCAAGGG - Intergenic
994938376 5:106286473-106286495 TTCAAACACATGTTCTTCAAGGG - Intergenic
994977717 5:106831458-106831480 TTCAAACCTATGTTTTTCAAGGG + Intergenic
995026772 5:107432785-107432807 TTCAAACCCGTGTTGCTCAAGGG - Intronic
995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG + Intronic
995168260 5:109073813-109073835 TTCAAACTCAAGTTGTTCAAGGG + Intronic
995217340 5:109611086-109611108 TTCAAACCCATGTTGTTCAAGGG - Intergenic
995267450 5:110179748-110179770 TCCAAACATATGTTTCTATATGG + Intergenic
995534992 5:113126449-113126471 CTCAAATACATGTTGTTCAAAGG - Intronic
995609824 5:113897648-113897670 TTCAAACCCATGTTGCTTGAGGG - Intergenic
995673845 5:114639803-114639825 TTCAAACCTAAGTTGTTCAAGGG + Intergenic
995739612 5:115341627-115341649 TTCAAACTTGTGTTGTTCAGGGG + Intergenic
995830741 5:116352633-116352655 TTCAAACTCATGTTGACCAAGGG + Intronic
996005627 5:118418022-118418044 TTTAAGCATGTGTTGCTCAGGGG - Intergenic
996215524 5:120860721-120860743 TTCAAACCCATGTTGTTCAAGGG - Intergenic
996557628 5:124795522-124795544 TTCAAACTCATGCTGTTCAAGGG + Intergenic
996611040 5:125380928-125380950 TTCAAACCTATGTTGTTCAGGGG + Intergenic
996728328 5:126692447-126692469 TTTAAACATATTTTACTGAATGG - Intergenic
996844708 5:127886395-127886417 TGCAAACCTATGTTGTTCAAGGG - Intergenic
996988525 5:129598984-129599006 TTCAAACCCATGTTGTTCAAGGG + Intronic
997132016 5:131286551-131286573 TTCAAACCCATGTTGTTCAAGGG - Intronic
997149684 5:131480148-131480170 TTCAAACTGGTGTTGTTCAAGGG - Intronic
997913477 5:137899810-137899832 TTCAAACTCATGTGGTTCAAGGG - Intronic
998030950 5:138867504-138867526 TTCATACCCATGTTGCTCAAGGG - Intronic
998072970 5:139213093-139213115 TTCAAACTTGTGTTGTTCAAGGG - Intronic
998100983 5:139434271-139434293 CTCAAACCTGTGTTGTTCAAAGG + Intronic
998364496 5:141620080-141620102 TTCAAGCATAAGTTCCTGAAGGG + Intergenic
998510133 5:142706302-142706324 TTCAAACCCATGTTGTTCAAGGG + Intergenic
998701889 5:144712220-144712242 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
999114138 5:149147601-149147623 TTCAAACCTATGTTGTTCAAGGG + Intronic
999244271 5:150144971-150144993 TTCAAACCTGTGTAGTTCAAGGG - Intronic
999412475 5:151364339-151364361 TTCAAACCCATGTTGTTCAAGGG + Intergenic
999704585 5:154260663-154260685 TAAAAGCATATGTTTCTCAAGGG + Intronic
999775047 5:154805499-154805521 TTCAAACCCATGTTGTTCAAGGG + Intronic
999993862 5:157073163-157073185 TTCAAAGCCATGTTGTTCAAGGG - Intergenic
1000198327 5:158982820-158982842 TTCATACATAGGATGCTGAATGG - Intronic
1000219649 5:159201078-159201100 TTCCATCCTATGTTGTTCAAGGG - Intronic
1000266084 5:159639753-159639775 TTCAAACTTGTGCTGTTCAAGGG + Intergenic
1000493765 5:161951413-161951435 TTCAAACTCATGTTGTGCAAGGG + Intergenic
1000675145 5:164112613-164112635 TTCAAACTCATCTTGTTCAAGGG + Intergenic
1000703117 5:164477595-164477617 TTCAAATTTGTGTTGTTCAAGGG + Intergenic
1000813262 5:165888797-165888819 TTTAAACATAGGATTCTCAAGGG + Intergenic
1000922392 5:167153600-167153622 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
1000930207 5:167242456-167242478 TTCAAACCCATGTTCTTCAAAGG - Intergenic
1000947699 5:167441712-167441734 TTCATACGTATGTTGATGAAGGG + Intronic
1001132588 5:169077001-169077023 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1001345045 5:170887054-170887076 TTCAAACTCATGTTGTTCAAGGG + Intronic
1001350616 5:170959935-170959957 TTCAAACCTGTCTTGTTCAAGGG + Intronic
1001360717 5:171083528-171083550 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1001571034 5:172730764-172730786 TTCAAACCTGTGTTATTCAAAGG - Intergenic
1001655635 5:173347371-173347393 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
1001663531 5:173413893-173413915 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1002766318 6:241973-241995 TTCAAATCCATGTTGTTCAAGGG - Intergenic
1002817089 6:691275-691297 TTCAAACCCATGTTGCTTAAGGG - Intronic
1002842344 6:917043-917065 CTCAAACTCATGTTGTTCAACGG - Intergenic
1002952545 6:1829218-1829240 TTCAAACCCATGTTGTTCAAGGG + Intronic
1003232528 6:4267598-4267620 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1003375689 6:5574993-5575015 TTCAAACCCAAGTTGTTCAAGGG + Intronic
1003532187 6:6946978-6947000 TTCAAACCTGTGGTGTTCAAGGG - Intergenic
1003765507 6:9231773-9231795 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1003781962 6:9439310-9439332 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1003947106 6:11086001-11086023 TTCAAACCTATGTTGTTTGAGGG + Intergenic
1004083650 6:12422102-12422124 TTCAAGCCTGTGTTGTTCAAGGG - Intergenic
1004173185 6:13315154-13315176 TTCAAACCCATGTTGTTCAGGGG - Intronic
1004433598 6:15568508-15568530 TTCAAATCCATGTTGTTCAAGGG - Intronic
1004454859 6:15782979-15783001 TACAAACCCATGTTGTTCAAGGG + Intergenic
1004486982 6:16075852-16075874 TTCAAGCCCATGTTGCTCAAGGG - Intergenic
