ID: 1111859824

View in Genome Browser
Species Human (GRCh38)
Location 13:93688708-93688730
Sequence TCTACGAATTTGCCCACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1652
Summary {0: 1, 1: 1, 2: 48, 3: 417, 4: 1185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111859824_1111859827 15 Left 1111859824 13:93688708-93688730 CCTAGAGTGGGCAAATTCGTAGA 0: 1
1: 1
2: 48
3: 417
4: 1185
Right 1111859827 13:93688746-93688768 AGAAGTTATAAAGTGCTGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 229
1111859824_1111859829 19 Left 1111859824 13:93688708-93688730 CCTAGAGTGGGCAAATTCGTAGA 0: 1
1: 1
2: 48
3: 417
4: 1185
Right 1111859829 13:93688750-93688772 GTTATAAAGTGCTGAGGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 255
1111859824_1111859826 14 Left 1111859824 13:93688708-93688730 CCTAGAGTGGGCAAATTCGTAGA 0: 1
1: 1
2: 48
3: 417
4: 1185
Right 1111859826 13:93688745-93688767 TAGAAGTTATAAAGTGCTGAGGG 0: 1
1: 0
2: 2
3: 21
4: 227
1111859824_1111859828 18 Left 1111859824 13:93688708-93688730 CCTAGAGTGGGCAAATTCGTAGA 0: 1
1: 1
2: 48
3: 417
4: 1185
Right 1111859828 13:93688749-93688771 AGTTATAAAGTGCTGAGGGGAGG 0: 1
1: 0
2: 2
3: 14
4: 186
1111859824_1111859825 13 Left 1111859824 13:93688708-93688730 CCTAGAGTGGGCAAATTCGTAGA 0: 1
1: 1
2: 48
3: 417
4: 1185
Right 1111859825 13:93688744-93688766 ATAGAAGTTATAAAGTGCTGAGG 0: 1
1: 0
2: 1
3: 35
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111859824 Original CRISPR TCTACGAATTTGCCCACTCT AGG (reversed) Intronic
900082339 1:867415-867437 TCAAGGACTCTGCCCACTCTAGG - Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901393775 1:8965449-8965471 TCTAAGAATTTGACTATTCTAGG + Intronic
901771601 1:11533181-11533203 TCCATGAATTTGACAACTCTGGG + Intronic
901901180 1:12364263-12364285 TCTATAAATTTGACTACTCTAGG + Intronic
902367444 1:15986214-15986236 TCTATGAATTTGCCTATTCTAGG + Intergenic
903268814 1:22175142-22175164 TCTATGAATTTGACTACTCTAGG - Intergenic
903269848 1:22180870-22180892 TCTATGAATTTGACTACTCTAGG - Intergenic
903784505 1:25849457-25849479 TCTACAGATTTGCCTATTCTGGG + Intronic
904080026 1:27866380-27866402 TCTATGAATTTCACGACTCTAGG + Intergenic
904108098 1:28103052-28103074 TCTATGAATTTGCCTATTTTAGG - Intergenic
904112545 1:28137681-28137703 TCTACAAATTTGACTACTCTGGG + Intergenic
904124259 1:28225500-28225522 TCTATGAATTTGCCTCTTCTAGG - Intronic
904333081 1:29778128-29778150 TTTATGAATTTGACTACTCTAGG + Intergenic
904765047 1:32839181-32839203 TTTATGAATTTGACTACTCTAGG + Intronic
905119928 1:35673794-35673816 TCTGTGAATTTGACTACTCTAGG - Intergenic
905246592 1:36619009-36619031 TCTATGAATTTGACTACTCTAGG - Intergenic
905264419 1:36741112-36741134 TCTACGGATTTGCCTATTCTGGG + Intergenic
905679882 1:39862071-39862093 TCTATGAATTTGACTACTCTAGG - Intronic
905930286 1:41782249-41782271 TCTATGAATTTGACTACTCTAGG - Intronic
906064178 1:42968392-42968414 TCTGTGAATTTGACTACTCTAGG + Intergenic
906083846 1:43112980-43113002 TTTATGAATTTGACTACTCTTGG + Intergenic
