ID: 1111858498

View in Genome Browser
Species Human (GRCh38)
Location 13:93671112-93671134
Sequence CTAGCTCAGCCTGTTGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111858495_1111858498 15 Left 1111858495 13:93671074-93671096 CCTACAGCAGCATTTGCCAAAGT 0: 1
1: 1
2: 3
3: 48
4: 308
Right 1111858498 13:93671112-93671134 CTAGCTCAGCCTGTTGTAATTGG 0: 1
1: 0
2: 1
3: 10
4: 73
1111858496_1111858498 -1 Left 1111858496 13:93671090-93671112 CCAAAGTCTGTGCCATGAACAAC 0: 1
1: 0
2: 2
3: 21
4: 220
Right 1111858498 13:93671112-93671134 CTAGCTCAGCCTGTTGTAATTGG 0: 1
1: 0
2: 1
3: 10
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111858498 Original CRISPR CTAGCTCAGCCTGTTGTAAT TGG Intronic
904941984 1:34170391-34170413 CTAGCTCAGCCTATGGGAAAGGG + Intronic
905228666 1:36497005-36497027 CTACCTCAGCCTGTAGTAGCTGG + Intergenic
908858235 1:68453119-68453141 CTCTTTCAGCCTCTTGTAATGGG - Intergenic
911239713 1:95451921-95451943 ATAGCTCAGCATGTTTTCATGGG - Intergenic
913212555 1:116593658-116593680 CTTTCTCAGGCTCTTGTAATTGG + Intronic
917198963 1:172495750-172495772 CTGGCTAAGCCTGGTGTTATAGG - Intergenic
920446447 1:206022142-206022164 CTAGCCCAGCCTGCAGTAAGTGG - Exonic
1063780934 10:9323202-9323224 CCAGCCCAGCCCGTTGTATTGGG - Intergenic
1064245469 10:13664423-13664445 CTATCTCATCCTGTTGTCCTTGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1070174694 10:73960050-73960072 CTAGCTCACCCTGTGGCCATGGG - Intergenic
1070769509 10:79074108-79074130 CTAGCTTACACTGTTGTTATTGG - Intronic
1077501167 11:2910350-2910372 GTAGCTCAGCCTGATGTTACGGG - Intronic
1078184363 11:9039222-9039244 CTAGCTCAGTCTGTTGTACCAGG - Intronic
1079015204 11:16862888-16862910 CTAGCTTTGCCTGTTGTATTTGG - Intronic
1088793122 11:113244015-113244037 CGAGCACAGCCTGTTGTCACCGG - Intronic
1091500806 12:1015817-1015839 CTAGTACAACCTGATGTAATGGG - Intronic
1091849081 12:3680636-3680658 CTAGCTCAGAGTGTTGTCATGGG - Intronic
1096117539 12:49064076-49064098 CTAGGTCAGCATGTTGCAGTTGG + Intergenic
1104574195 12:129951687-129951709 CTAGGTCAGCCTGTTAAAAAAGG + Intergenic
1105215798 13:18284281-18284303 CTTTCTCAGCCTCTTATAATTGG + Intergenic
1107751856 13:43576189-43576211 TTAACACAGACTGTTGTAATAGG + Intronic
1110295181 13:73855986-73856008 CTATCTAAGGCTGTTGTAATGGG + Intronic
1111858498 13:93671112-93671134 CTAGCTCAGCCTGTTGTAATTGG + Intronic
1117022059 14:51580977-51580999 CTAGCTCAAGCTCTAGTAATAGG - Intronic
1117501194 14:56353320-56353342 CAAGGTAAGCCTATTGTAATTGG + Intergenic
1119034464 14:71217949-71217971 TTAGCTCAGGCTGCTGTAACAGG - Intergenic
1124997007 15:34733266-34733288 GTAACTCAGCCTGATGTGATGGG - Intergenic
1126242023 15:46455913-46455935 CTAGCTGAGGCTGGTGTAACAGG - Intergenic
1127043551 15:55002749-55002771 CCAGGTCACCCTGATGTAATAGG + Intergenic
1128389188 15:67171696-67171718 CCAGGTCAGCCTGTTCTAAAGGG - Intronic
1134570091 16:15283580-15283602 CTAGCTCAGCCTGAGGCCATAGG + Intergenic
1134732285 16:16472469-16472491 CTAGCTCAGCCTGAGGCCATAGG - Intergenic
1134935151 16:18239494-18239516 CTAGCTCAGCCTGAGGCCATAGG + Intergenic
1137588639 16:49679900-49679922 CTGGCTGAGTCTGGTGTAATGGG - Intronic
1144458224 17:15436454-15436476 CTGGGTCAGCCTGTCATAATTGG + Exonic
1145042973 17:19590517-19590539 CTGCCTCAGCCAGTTGGAATCGG + Intergenic
1147049955 17:37786797-37786819 CTAGCTTAGCCTGTTGGGAGAGG + Intergenic