1004932830 6:20478229-20478251 TCCAAACCCATGTTGTTCAAGGG + Intronic
1005160202 6:22850936-22850958 TTCAAACCCATATTGTTCAAGGG - Intergenic
1005204525 6:23386513-23386535 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1005335592 6:24792876-24792898 TTCAAACCCATATTGTTCAAGGG + Intergenic
1005817416 6:29566128-29566150 TTCAAACCCTTGTTGTTCAAGGG - Intronic
1005881471 6:30065270-30065292 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1006015141 6:31074867-31074889 TTCAAATCCATGTTGCTCAAGGG - Intergenic
1006262934 6:32892027-32892049 TTCAAGCCCATGTTGTTCAAAGG + Intergenic
1006972378 6:38060032-38060054 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1007036129 6:38675458-38675480 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1007149136 6:39670658-39670680 TTCAAATTCATGTTGTTCAAGGG + Intronic
1007634518 6:43290507-43290529 TTCAAACCCGTGTTGTTCAAAGG + Intergenic
1007732604 6:43957132-43957154 TTCTAACCTGTGTTGTTCAAGGG - Intergenic
1007806503 6:44453914-44453936 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1008139988 6:47821240-47821262 TTCAAAACTGTGTTGTTCAAGGG + Intronic
1008216000 6:48789524-48789546 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1008306026 6:49901112-49901134 TTCAAATCTATGTTCTTCAAGGG - Intergenic
1008585982 6:52949875-52949897 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1008964529 6:57300954-57300976 TTCAAACACATGATGCTTTAGGG + Intergenic
1009294682 6:61931701-61931723 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1009439322 6:63657711-63657733 TTCAAACCCATGTTGTTCAAGGG + Intronic
1009463267 6:63939574-63939596 TTAAAACCCTTGTTGCTCAAGGG - Intronic
1009504221 6:64454492-64454514 ATCAAACTCATGTTGTTCAAGGG - Intronic
1009546631 6:65029460-65029482 TTTAAACCTATGCTGTTCAAGGG - Intronic
1009686799 6:66969866-66969888 TTCAAACATATGTTACAACATGG + Intergenic
1009729001 6:67574805-67574827 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1009807259 6:68616670-68616692 TTCAAACCCATGTTGATCACAGG - Intergenic
1009834205 6:68976828-68976850 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1009890774 6:69678465-69678487 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1009901239 6:69810167-69810189 TTCAAATCTGTGTTGTTCAAGGG - Intergenic
1009958565 6:70488839-70488861 ATCAAACCTATGTTGCTCAAGGG + Intronic
1009988277 6:70808202-70808224 TTCAAACCCATGTCGTTCAAGGG + Intronic
1010951454 6:82041601-82041623 TTTAAACCCATGTTGTTCAAGGG - Intergenic
1011116148 6:83894943-83894965 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1011189480 6:84714691-84714713 TGCAAACCTATGCTGCTCAAGGG - Intronic
1011566476 6:88678881-88678903 TTCAAACTTGTGTTATTCAAGGG - Intronic
1011567186 6:88688731-88688753 TTCAAACCCATGTTATTCAAGGG - Intronic
1011623318 6:89263056-89263078 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1011712847 6:90072099-90072121 TTCAAACCTGTGTTGTTTAAGGG + Intronic
1011875413 6:91954906-91954928 TTCAAACCTGTGTTTTTCAAGGG - Intergenic
1012007771 6:93735971-93735993 TTCAAATATATGTTGATTGATGG + Intergenic
1012012241 6:93804210-93804232 TTCAATCCTATGTTGTTCACAGG - Intergenic
1012107210 6:95178210-95178232 TTCAAGCCTGTGTTGTTCAAGGG + Intergenic
1012160831 6:95884052-95884074 TTCAAACTTATGTTGTTTAAGGG - Intergenic
1012266072 6:97144434-97144456 TTCAAACTTGTGTTGCTCAAGGG + Exonic
1012367231 6:98456796-98456818 TTCAAACCTATGTTACTCAAAGG - Intergenic
1012409495 6:98940302-98940324 TCCAAACCCATGTTGTTCAAGGG + Intronic
1012421270 6:99068251-99068273 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1012465230 6:99510040-99510062 TTCAAACCCATGTTGTTGAAGGG + Intronic
1012488441 6:99748891-99748913 TTCAAACCTGAGTTGTTCAAGGG + Intergenic
1012543311 6:100388389-100388411 TTCAAACCCATGTTATTCAAGGG + Exonic
1012989446 6:105910373-105910395 TTCAAACCTGTATTGCTCAAGGG - Intergenic
1013059513 6:106619418-106619440 TTCAAACCCCTGTTGTTCAAGGG - Intronic
1013059921 6:106623656-106623678 TTCAAAAATATTTTGAACAATGG - Intronic
1013205671 6:107943549-107943571 TTCAAACCCATGTTGTTGAAGGG + Intronic
1013330021 6:109091126-109091148 TTCAAACCTATGCTGTTCAAGGG + Intronic
1013363574 6:109417441-109417463 TTCAAATCCATGTTGCTCAAGGG + Intronic
1013437634 6:110127721-110127743 TTCAAATCCATGTTGTTCAAGGG - Intronic
1013477011 6:110517932-110517954 TTCAGACCTGTGTTGTTCAAGGG - Intergenic
1013613288 6:111816234-111816256 TTTAAACATATTTAACTCAAAGG + Intronic
1013804038 6:113977020-113977042 TTCAAACCTGTTTTGTTCAAGGG + Intronic
1013857106 6:114586201-114586223 TTTAAACCTATGTTGTTCAAGGG + Intergenic
1014041726 6:116835031-116835053 TTCAAACCCATGTTGTCCAAGGG - Intergenic
1014269792 6:119324080-119324102 TTCAAACCCATGTTGTTCAAGGG - Intronic
1014303216 6:119709632-119709654 TTCAAACCTGTGTTGCTCAAGGG - Intergenic
1014311828 6:119813282-119813304 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1014645866 6:123971917-123971939 TTCAAACCCATGTTGTTCAAAGG - Intronic