906629212 1:47350988-47351010 TCTACGAGTTTGCCTATTTTAGG + Intronic
906652594 1:47523434-47523456 TCTCTGAATTTGCCCATTCTAGG + Intergenic
906745400 1:48217926-48217948 TCTATGATTTTGACGACTCTAGG + Intergenic
906750666 1:48256519-48256541 TCTCTGAATTTGCCTATTCTGGG - Intergenic
906763061 1:48396706-48396728 TCTATGAATTTGACTACTCTTGG - Intronic
906969754 1:50499150-50499172 TCTAGGAGTTTGCCTATTCTAGG - Intronic
907169592 1:52449828-52449850 CCTATGAATTTGACTACTCTAGG + Intronic
907200683 1:52724275-52724297 TCTATGAATTTGACTACTCTAGG - Intergenic
907279290 1:53335020-53335042 TTTATGAATTTGACTACTCTAGG + Intergenic
907474486 1:54696524-54696546 TCTATGAATTTGCCTATTCTAGG + Intronic
907528888 1:55072994-55073016 TCCATGAATTTGACTACTCTAGG - Intronic
907532877 1:55119356-55119378 TCTAAGGATTTGACGACTCTAGG - Intronic
907645067 1:56234231-56234253 GCTACAAATTTGCCCAAACTAGG + Intergenic
907931449 1:59004854-59004876 TCTATGAACTTGACTACTCTAGG - Intergenic
907951794 1:59190288-59190310 TCTATGGATTTGTCCACTCCAGG - Intergenic
908110214 1:60889095-60889117 TCTATGAATTTGGCTACTCTAGG + Intronic
908130063 1:61066406-61066428 TCTATGAATTTGATAACTCTAGG - Intronic
908162994 1:61429857-61429879 TCTATGAATTTGACTACTCTAGG - Intronic
908256927 1:62310488-62310510 TCAGGGAATTTGCCCATTCTTGG - Intronic
908266364 1:62383325-62383347 TCTATAAATTTGACCACTATAGG - Intergenic
908462802 1:64362285-64362307 TCTATGAATTTGACTACTCCAGG - Intergenic
908475618 1:64484683-64484705 TCTCTGAATTTGGCTACTCTAGG + Intronic
908709474 1:66998778-66998800 TCTATGAATTTGACTACACTAGG - Intergenic
908714599 1:67055697-67055719 TCTGTGAATTTGACTACTCTAGG + Intergenic
908771420 1:67600226-67600248 TCTATGAATTTGACTGCTCTAGG + Intergenic
908776005 1:67640732-67640754 TCTATGAATTTGACTACTCTAGG - Intergenic
910208040 1:84766953-84766975 TCTACGATTTAGGCCACTGTCGG + Intergenic
910305398 1:85756994-85757016 TCTATGAATTCGACTACTCTAGG - Intronic
910340312 1:86179691-86179713 TCTATGAATTTGTCTACTCTAGG + Intergenic
910563389 1:88617279-88617301 TCTATGAATTTGACTACTATAGG - Intergenic
910599887 1:89019696-89019718 TCTATTAATTTGACTACTCTAGG - Intronic
910671344 1:89775858-89775880 TCTATGAATTTGCCTGTTCTAGG + Intronic
910951369 1:92652285-92652307 TCTATGAATTTGCTTATTCTGGG - Intronic
911140488 1:94496290-94496312 TCTATGAATTTGACTGCTCTAGG + Intronic
911580512 1:99628335-99628357 TCTATGAATTTGCCTATTTTGGG - Intergenic
912190747 1:107337401-107337423 TCTATGAATTTGCTTACTCTAGG - Intronic
912315352 1:108662892-108662914 TCTATGAATTTGGCTACTCTAGG - Intergenic
912346081 1:108964391-108964413 TTTATGAATTTGACTACTCTAGG + Intergenic
912395560 1:109340343-109340365 TCAATGAATTTGCCTATTCTAGG - Intronic
912404898 1:109428933-109428955 TCTATGAATTTGACTATTCTAGG - Intergenic
912648422 1:111416832-111416854 TCTGTGAATTTGACTACTCTAGG - Intronic
912781638 1:112554919-112554941 TCTATGAGTTTGACTACTCTAGG - Intronic
912908296 1:113730953-113730975 TCTATGATTTTGACTACTCTGGG - Intronic
912918664 1:113843471-113843493 TCTATGAATTTGACTACTGTAGG - Intronic