1150281210 17:63930677-63930699 CTGGGTCAGGCTGTTGTAATGGG - Intronic
1150453664 17:65289924-65289946 CTAGCTCAGAGGGTTGTAGTAGG - Intergenic
1151618806 17:75232297-75232319 CTAGCTCAGCCTGGCTCAATGGG + Intronic
1158525366 18:58208386-58208408 CCTTCTCAGCCTGTTGTCATAGG + Intronic
1161431624 19:4235812-4235834 CCACCTCAGCCTCTTGTAACTGG - Intronic
1167199560 19:48054977-48054999 CCAGCTCAGCCTCTTCTACTTGG + Exonic
929033773 2:37672066-37672088 CTAGGTCGGCCTGTTGGGATCGG - Exonic
937910866 2:127074999-127075021 CCAGCTCAGCCTGTTCTAAGGGG + Intronic
939145692 2:138412123-138412145 CTACCTCATCATGTTTTAATGGG - Intergenic
939229089 2:139403631-139403653 CTTGCTCAGCCTATTGAAAATGG - Intergenic
943524213 2:188996449-188996471 CGAGGTCAGCCTGGTGTCATGGG + Exonic
944621272 2:201518074-201518096 CTAACTCAGCCTGTTGGACTGGG + Intronic
945525144 2:210878844-210878866 CTGCCTCAGCCTCTTGTAACTGG - Intergenic
1177451947 21:21279656-21279678 CTATCACAGCCTGTTGTTCTGGG + Intronic
1179197274 21:39176143-39176165 CTGACTCAGGCTGATGTAATTGG + Intronic
954966288 3:54614064-54614086 CAAGCACAGCATGTTGTACTTGG + Intronic
957517834 3:81278824-81278846 CCATCTCAGCCTGCTGTCATAGG - Intergenic
958029707 3:88093483-88093505 CTAGTTCAGCTAGTTGTATTTGG + Intronic
961316597 3:126040451-126040473 CTACCTCTGCCTTTTGCAATAGG - Intronic
961755657 3:129125779-129125801 CCAACTCAGCCTCTTGTACTCGG + Intronic
963563585 3:146899369-146899391 CTCACTCAGTCTTTTGTAATGGG - Intergenic
964681029 3:159338830-159338852 CAAGCACAGCCTTTTGTATTTGG - Intronic
968001053 3:195207079-195207101 CTGGCTCAGCCTGTGGTAGAAGG - Intronic
979370733 4:119882709-119882731 CTGGCTCATCCTGTGGTCATTGG + Intergenic
979748644 4:124248049-124248071 CTAGCTTATCCTGTTGACATGGG - Intergenic
982627772 4:157789028-157789050 CAAGCCCACCCTTTTGTAATTGG + Intergenic
983673091 4:170260425-170260447 CAAGCTCAGAAGGTTGTAATAGG - Intergenic
984134262 4:175916018-175916040 CTCACTCAGCCTGTTTTTATTGG + Intronic
984992202 4:185391860-185391882 CTAGCTCTGCCTGCTGTGAGAGG - Intronic
986003727 5:3650281-3650303 GTACCTCACCCTGTTGTAAGAGG - Intergenic
986672437 5:10154705-10154727 CTAGGTCAGCTTCTTGTAATGGG + Intergenic
987397648 5:17440571-17440593 CTAGTTCAGCCTCTTGGATTGGG - Intergenic
1001583452 5:172816507-172816529 CTAACCCAGCCTGGGGTAATAGG + Intergenic
1005303093 6:24490121-24490143 CTACCTCTGGCTGTTCTAATAGG + Intronic
1007000371 6:38306364-38306386 CTAGCACAGGCTGTTGTAATAGG - Intronic
1009412749 6:63385085-63385107 GAAGCTCAGCCTGTGGTATTTGG + Intergenic
1011057210 6:83218247-83218269 CTAGCTCAGCCTTCTGGAAGGGG - Intronic
1014493276 6:122089076-122089098 CTTGCTCTGCATGTTGAAATGGG + Intergenic
1016096394 6:140042992-140043014 CCAGCTCAGTCTGTTTTACTTGG - Intergenic
1018531360 6:164766952-164766974 CTGGCTCAGCCTTCTGTATTTGG + Intergenic
1020839480 7:13197545-13197567 CTAGCCCAACATGTTGAAATAGG + Intergenic
1027362723 7:77426196-77426218 CTAGCCCAGCCTGTTCGAAAGGG + Intergenic
1031463669 7:122082251-122082273 CTAGATGAGCATGTTGTGATGGG - Intronic
1040823441 8:51590651-51590673 CTATCTCTCCCTTTTGTAATGGG + Intronic
1047451025 8:124965102-124965124 CTCTCTCAGCCAGTTGTGATTGG - Intergenic
1047826092 8:128577385-128577407 CTACCTCATGCTGTTGTAATAGG - Intergenic
1049613368 8:143566116-143566138 CTGGCTCAGGCTGGGGTAATAGG - Intergenic