1014751800 6:125265465-125265487 TTCAAACTCCTGTTGTTCAAGGG - Intronic
1014960739 6:127681267-127681289 TTCAAACGCATGTTGTTCAAGGG - Intergenic
1015138192 6:129898011-129898033 TTTAAACCTGTGTTGTTCAAGGG + Intergenic
1015148240 6:130011287-130011309 TTTAAACAGAGGTTTCTCAATGG - Intergenic
1015168128 6:130221784-130221806 TTCCAACACATGTTGTTCAAGGG + Intronic
1015327214 6:131936799-131936821 TTCAAACCCATGTTCTTCAAGGG + Intergenic
1015336243 6:132042468-132042490 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
1015416173 6:132951156-132951178 TCCAAACTCATGTTGTTCAAGGG + Intergenic
1015425331 6:133059074-133059096 TTCAAGCGCATGTTGTTCAAGGG - Intergenic
1015445589 6:133300300-133300322 TTTAAACTCATGTTGTTCAAGGG + Intronic
1015646939 6:135402505-135402527 TTCAAACTCATGTTGTTCAAGGG - Intronic
1015667011 6:135642812-135642834 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
1015699478 6:136019991-136020013 TTCGAACCTATGTTATTCAAGGG + Intronic
1015960161 6:138640396-138640418 TTCAAACTTGTGTTGTTCAGGGG - Intronic
1015986570 6:138890336-138890358 TTTCAACAAATGTTCCTCAAAGG + Intronic
1015998754 6:139021477-139021499 TTAAAACATCTGTGCCTCAAAGG - Intergenic
1016056649 6:139584901-139584923 TTCAAATTCATGTTGTTCAAGGG + Intergenic
1016187540 6:141216075-141216097 TTCAAACCCACGTTGTTCAAGGG - Intergenic
1016282649 6:142436085-142436107 TTCCAACACATATTGCTCAAAGG - Intronic
1016342945 6:143082363-143082385 CTCAAACCTATGCCGCTCAAGGG - Intronic
1016427082 6:143946230-143946252 CTCAAACTCATGTTGTTCAAGGG + Intronic
1016543644 6:145195742-145195764 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1016723845 6:147335887-147335909 TTCAAATATATTTTGCTCTTTGG + Intronic
1017023350 6:150159726-150159748 TTCTAACATATGTTGCTAACAGG - Intronic
1017441668 6:154470052-154470074 TTCAAACCTACATTGTTCAAGGG + Intronic
1017572645 6:155763736-155763758 TTCAAACCCATATTGCTCAAGGG + Intergenic
1017652122 6:156593319-156593341 TTCAAATCCATGTTGTTCAAGGG - Intergenic
1017984303 6:159429594-159429616 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1018014382 6:159698992-159699014 TTCAAACCCATGTTGTTCAAGGG + Intronic
1018063765 6:160111191-160111213 TTCAAACCTGTATTGTTCAAGGG - Intronic
1018066739 6:160129869-160129891 TTCAAACCCATGTTGTTCGAGGG + Intronic
1018217358 6:161541951-161541973 TTCTAATACATGTTGTTCAAGGG - Intronic
1018344269 6:162884375-162884397 TTCAAATTTGTGTTGTTCAAGGG + Intronic
1018584557 6:165342292-165342314 TTCAAACCCGTGTTGTTCAAGGG + Intronic
1018687071 6:166311560-166311582 TTCAAACCCATGGTGTTCAAGGG - Intergenic
1019096830 6:169588540-169588562 TTCAAACCCATGTTGTTCAAGGG + Intronic
1019208962 6:170389140-170389162 TTCAAACCCATGTTGTTCAAGGG + Intronic
1019838904 7:3419118-3419140 TTGAAACCTGTGTTGTTCAAGGG + Intronic
1020202086 7:6087815-6087837 ATCAAACATATGTTCCTCTGGGG - Intergenic
1020349718 7:7205585-7205607 TTCAGACCCATGTTGTTCAAGGG + Intronic
1020398408 7:7745294-7745316 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1020433221 7:8134271-8134293 TTCACACAGATATTGCTCATTGG - Intronic
1020589067 7:10111389-10111411 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1020590072 7:10124404-10124426 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1020871286 7:13632284-13632306 TTCAAACTTTTGTTGTTAAAGGG + Intergenic
1020931988 7:14408741-14408763 TTCAACCTCATGTTGTTCAAGGG - Intronic
1020943506 7:14570858-14570880 TTCAAACCTGTGTTGTTCAAAGG + Intronic
1020970936 7:14937679-14937701 TTTAAACCTGTGTTGTTCAAGGG - Intronic
1021089770 7:16469786-16469808 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1021128574 7:16883088-16883110 TTCAAATCTATGTTGTTTAAGGG + Intergenic
1021164481 7:17319033-17319055 TTCAAACCCATGTTGTTCAAGGG + Intronic
1021353035 7:19618622-19618644 TTCAAACCTAAGTTGTTCAAGGG + Intergenic
1021407914 7:20295239-20295261 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1021809017 7:24384951-24384973 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1021854481 7:24840236-24840258 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1022061080 7:26795886-26795908 TTCAAACCTGTGTTGTTCAGGGG - Intronic
1022085046 7:27058480-27058502 ATCATACATATGTTACTAAAAGG - Intergenic
1022146069 7:27542275-27542297 TTCAAATCTGTGTTGTTCAAGGG + Intronic
1022270352 7:28801103-28801125 GTCAAAGATATATTGCTAAAGGG + Intronic
1022425665 7:30266587-30266609 TTCAAGGATATGTTGCACAGAGG + Intergenic
1022751292 7:33228907-33228929 TTCAAACAGTTGTTGTTCAAGGG + Intronic
1022868983 7:34456568-34456590 TTCAAACTTGTGTTATTCAAGGG - Intergenic
1023047389 7:36222469-36222491 TTCAAACCTGTATTGTTCAAGGG + Intronic
1023114608 7:36850075-36850097 TTCAAACCTGTGTTGATCAAGGG - Intergenic
1023115683 7:36859792-36859814 TTAAAACCCATGTTGTTCAAGGG - Intronic