913094159 1:115500567-115500589 TTTACGAATTTTACTACTCTAGG - Intergenic
913429447 1:118774691-118774713 TCTACAAATTTGACTATTCTAGG + Intergenic
913665633 1:121045964-121045986 TCTATGACTTTGACTACTCTAGG - Intergenic
913960170 1:143333389-143333411 TATTTGAATTTGCCCATTCTGGG - Intergenic
914017031 1:143829235-143829257 TCTATGAATTTGACTACTCTAGG - Intergenic
914054526 1:144158962-144158984 TATTTGAATTTGCCCATTCTGGG - Intergenic
914124620 1:144807399-144807421 TATTTGAATTTGCCCATTCTGGG + Intergenic
914160755 1:145131763-145131785 TCTATGAATTTGACTACTCTAGG + Intergenic
914340968 1:146760216-146760238 TCTATGAATTTGACCAGTCTGGG - Intergenic
914655640 1:149737777-149737799 TCTATGACTTTGACTACTCTAGG - Intergenic
914749058 1:150520369-150520391 TTTATGAATTTGCCTATTCTGGG + Intergenic
914768428 1:150660721-150660743 TCTATGAATTTGCTTACTCTAGG - Intronic
914865599 1:151425555-151425577 TCTATGAATTTGACTACTCTAGG + Intronic
914973908 1:152339934-152339956 TCAATGAATTTGACTACTCTAGG - Intergenic
915144940 1:153791100-153791122 TCTATGAATATGGCTACTCTGGG - Intergenic
915224241 1:154400709-154400731 TCTATTAATTTGACTACTCTAGG + Intergenic
915235547 1:154477995-154478017 TCTATGAATTTGACTACTCTGGG + Intronic
916385826 1:164267551-164267573 TCTACGTATTTGCCTATTTTAGG - Intergenic
917102236 1:171458342-171458364 TCTATGAATTTGACTACCCTAGG - Intergenic
917129359 1:171725129-171725151 TCTATGAAATTGACTACTCTAGG + Intronic
917412400 1:174772787-174772809 TCTATGAATTTGGCTACTCTAGG + Intronic
917811774 1:178665641-178665663 TCTAGGACTTTGCCTATTCTAGG - Intergenic
917902661 1:179558281-179558303 TCTATGAATTTGACTACTCTAGG + Intronic
917985779 1:180317287-180317309 CCTATGAATTTGACTACTCTAGG - Intronic
917992482 1:180396084-180396106 TCTGTGAATTTGACTACTCTAGG - Intronic
918056697 1:181027438-181027460 TCTATGAATTTTACTACTCTGGG + Intergenic
918096251 1:181336772-181336794 TCTCTGAATTTGACTACTCTGGG + Intergenic
918421532 1:184369063-184369085 TCTATAAATTTGCCTACTCTAGG - Intergenic
918482377 1:184992354-184992376 TTTATGAATTTGCCTATTCTAGG + Intergenic
919570025 1:199236744-199236766 TCTATGAATTTGCCTATTCTGGG + Intergenic
919662035 1:200256799-200256821 TCCATGAATTTGCCTATTCTAGG - Intergenic
919787352 1:201268113-201268135 TCTATGAATTTGACCACTCTAGG - Intergenic
919816342 1:201443081-201443103 CTTACGAATTTGACCACTCTAGG - Intergenic
919858544 1:201722305-201722327 TCTATGAATTTGACTACTCTAGG + Intronic
920102188 1:203523838-203523860 TCTGTGAATTTGACTACTCTGGG + Intergenic
920286975 1:204887201-204887223 TCTATGAATTTGACCTCTCTAGG + Intronic
920658455 1:207894340-207894362 CCTATGACTTTGCCTACTCTAGG - Intronic
920894205 1:210028108-210028130 TCTATGAACTTGACTACTCTGGG + Intronic
921218556 1:212957073-212957095 TCTATGACTTTGACTACTCTGGG + Intronic
921259272 1:213371155-213371177 CCTGTGAATTTGACCACTCTAGG + Intergenic
921469404 1:215530724-215530746 TCTCTGAATTTGACTACTCTGGG - Intergenic
921493288 1:215805369-215805391 TCTATGAATTTGACTACTCTAGG - Intronic
921584216 1:216928894-216928916 TCTATGAATTTGACTACTCTGGG - Intronic
