ID: 1111855730

View in Genome Browser
Species Human (GRCh38)
Location 13:93634700-93634722
Sequence CAGTAGGAAAGGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2951
Summary {0: 1, 1: 1, 2: 15, 3: 271, 4: 2663}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111855723_1111855730 21 Left 1111855723 13:93634656-93634678 CCATCACATTTGAGTTTCTAGAA 0: 1
1: 0
2: 2
3: 21
4: 267
Right 1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG 0: 1
1: 1
2: 15
3: 271
4: 2663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111855730 Original CRISPR CAGTAGGAAAGGAAGGAAGA AGG Intronic
Too many off-targets to display for this crispr