1023134325 7:37036248-37036270 TTCAAACCCATGTTGCTCAAGGG + Intronic
1023296781 7:38723228-38723250 TTCCAACCTGTGTTGTTCAAGGG + Exonic
1023316958 7:38947998-38948020 TTCAAACCCCTGTTGTTCAAGGG - Intergenic
1023386203 7:39660644-39660666 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1023441670 7:40190956-40190978 TTCAAACCCCTGTTGTTCAAGGG + Intronic
1023489765 7:40726516-40726538 TTCAAACCTGTGTTGTCCAAGGG + Intronic
1023907449 7:44532456-44532478 TTCAAACTCGTGTTGTTCAAGGG - Intronic
1024407212 7:48995550-48995572 TTCAAACTCGTGTTGCTCAAAGG + Intergenic
1024560717 7:50643036-50643058 TTCAAACCTGTGTTGTCCAAGGG - Intronic
1024669386 7:51578171-51578193 TTAAAACTTCTGTTCCTCAAAGG - Intergenic
1024789850 7:52953094-52953116 TTCAAACCCATATTGTTCAAGGG - Intergenic
1024833861 7:53493364-53493386 TTTAAACCTATGTTGTTCAAGGG + Intergenic
1024927863 7:54636786-54636808 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1026324729 7:69299247-69299269 GTTAAACCCATGTTGCTCAATGG + Intergenic
1026814280 7:73497746-73497768 TTCAAACCTATGTTGTTCAAGGG + Intronic
1027242311 7:76339591-76339613 TTCAAACCTGTGTTGTCCAAGGG - Intronic
1027347360 7:77275098-77275120 TTCAAATCCATGTTGTTCAAGGG - Intronic
1027867782 7:83669975-83669997 TTCAAACTCGTGTTGCTCAAGGG + Intergenic
1027893195 7:84004866-84004888 TTCAAACCCATGTTGTTCAAGGG - Intronic
1028028837 7:85882279-85882301 TTCTAACCCATGTTGTTCAAGGG - Intergenic
1028030456 7:85905556-85905578 TTCAAACCTGTGTTGTTCAATGG - Intergenic
1028058138 7:86274591-86274613 TTCAAATTTTTGTTGTTCAAAGG - Intergenic
1028106406 7:86884394-86884416 TTCAAACTTGTGGTGTTCAAAGG - Intronic
1028152777 7:87393816-87393838 TTCAAACCCATGTTGTTCAAGGG - Intronic
1028606513 7:92661821-92661843 TTCAAACCTATGTTGTTCAAGGG + Intronic
1028628856 7:92910538-92910560 TTCAAGCTTGTGTTGCTCAAGGG - Intergenic
1028740364 7:94267735-94267757 TTCAAATATATGTTGCTAGAGGG - Intergenic
1028996959 7:97111344-97111366 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1029108780 7:98200378-98200400 TTCAAACCCATGTTGCTCCAGGG - Intronic
1029913891 7:104186162-104186184 TTCAAACCTATGTCGTTCAAGGG - Intronic
1029994392 7:104992841-104992863 TTTAAACCCATGTTGTTCAAGGG - Intergenic
1030002950 7:105085173-105085195 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1030087268 7:105827472-105827494 TTCAAACCCATGGTGTTCAAGGG - Intronic
1030131413 7:106204899-106204921 TTGAAACCCATGTTGTTCAAGGG + Intergenic
1030177336 7:106668246-106668268 TTCAAATCTGTGTTGTTCAAGGG + Intergenic
1030203078 7:106925451-106925473 TTCAAACCCATGTTATTCAAGGG - Intergenic
1030322317 7:108182228-108182250 TTCAAACCCGTGTTGTTCAAGGG - Intronic
1030360689 7:108592499-108592521 TTAAAAAATATGTTGCCCAAGGG + Intergenic
1030402819 7:109074110-109074132 TTCAAACTCATGTTGCTTCAAGG + Intergenic
1030418561 7:109277451-109277473 TTCAAACCCATATTGTTCAAGGG - Intergenic
1030558549 7:111056927-111056949 TTCAGCCCTGTGTTGCTCAAGGG + Intronic
1030573366 7:111254842-111254864 TTCCAACCTGTGTTGTTCAAAGG + Intronic
1030591785 7:111490891-111490913 TTCAAACCTGTGTTATTCAAGGG - Intronic
1030899703 7:115107282-115107304 TTCATACTTGTGTTGTTCAAGGG + Intergenic
1030921999 7:115402487-115402509 TTCAAAAATATGTAACTTAAAGG + Intergenic
1031108652 7:117578143-117578165 TTCAAACCCGTGTTGTTCAAAGG - Intronic
1031200479 7:118677928-118677950 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1031288694 7:119905835-119905857 TCCAAACATACGTTTCCCAAAGG - Intergenic
1031365315 7:120894224-120894246 TTCAAATTCATGTTGTTCAAGGG + Intergenic
1031466613 7:122119988-122120010 TTCAAACTCGTGTTGTTCAAGGG + Intronic
1031549797 7:123094808-123094830 TTCAAACCTCTGTTGTTCTAAGG + Intergenic
1031601284 7:123713753-123713775 TTCAAACCCATATTGTTCAAGGG - Intronic
1031649614 7:124271616-124271638 TTCAAACTCCTGTTGTTCAAGGG + Intergenic
1031696975 7:124869243-124869265 TTCAAACCTGTGTTGTTGAAGGG + Intronic
1031796182 7:126176849-126176871 TTCAAGCCCCTGTTGCTCAAGGG - Intergenic
1031849093 7:126841944-126841966 TTCAAACAAATGTTGTTGAGAGG + Intronic
1032305426 7:130729620-130729642 TTCAAACTCATGTTGCTCAAGGG + Intergenic
1032365602 7:131296533-131296555 TTCAAACCCATGTTCTTCAAGGG - Intronic
1032369944 7:131338811-131338833 TTCAAATCCATGTTGTTCAAGGG - Intronic
1032692773 7:134305506-134305528 TTTAAACCCATGTTGTTCAAGGG + Intronic
1032774084 7:135091495-135091517 TTCAAACCTGTGTTGTTCACAGG + Intronic
1032863188 7:135901332-135901354 TTCAAACACATGCTGTTCAAGGG + Intergenic
1032867152 7:135937639-135937661 TTCAAACCCATGTCGTTCAAGGG - Intronic
1032885656 7:136135683-136135705 TTCAAACCCAGGTTGTTCAAGGG - Intergenic
1032940636 7:136785861-136785883 TTCAAACCTGTGTTGTTTAATGG + Intergenic
1033410838 7:141116130-141116152 TTCAAACAAAGGTTTCTCAGTGG - Intronic
1033839412 7:145356177-145356199 TTAAAATACATGTTGTTCAAGGG - Intergenic