922050102 1:221980548-221980570 TCTACGAATTTGACTACTCTAGG + Intergenic
922064056 1:222118804-222118826 TCTATGAATTTGACTATTCTAGG + Intergenic
922209034 1:223473060-223473082 TCTAAGAATTTGCCTATTCTAGG + Intergenic
922443959 1:225680582-225680604 TCTAAGAATTTGACTATTCTAGG - Intergenic
922667507 1:227485303-227485325 TCTATAAATTTGACTACTCTAGG - Intergenic
922878679 1:228962214-228962236 TCTATGAAATTACCTACTCTAGG + Intergenic
922911257 1:229219677-229219699 TCTATGAATTTGACTACTCTAGG - Intergenic
922969493 1:229724058-229724080 TCTATGAATTTGCCTATTGTAGG - Intergenic
923106828 1:230860647-230860669 TCTATGATTTTGCCTACTCTAGG - Intronic
923138077 1:231135719-231135741 CCTATGAATTTGACTACTCTAGG + Intergenic
923184295 1:231555342-231555364 TCTATGATTTTGACTACTCTGGG - Intronic
923207079 1:231769549-231769571 TCTATGAATTTGACTCCTCTAGG - Intronic
923249166 1:232163431-232163453 TTTATGAATTTGCCTATTCTTGG - Intergenic
923619596 1:235567513-235567535 TCTATGAATTTGACTCCTCTAGG + Intronic
923757584 1:236806790-236806812 TCTATGAATTTGACTATTCTAGG + Intronic
923952524 1:238974743-238974765 TCTATGAATGTGACTACTCTAGG + Intergenic
924327257 1:242908502-242908524 TCTATGAATTTTCCTATTCTAGG - Intergenic
924862776 1:247942925-247942947 TCTATGAATTTCACTACTCTGGG + Intronic
924866277 1:247984934-247984956 TCTATGAATTTGACTACTCTGGG + Intronic
924870079 1:248032558-248032580 TCTATAAATTTGACTACTCTGGG + Intronic
1062790335 10:300434-300456 TCTATGAATTTGACTACTCTAGG - Intronic
1063012459 10:2037820-2037842 TCTAGGAAGATGCCCACTGTGGG + Intergenic
1063255024 10:4317929-4317951 TCCACAATTTTGCCCACACTTGG + Intergenic
1063475402 10:6324248-6324270 TCTATGAATTTGACTACTCTGGG - Intergenic
1063521587 10:6746280-6746302 TCTATGAATTTGACTACACTAGG + Intergenic
1063554834 10:7068507-7068529 TCTACGATTTTGACTACTCTAGG + Intergenic
1063836268 10:10017384-10017406 TTTATGAATTTGACTACTCTAGG - Intergenic
1064007594 10:11710876-11710898 TCTGTGAATTTGACTACTCTGGG - Intergenic
1064021459 10:11812687-11812709 TCTATGAATTTGCCTATTTTAGG - Intergenic
1064102433 10:12475329-12475351 TCCACGAATTTGACTACTCTAGG + Intronic
1064193010 10:13223850-13223872 TCTGTAAATTTGCCCATTCTAGG - Intronic
1064198691 10:13266250-13266272 TCTGTGAATTTGACTACTCTAGG + Intergenic
1064217429 10:13412020-13412042 TCTATGAATTTGCCTATTCTGGG + Intergenic
1064290071 10:14025734-14025756 TCTATCAATTTGACCACTCTAGG + Intronic
1064365674 10:14705653-14705675 TCTATGCATTTGACTACTCTAGG - Intronic
1064457554 10:15502533-15502555 TCTATGAATTTGACCACTCTAGG + Intergenic
1064516167 10:16151159-16151181 TCTATGGATTTGCCTATTCTGGG - Intergenic
1064549913 10:16489759-16489781 TCTATGAATTTGACTACTCTAGG + Intronic
1064654726 10:17545804-17545826 TCTATGAGTTTAACCACTCTAGG - Intergenic
1064691998 10:17927878-17927900 TCTATGACTTTGACTACTCTAGG + Intergenic
1064735739 10:18380006-18380028 TCTATGAATTTGACTACACTGGG + Intronic
1064806559 10:19141321-19141343 TCTATGAGTTTGCCTACTTTAGG - Intronic
1064911609 10:20407745-20407767 TCTATGAATTTGCCTATTGTGGG + Intergenic