1034145974 7:148871937-148871959 TTCAAAGCTGTGTTGTTCAATGG + Intronic
1034238772 7:149593441-149593463 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1034242200 7:149619205-149619227 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1034823568 7:154239311-154239333 TTCAAACCCGTGTTGTTCAAGGG - Intronic
1034878222 7:154743952-154743974 TTCAAACCTATATTGTTCAAGGG + Intronic
1035666270 8:1382392-1382414 TTCCAACCAATGTTGTTCAAGGG + Intergenic
1035857777 8:2995059-2995081 TTAAAACTTGTGCTGCTCAAAGG + Intronic
1035924227 8:3710255-3710277 TTTAAACCTATGCTGCTCAAGGG + Intronic
1036009300 8:4703317-4703339 TTCAAATATACGTCGCTCCACGG + Intronic
1036043818 8:5117111-5117133 ATCATACATATGCTGCTTAATGG - Intergenic
1036164286 8:6418049-6418071 CTCAAACACATGTTGTTCAGGGG + Intronic
1036200720 8:6769241-6769263 TTCAAACCCGTGTTGTTCAATGG + Intergenic
1036459333 8:8938000-8938022 TTCAAACCTGCGTTGATCAAGGG + Intergenic
1036676999 8:10842397-10842419 TTCAAAAACATGATGCTCAGTGG + Intergenic
1037092391 8:14938283-14938305 TTCGAAAGTATGTTGTTCAAGGG - Intronic
1037148541 8:15605471-15605493 TTCATACCCATGTTGTTCAAGGG - Intronic
1037189596 8:16107120-16107142 TTCAAACACATATTGTTTAAGGG - Intergenic
1037242937 8:16798024-16798046 TTCAAACCTGTGTTGTTGAAGGG - Intergenic
1038098675 8:24346326-24346348 TTCAAACAAATGATACTCATGGG - Intronic
1038346007 8:26733217-26733239 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1038591740 8:28845025-28845047 TTCAAACTCATATTGTTCAAGGG + Intronic
1038846869 8:31238102-31238124 CTCAAACTTGTGTTGTTCAAGGG - Intergenic
1038923825 8:32115639-32115661 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1038954816 8:32456391-32456413 TTCAAATCTGTGTTGTTCAAGGG - Intronic
1038977540 8:32716945-32716967 TTCAACCTAATGTTGTTCAATGG - Intronic
1039033677 8:33336014-33336036 TTCAAACGCATGTTGTTCAAAGG + Intergenic
1039186086 8:34917927-34917949 TTCAAATCCATGTTGTTCAAAGG - Intergenic
1039231492 8:35453754-35453776 TTCAAACATGTGTTTCTAAAAGG + Intronic
1039270691 8:35877081-35877103 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1040062701 8:43117532-43117554 TTCAAACCCGTGTTGTTCAAGGG + Intronic
1040099741 8:43488269-43488291 TTCAAGCCTGTGTTGGTCAAAGG + Intergenic
1040765126 8:50900372-50900394 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1041180118 8:55238481-55238503 TTCAAACCCTTGTTGTTCAAGGG + Intronic
1041191208 8:55356760-55356782 TTCAAACTTGTATTGTTCAAGGG - Intronic
1041353250 8:56971398-56971420 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1041359487 8:57036986-57037008 TTCAAACCCACATTGCTCAAGGG - Intergenic
1041407750 8:57518908-57518930 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1041458852 8:58089959-58089981 TTCAAACCTGTGTTATTCAAGGG - Intronic
1041590908 8:59581947-59581969 TTTAAACCAATGTTGTTCAATGG + Intergenic
1041592549 8:59605976-59605998 TTCAAATCCATGTTGTTCAAGGG - Intergenic
1041779195 8:61558833-61558855 TTCAAACCAATGTTGTTCAAAGG - Intronic
1041992395 8:64009194-64009216 TTCAAACTAATGTTGATAAATGG + Intergenic
1042054295 8:64747647-64747669 TTCAAATCCATGTTGTTCAAGGG + Intronic
1042868829 8:73379233-73379255 TTCAAACCCATGTTGCTCAAGGG - Intergenic
1042960185 8:74295026-74295048 TTCAAACTTATGTAGGTCCAGGG - Intronic
1043077723 8:75722976-75722998 CTCAAACTCATGTTGTTCAAGGG - Intergenic
1043169420 8:76946463-76946485 TTCAAACCCAGGTTGTTCAAGGG - Intergenic
1043337768 8:79198320-79198342 TTTAAATCTATGTTGTTCAAGGG - Intergenic
1043700189 8:83277129-83277151 TTCTAACATATGTTGCAGCATGG - Intergenic
1043980078 8:86627816-86627838 TTCAAACACGTGTTGTTCAAGGG - Intronic
1044091587 8:88008921-88008943 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1044399994 8:91759351-91759373 TTCAAACCTGTGTTGTTCAATGG + Intergenic
1044438791 8:92198356-92198378 TTAAAACCTGTGTTGTTCAAGGG - Intergenic
1044489056 8:92790418-92790440 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1044526027 8:93251896-93251918 TTCAAACCCCTGTTGTTCAAGGG + Intergenic
1044650506 8:94489461-94489483 TTGAAACCCATGTTGTTCAAGGG - Intronic
1044734232 8:95262019-95262041 TTGAAACGCATGTTGTTCAAGGG - Intronic
1044912684 8:97077790-97077812 TTCAAACTCATGTTGTTCAAAGG + Intronic
1045149637 8:99389739-99389761 TTCAAACTTATATTATTCAAGGG + Intronic
1045218899 8:100177720-100177742 TTCAAACTTATATTGTTCAAGGG + Intronic
1045451450 8:102330856-102330878 TTCAAACCCATATTGTTCAAGGG - Intronic
1045668774 8:104523117-104523139 TTCAAACCCATGTTGTTCAAAGG - Intronic
1045674662 8:104593787-104593809 TTCAAACCTGTGCTGTTCAAGGG + Intronic
1045816497 8:106282810-106282832 TTCAAACCTGTGTTGTCCAAGGG + Intronic
1045832328 8:106477749-106477771 TTCAAATCCATGTTGTTCAAAGG + Intronic
1045999808 8:108406059-108406081 TTCAAACTCATATTGCTAAAGGG + Intronic
1046292587 8:112182233-112182255 TTCAAATACATATTGTTCAATGG - Intergenic