1064972129 10:21076798-21076820 TCTATGAATTTGACTACTCTAGG - Intronic
1065070585 10:22020148-22020170 TCTATGAATTTGACTACTCTAGG - Intergenic
1065282554 10:24154550-24154572 TCTATGAATTTGGCTACTCCAGG - Intronic
1065386155 10:25135142-25135164 TCTATAAATTTGCCTATTCTAGG + Intergenic
1065488612 10:26258583-26258605 TCTACGAATTTTACTACTATGGG + Intronic
1065633421 10:27706080-27706102 TCTATGAATTTGACTATTCTAGG + Intronic
1065704843 10:28463327-28463349 TCTATGAATTTGACTACTCCAGG - Intergenic
1065709919 10:28506099-28506121 TCTATGAATTTGACTACTATAGG + Intergenic
1065718611 10:28601831-28601853 TGTATGAATTTGACCATTCTGGG - Intronic
1065873033 10:29972304-29972326 TCCATGAATTTGACCACTTTAGG + Intergenic
1066050395 10:31629748-31629770 TCTATGAATTTGACTACTCTAGG + Intergenic
1066079781 10:31919162-31919184 TTTATGAATTTGACTACTCTAGG - Intronic
1066117149 10:32250687-32250709 TCTGTGAATTTGACTACTCTAGG - Intergenic
1066201765 10:33148732-33148754 TCTATGAATTTGACTACTGTAGG - Intergenic
1066453493 10:35552307-35552329 TCTATGAATCTGACTACTCTTGG - Intronic
1066517207 10:36176237-36176259 TCTATGAATTTGCCTCTTCTAGG - Intergenic
1067028582 10:42865442-42865464 TCTCTGAATTTGCCCATTCTGGG - Intergenic
1067064895 10:43098285-43098307 TCTGTGAATTTGACTACTCTAGG + Intronic
1067145551 10:43691058-43691080 TCTAGGAATTGGACTACTCTAGG + Intergenic
1067194568 10:44105200-44105222 TTTATGAATGTGACCACTCTAGG - Intergenic
1067245502 10:44538434-44538456 TCTAAGAGTTTGACTACTCTAGG + Intergenic
1067407697 10:46038058-46038080 TCTATGATTTTGACTACTCTAGG - Intronic
1068082740 10:52339994-52340016 TCTATGAATTTAACCACTCTAGG - Intergenic
1068209148 10:53897747-53897769 TTTATGAATTTGCCTACTCTAGG + Intronic
1068742416 10:60488615-60488637 TCTACAGATTTGCCTATTCTGGG + Intronic
1068897557 10:62224136-62224158 TCTATGAATTTCACTACTCTAGG - Intronic
1069088236 10:64167300-64167322 TCTACAAATTTGACTACTGTAGG + Intergenic
1069244921 10:66192170-66192192 TCTCAGAATTTTACCACTCTGGG - Intronic
1069574963 10:69520218-69520240 TCTATGAATTTGCCTTTTCTAGG + Intergenic
1069676475 10:70252317-70252339 TCTGTGAATTTGGCCACTCTAGG - Exonic
1069851935 10:71412011-71412033 TCTATGAATTTGCCTATTCTGGG + Intronic
1069965557 10:72112361-72112383 TCTATGAATTTGACTACTCTAGG - Intronic
1070228398 10:74536711-74536733 TCTATGAATTTGCCTATTTTAGG + Intronic
1070243226 10:74704123-74704145 TCTATAAATTTGCCTATTCTAGG - Intronic
1070254194 10:74800063-74800085 TCTATGAATTTGACTACTCTAGG - Intergenic
1070311088 10:75274428-75274450 TCTCTGAATTTGACTACTCTAGG + Intergenic
1070313443 10:75290048-75290070 TCTATGAATTTGACTACTTTAGG + Intergenic
1070315360 10:75305714-75305736 TCTATGAATCTGACTACTCTAGG + Intergenic
1070553326 10:77508849-77508871 TCTGTGAATTTGCCTACTCCAGG + Intronic
1070608536 10:77917058-77917080 TCTAGGAATTTGACTACTTTAGG - Intronic
1070691231 10:78527924-78527946 TTTATGAATTTGACTACTCTGGG + Intergenic
1071558305 10:86624175-86624197 TCTATGACTTTGCCTATTCTAGG - Intergenic
1071833796 10:89398580-89398602 TTTATGAATGTGCCTACTCTAGG + Intronic
1072136488 10:92551646-92551668 TCTGTGAATTTGACTACTCTAGG - Intronic
1072217203 10:93297430-93297452 TCTATAAATTTGACTACTCTAGG + Intergenic
1072218939 10:93311307-93311329 TCTAGAAACTTGCCCACTTTTGG + Intronic
1072724599 10:97804449-97804471 TGTATGAATTTGACTACTCTAGG + Intergenic
1073182201 10:101590827-101590849 TCTATGAATTTGACTGCTCTAGG + Intronic
1073222289 10:101885563-101885585 TCTATGAATTTGACTATTCTAGG - Intronic
1073310600 10:102537605-102537627 TCTATGAATGTGACTACTCTGGG + Intronic
1073316757 10:102586907-102586929 TCTATAAATTTGCCTACCCTAGG + Intronic
1073506478 10:103997128-103997150 TCTATGATTTTGACCACTCTAGG + Intronic
1073690370 10:105801217-105801239 TCTATGAATTTGGCTACTCTAGG + Intergenic
1073866501 10:107810415-107810437 TCTATGAATTTGCCTATTTTAGG + Intergenic
1074142874 10:110690592-110690614 TCTATGAATTTGCCTATTTTAGG + Intronic
1074775935 10:116768289-116768311 TCTATGGATTTGCCTACTCCAGG - Intergenic
1074809580 10:117090345-117090367 TCTATGAATCTGACTACTCTAGG - Intronic
1074820704 10:117176079-117176101 TCTACGAATTTGCGCAACATGGG + Intergenic
1074875763 10:117611920-117611942 TCTATGAATTTGCTCATTCTGGG + Intergenic
1074926380 10:118076404-118076426 TCTATGAATTTGACTCCTCTAGG + Intergenic
1075168765 10:120093579-120093601 TCTATGAATTTGACTACTTTAGG + Intergenic
1075203880 10:120429906-120429928 TCTATGAATTTGACTAGTCTAGG + Intergenic
1075423797 10:122326385-122326407 TCTACGAATTTGATGACTCTAGG + Intronic
1075854845 10:125620829-125620851 TCTGTGAATTTGACTACTCTGGG + Intronic
1075952238 10:126490311-126490333 TCTGTGAATGTGACCACTCTAGG - Intronic
1075956014 10:126523780-126523802 CCTACAAATTTGCCTACTCTAGG + Intronic
1076005664 10:126946619-126946641 TCTCTGAATTTGACTACTCTAGG + Intronic
1076010356 10:126983119-126983141 TCTATGCATTTGCCCACAGTGGG - Intronic
1076121840 10:127942658-127942680 TCTACAAATTTGACTACTCTAGG - Intronic
1076406792 10:130217549-130217571 TCTATGAATTTGATGACTCTAGG + Intergenic
1076640887 10:131916582-131916604 TCTCTGAATTTGCCCAGTCTAGG + Intronic
1077388808 11:2289721-2289743 TCTATGGATTTGACCACCCTAGG - Intergenic
1078092372 11:8272945-8272967 CCTATGAATTTGACTACTCTAGG - Intergenic
1078340357 11:10494268-10494290 TCTATGAATTTGCCTATTCTAGG - Intronic
1078387144 11:10902576-10902598 TCTAAGAATTTAACCACTTTAGG + Intergenic
1078547243 11:12255372-12255394 TCTACGATTTTGACTACTCTAGG + Intronic
1078601852 11:12739484-12739506 TCTGTGAATTTGACTACTCTAGG + Intronic
1078624533 11:12941937-12941959 TTTACGAATTGGCCCAATATTGG + Intronic
1079088829 11:17466450-17466472 TCTATGAATTTGAGCACTCTAGG - Intronic
1080960093 11:37147904-37147926 TCTATGAATTTGCCTATTCTAGG + Intergenic
1081411925 11:42769494-42769516 TCTATGAATTTGACCACAATAGG + Intergenic
1081487130 11:43539673-43539695 TCTATGAATTTGCCTGTTCTAGG - Intergenic
1081687182 11:45051164-45051186 TCTATGAATTTGAACACTCTAGG + Intergenic
1081948770 11:47023658-47023680 TCTAGGAATTTGACTACTCTAGG + Intronic
1081996565 11:47368705-47368727 TCTATGAATTTGCCTATTCTAGG - Intronic
1082056654 11:47823397-47823419 TCTATAAATTTGACTACTCTAGG + Intronic