1046414593 8:113896166-113896188 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1046765599 8:118066100-118066122 TTCAAACCTATGTTGTTCAAGGG - Intronic
1046921380 8:119732922-119732944 TTCAAACCCATGTTGTTCAAGGG - Intronic
1047113118 8:121812962-121812984 CTCAAACCAATGTTGTTCAAGGG - Intergenic
1047217622 8:122889655-122889677 TTCAAACCCGTGTTGTTCAAGGG - Intronic
1047842933 8:128773787-128773809 TTCAAACTTCTGTTGTTCAAAGG + Intergenic
1047904862 8:129462127-129462149 TTCAAACCTGTGTTGTTCCAGGG + Intergenic
1048462374 8:134632063-134632085 TTCAAACCCATGTTGTTCAAGGG - Intronic
1048737994 8:137522999-137523021 TTCAACCCCATGTTGTTCAAGGG - Intergenic
1048748191 8:137639537-137639559 TTGAAAGAGATGTTGGTCAAAGG - Intergenic
1048854035 8:138671042-138671064 TTCAAGCCCATGTTGCTCAGGGG - Intronic
1048997534 8:139803687-139803709 TTCAAACCCATTTTTCTCAAAGG + Intronic
1049012915 8:139899576-139899598 TTCACACCTGTGTTGTTCAAGGG + Intronic
1049140315 8:140948890-140948912 TTCAAATCCATGTTGTTCAAGGG - Intronic
1049184684 8:141243665-141243687 TTCAAACCCACGTTGTTCAAGGG - Intronic
1049837043 8:144742946-144742968 TTCAAACCCATGTTGTTCAAAGG + Intronic
1050000258 9:1070029-1070051 TTTAAACCCATGTTGTTCAAGGG + Intergenic
1050002407 9:1092041-1092063 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
1050035361 9:1429931-1429953 TTCAAACGCATGTTGCTTGATGG - Intergenic
1050135284 9:2456867-2456889 TTCAAAAATGTGTTGAGCAATGG - Intergenic
1050302197 9:4270947-4270969 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1050349948 9:4731778-4731800 TTCAAATCCATGTTGTTCAAGGG - Intronic
1050609188 9:7333579-7333601 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
1050846298 9:10224661-10224683 TTCAAACTCATGATGTTCAAGGG - Intronic
1050957473 9:11683008-11683030 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1050975899 9:11937718-11937740 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1051124499 9:13788964-13788986 TTCAAACCTGTGTTGTTTAAGGG - Intergenic
1051128032 9:13826915-13826937 TTCACACCTGTGTTGTTCAAGGG + Intergenic
1051235647 9:14995831-14995853 TTCAAACCCTTGTTGCTCAAGGG + Intergenic
1051604100 9:18903887-18903909 TTCAAACCCATGTTGTTCAAAGG + Intronic
1051715712 9:19981205-19981227 TTCACATATATGTAGCTCACTGG + Intergenic
1051840473 9:21392047-21392069 TTCAAACCTGTGTTTTTCAAGGG + Intergenic
1052086592 9:24274580-24274602 TTCAAACCTCTGTTGTTCATAGG - Intergenic
1052308280 9:27036274-27036296 TTCAAACCTCTGTTTTTCAAGGG + Intronic
1052361820 9:27570471-27570493 TTCAATCAGATTTTGCTCCAGGG - Intronic
1052434806 9:28412815-28412837 TTTAAACCTATATTGCTCAAGGG - Intronic
1052435415 9:28421739-28421761 ATCAAACCCATGTTGTTCAAGGG + Intronic
1052472152 9:28913171-28913193 CTCAAACATATGTTCCTAACAGG + Intergenic
1052473395 9:28928430-28928452 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1052479536 9:29005808-29005830 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1052728700 9:32260877-32260899 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1052873928 9:33538060-33538082 TTCAAACTCTTGTTGTTCAAGGG + Intronic
1052968087 9:34357077-34357099 TTCAAACCCATGTTGGTCAAGGG + Intergenic
1052988970 9:34507612-34507634 TTCAAAGTCATGTTGGTCAAGGG + Intronic
1052994530 9:34544215-34544237 TTCAAACTCGTGTTGTTCAAAGG + Intergenic
1053226604 9:36363826-36363848 TTCAAACTCATGTTGTTCAAGGG - Intronic
1053373376 9:37582223-37582245 TTCAAATCTGTGTTGTTCAAGGG + Intronic
1053502115 9:38606285-38606307 TTCAAACTCTTGTTGTTCAAGGG - Intergenic
1054943918 9:70774146-70774168 TTCAAACCCCTGTTGTTCAAGGG - Intronic
1054946390 9:70800471-70800493 TTCAAACCCATGTTGTTCAAGGG - Intronic
1055280506 9:74668833-74668855 TTCAAACCTATGTTGTAGAAGGG + Intronic
1055519520 9:77066170-77066192 TTCAAACCTATGCTGTTTAAGGG + Intergenic
1055739896 9:79376478-79376500 TTTAAACCCATGTTGTTCAAGGG + Intergenic
1056024222 9:82475831-82475853 TTCAAACCTATGTTGTTTAAGGG + Intergenic
1056303210 9:85263323-85263345 TTCAAACATATATATCCCAAAGG + Intergenic
1056464677 9:86842163-86842185 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1056775335 9:89508176-89508198 TTCAAACTCTTGTTGTTCAAGGG + Intergenic
1056938832 9:90937855-90937877 TTCAAACCCATGTTGTTAAAGGG + Intergenic
1056964464 9:91154512-91154534 TTCAAACCTATGTTGTTAAAGGG + Intergenic
1057059432 9:91990318-91990340 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1057153975 9:92823392-92823414 TTCAAACTCTTGTTGTTCAAGGG + Intergenic
1057323829 9:94041179-94041201 TTCAAAGAGCTTTTGCTCAAAGG - Intronic
1057494241 9:95547399-95547421 TTAAAACATTTGTTCATCAAAGG + Intergenic
1057558330 9:96107434-96107456 TTCAAACCTGTGTTGTCCAAAGG + Exonic
1057730169 9:97601736-97601758 TTCAAACCCATATTGTTCAAGGG - Exonic
1057736449 9:97666061-97666083 TTCAAACCTGTATTGTTCAAGGG + Intronic
1057737040 9:97672621-97672643 TTCAAACCCATGTTGTTCAAGGG - Exonic
1058020590 9:100082795-100082817 TTCAAACCTATATTGTTCAAGGG + Intronic
1058511002 9:105716606-105716628 TTCAAATTCATGTTGTTCAAGGG - Intronic
1058615372 9:106821505-106821527 TTCAAAAATATCTTTGTCAAAGG + Intergenic
1058617618 9:106850144-106850166 TGCAAACTCATGTTGTTCAAGGG - Intergenic
1058665037 9:107305533-107305555 TTCAAACCCTTGTTGTTCAAGGG + Intronic
1058841686 9:108915711-108915733 TTCAAGCCTGTGTTGTTCAAGGG - Intronic
1058844237 9:108940072-108940094 TTCAAACCTATGTTGCTCAAGGG - Exonic
1058899423 9:109429540-109429562 TTCAAACCTTTGTTAATCAAGGG - Intronic
1059024666 9:110613088-110613110 TTCAAACATGTATTGTTCAAAGG + Intergenic
1059109170 9:111538531-111538553 TTCAAATCTGTGTTGTTCAAGGG + Intronic
1059898803 9:118899107-118899129 TTCAAACCTGTGTTGTTTAAGGG + Intergenic
1060573704 9:124668424-124668446 TTCAAATTCATGTTGTTCAAGGG + Intronic
1060652912 9:125345542-125345564 TTCAAACCCATGTTGTTCAAGGG + Intronic
1060711991 9:125876317-125876339 TTCAAACCTGTGTTGTTCAGGGG - Intronic
1061645376 9:131996665-131996687 TTCAAACTCATGTTGTTCAAGGG - Intronic
1061692628 9:132346049-132346071 TTCAAACTTATCTTGTTCAGAGG - Intronic
1062061653 9:134499968-134499990 TTCAAACCCGTGTTGTTCAAGGG - Intergenic
1185713348 X:2321739-2321761 TTCAAACCTGTGTTGTTTAAGGG - Intronic
1185843777 X:3417914-3417936 ATCTAACCTATGTTGTTCAAGGG + Intergenic
1185853970 X:3516452-3516474 TTCAAACCCGTGTTGTTCAAAGG - Intergenic
1185937270 X:4272629-4272651 TTCAGAAATATGTTGCACACAGG + Intergenic
1185938949 X:4291908-4291930 TTCAAATTCATGTTGTTCAACGG - Intergenic
1186019773 X:5241070-5241092 TTCAGACCTGTGTTGTTCAAGGG + Intergenic
1186033532 X:5395524-5395546 TTTAAATATGTGTTGATCAAGGG + Intergenic
1186075021 X:5868907-5868929 TTCAAACCTGTTTTGTTCAAGGG + Intronic
1186125677 X:6411383-6411405 TTCAGACCTGTGTTGTTCAAGGG + Intergenic
1186304426 X:8240188-8240210 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
1186405213 X:9295842-9295864 TTCAGACCTGTGTTGTTCAAGGG - Intergenic
1186501790 X:10056708-10056730 TTCAAACCCATGTTGTTTAAGGG - Intronic
1186538187 X:10371600-10371622 TTCAAACCTATGTTGTTCCGGGG - Intergenic
1186730002 X:12399817-12399839 TTCAAACCCATGTTGTTCAAGGG + Intronic
1186812622 X:13205207-13205229 GTCAAACTTGTGTTGCTCAAGGG + Intergenic
1186900783 X:14053213-14053235 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1186925307 X:14327277-14327299 TTCAAACCTATGTTCCTTAAGGG - Intergenic
1187062228 X:15797736-15797758 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1187342796 X:18436376-18436398 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1187441346 X:19323496-19323518 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1187489020 X:19732531-19732553 TTCAAAGCTGTGTTGTTCAAGGG + Intronic
1187538840 X:20170407-20170429 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1187541830 X:20204368-20204390 TTCATACATATGTAGTTTAAAGG - Intronic
1187846025 X:23538746-23538768 TTCAAATCCATGTTGTTCAAGGG + Intergenic
1187984787 X:24798307-24798329 TTCAAACTCATGTTGCTTAAGGG - Intronic
1188323652 X:28772596-28772618 TTAAAACATATGCAGCTAAAGGG + Intronic
1188425202 X:30038308-30038330 TTCAAGCATGTGTTGATCAAGGG - Intergenic
1188505001 X:30873182-30873204 TTCAAACCTGTGCTGTTCAAGGG - Intronic
1188535221 X:31189503-31189525 TTCAAATCTATGTTTTTCAAGGG + Intronic
1188712523 X:33418126-33418148 TTCAACCATATGCTGCTTATAGG + Intergenic
1188902068 X:35746047-35746069 TTCAAACCTATGTTGTTCAAAGG - Intergenic
1188911279 X:35850915-35850937 TTAAAATATATTTTGCTTAATGG - Intergenic
1188938572 X:36208538-36208560 TTCAAATACGTGTTGTTCAATGG + Intergenic
1189712839 X:43832387-43832409 TTCAAACCTGTGTTGTTCAGGGG - Intronic
1189763780 X:44348436-44348458 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1189979777 X:46497534-46497556 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1190039980 X:47063342-47063364 TTCAAACAAAGGTGGCTCTAGGG + Intergenic
1190475868 X:50826936-50826958 TTCAAACACATGTTGTTTAAAGG - Intergenic
1190523569 X:51305123-51305145 CTCACCCATATGTTGCACAATGG + Intergenic
1190606906 X:52153077-52153099 TTCAAACCCATGTTTTTCAAAGG + Intergenic
1190814838 X:53920791-53920813 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1190823875 X:53999126-53999148 TTCAAACCCATGTTGTTCAAGGG - Intronic
1190848814 X:54218086-54218108 TTCAAACCTGTTTTGTTCAAGGG - Intronic
1191025750 X:55911316-55911338 TTCAAACCTGTGTTTTTCAAGGG + Intergenic
1191672629 X:63762686-63762708 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1191786999 X:64926725-64926747 TTCAAACCCATGTTCTTCAAGGG - Intronic
1192113808 X:68392073-68392095 TTCAAACCTGTGTTGTTCAAGGG - Intronic
1192609533 X:72553864-72553886 TTCAAACCTGTGTTGTTCAAGGG + Intronic
1192624099 X:72710192-72710214 TTCAAACTTATGTTGTTCAGGGG - Intronic
1192666294 X:73090412-73090434 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1193319817 X:80108063-80108085 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1193337595 X:80308465-80308487 ATCAAACATATGTTGTTATATGG + Intergenic
1193570468 X:83135540-83135562 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1193596770 X:83455723-83455745 TTCAAATGTGTGTTGTTCAAAGG + Intergenic
1193701852 X:84772448-84772470 TTAAAACTTATTTTGCACAATGG + Intergenic
1193744648 X:85261181-85261203 TTCAAACCTATGTTATTCAAGGG + Intronic
1193870462 X:86791192-86791214 TTCAAACCCATATTGTTCAAGGG + Intronic
1193982200 X:88196081-88196103 TTAAAATATATGTTCCTGAATGG + Intergenic
1194284806 X:91996537-91996559 TTCAAACCTGTGTTGTTTAAGGG - Intronic
1194310027 X:92294827-92294849 TACACACATATGTTTCTCTAGGG - Intronic
1194619749 X:96156244-96156266 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1194696597 X:97059870-97059892 TTCAAACCTATGATGTTCAAGGG + Intronic
1194752236 X:97697733-97697755 TTCAAGCCTGTGTTGTTCAAGGG + Intergenic
1194934942 X:99937809-99937831 TTCAAGCTCATGTTGTTCAAAGG - Intergenic
1194936736 X:99959320-99959342 TTCAAACCTGTGTTGTTCAAAGG - Intergenic
1194967230 X:100302453-100302475 TTCAAACCCATGTTGTTCAAGGG - Intronic
1195035774 X:100970743-100970765 TTCAAACCCATGTTGTTCAAGGG + Intronic
1195164673 X:102207475-102207497 TTCAAACCTCTGTTGTTCAAGGG - Intergenic
1195194185 X:102479616-102479638 TTCAAACCTCTGTTGTTCAAGGG + Intergenic
1195309250 X:103614913-103614935 GTCAAACCTGTGTTGTTCAAGGG - Intronic
1195385247 X:104308047-104308069 TTCAAACCCATGTCGTTCAAGGG - Intergenic
1195506436 X:105663068-105663090 TTCAAACACATGTTGTTTTAAGG - Intronic
1195873648 X:109514668-109514690 TTCAAACCTGTGTTGTTTAAGGG + Intergenic
1195933577 X:110103880-110103902 CTCAAACCCATGTTGTTCAAGGG - Intronic
1195945254 X:110203378-110203400 TTCAATCATATGCTAATCAAAGG - Intronic
1196080157 X:111622158-111622180 TTCAAACCGATGTTGTTCAAGGG + Intergenic
1196082787 X:111650388-111650410 TTCAAACCCATGTTGATCAAGGG + Intergenic
1196230818 X:113218965-113218987 TTGAAACCCATGTTGTTCAAGGG - Intergenic
1196311935 X:114178587-114178609 TTCAAACTCGTGTTGTTCAAGGG - Intergenic
1196387424 X:115173708-115173730 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1196408401 X:115390675-115390697 TCCAAACCCATGTTGTTCAAAGG + Intergenic
1196908297 X:120460379-120460401 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1196964164 X:121037670-121037692 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
1197129236 X:122985222-122985244 TTCAAGCCTCTGTTGTTCAAGGG + Intergenic
1197136264 X:123063493-123063515 TTCAAACCTGTGTTGTTCAAGGG - Intergenic
1197258762 X:124293604-124293626 TTCAGACATGTGTTATTCAAGGG - Intronic
1197308750 X:124878108-124878130 TTCAAAACTTTGTTGTTCAAGGG + Intronic
1197426851 X:126307521-126307543 TTCAAAGCCATGTTGTTCAACGG + Intergenic
1197441511 X:126496317-126496339 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1197521371 X:127501783-127501805 TTCAAACTTGTGGTGTTCAAGGG - Intergenic
1197771683 X:130093349-130093371 TTTAAACCCATGTTGTTCAAGGG + Intronic
1197826823 X:130599079-130599101 TTCAAACTTGTGTTGTTCAGGGG - Intergenic
1197964987 X:132050617-132050639 TTAAAACCCATGTTGTTCAAGGG + Intergenic
1198303643 X:135356988-135357010 TTCAAACCCATGTTGTTCAATGG + Intronic
1198320252 X:135513080-135513102 TCCAAACATCTGTTGATCAAGGG - Intergenic
1198448394 X:136741241-136741263 TTCAAACCCATGTTGTTCAAGGG - Intronic
1198816641 X:140598569-140598591 TTCAAACCCATGTAGTTCAATGG - Intergenic
1198991850 X:142523661-142523683 TTCAAACATATTTTAATCAGAGG + Intergenic
1199350221 X:146791344-146791366 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1199481807 X:148305902-148305924 TTCAAACCCATGTTGTTCTAGGG - Intergenic
1199614285 X:149644119-149644141 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1199641357 X:149865575-149865597 TTCAAACCTACGTTGTTCAAGGG + Intergenic
1199967613 X:152832892-152832914 TTCAAACCCATGTTGTTCAGGGG - Intronic
1200602373 Y:5221107-5221129 TTCAAACCTGTGTTGTTTAAGGG - Intronic
1200618317 Y:5409125-5409147 TACACACATATGTTTCTCTAGGG - Intronic
1200809491 Y:7468040-7468062 TTCAAACCTGTGTTGTTCAAAGG + Intergenic
1201235847 Y:11910517-11910539 TTCAAACCTGTGTTGTTCAAGGG + Intergenic
1201607316 Y:15801200-15801222 TTCAGACCTGTGTTGTTCAAGGG + Intergenic
1201637804 Y:16144577-16144599 TTCAAACTTGTGTTATTCAAGGG + Intergenic
1201645543 Y:16225909-16225931 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1201657270 Y:16359405-16359427 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1201722395 Y:17114375-17114397 TTCAAACTCACGTTGTTCAAGGG - Intergenic
1201735810 Y:17260300-17260322 TTTAAACCTATGTTGTTCAAGGG + Intergenic
1201890800 Y:18941844-18941866 TTCAAACTCATGTTGTTCAAAGG - Intergenic
1201895480 Y:18987765-18987787 TTCCAACCTATGTTGTTCAAGGG - Intergenic
1201905917 Y:19085618-19085640 CTCAAACCTACGCTGCTCAAGGG + Intergenic