1082109925 11:48263214-48263236 TCTATGAATTTGACTATTCTAGG + Intergenic
1082728375 11:56764898-56764920 TCTATGAATATGACTACTCTAGG + Intergenic
1082822735 11:57555422-57555444 TCTATGAATTTGACTATTCTGGG - Intronic
1082956883 11:58879617-58879639 TCTAGGAATTTGCCTATTCTAGG - Intronic
1082963786 11:58944966-58944988 TCTAGGAATTTGCCTATTCTGGG - Intronic
1083142665 11:60734606-60734628 TTTATGAATTTGACCACCCTAGG - Intronic
1083206938 11:61156939-61156961 TCTACGAATTGGACTACTCTAGG + Intronic
1083410064 11:62486157-62486179 TGTATGAATTTGACTACTCTAGG - Intronic
1083802668 11:65055599-65055621 TCTATGAATTTGCCTATTCTAGG - Intronic
1083942499 11:65904159-65904181 GCTATGGATTTGCCCATTCTGGG + Intergenic
1084470167 11:69354839-69354861 TCTACAGACTTGCCAACTCTGGG - Intronic
1084540000 11:69780253-69780275 TCTACGAATTTGACTACTTAGGG + Intergenic
1084552091 11:69850525-69850547 TCTATAAATTTGACTACTCTGGG + Intergenic
1084570590 11:69957239-69957261 TCTATGGATTTGCCTATTCTGGG + Intergenic
1084676063 11:70635501-70635523 CCTATGAATTTGACCACTCTAGG - Intronic
1084685905 11:70695098-70695120 TCTATGAATTTGATGACTCTAGG - Intronic
1084691738 11:70731454-70731476 TCTACGGATTTGCTAATTCTGGG + Intronic
1084712080 11:70850047-70850069 TCTATGAATCTGACGACTCTAGG + Intronic
1084747000 11:71178366-71178388 TTTACGAATTTGGCTATTCTAGG - Intronic
1084753578 11:71220711-71220733 TCCATGGATTTCCCCACTCTAGG - Intronic
1085014123 11:73161345-73161367 TCTATGAATTTGCCTTTTCTAGG + Intergenic
1085164982 11:74390892-74390914 TCTATGAATTTGACTAATCTAGG - Intronic
1085362895 11:75908126-75908148 TCTATGATTTTGACTACTCTAGG + Intronic
1085499179 11:77002882-77002904 TCTATGAAGTTGACTACTCTAGG - Intronic
1085563902 11:77495826-77495848 TCTATGAATTTGACTGCTCTAGG - Intergenic
1085708347 11:78806900-78806922 TCTATGAATTTGACTACTCTAGG + Intronic
1085746427 11:79118603-79118625 TCCATGAATTTGACTACTCTAGG + Intronic
1087052662 11:93902106-93902128 TCTATGAATTTGACTACTCTAGG - Intergenic
1087233347 11:95691051-95691073 TCTAGGAGTTTGACTACTCTAGG - Intergenic
1087557495 11:99739986-99740008 CCTACTAATTTACCCACACTTGG + Intronic
1087629499 11:100634005-100634027 TCTGTGAATTTGCCTATTCTAGG + Intergenic
1087656429 11:100928817-100928839 TCTATTAATTTGCCTACTCTGGG + Intronic
1087785812 11:102352750-102352772 TCTATGAATTTGACTACTCTAGG + Intronic
1087952325 11:104238291-104238313 TCTATGAATTTGACTAATCTAGG + Intergenic
1088457501 11:110048512-110048534 TCTAGGAATTTGACTACTCTAGG - Intergenic
1088642527 11:111887165-111887187 TCTATGAATTTACCTATTCTAGG + Intergenic
1088677620 11:112211153-112211175 TCTATGAATTTGCCTATTTTAGG + Intronic
1089060326 11:115621046-115621068 TCTACGGCTTTGTCCATTCTAGG + Intergenic
1089070219 11:115693979-115694001 TCTCTGAATTTGACTACTCTTGG + Intergenic
1089277581 11:117348842-117348864 TCAATGAATTTGCCTATTCTAGG + Intronic
1089279450 11:117362864-117362886 TCTATGAATTTACCTATTCTAGG + Intronic
1089332209 11:117697641-117697663 TCTAGGAATTTGAGTACTCTAGG + Intronic
1089577662 11:119458109-119458131 TCTATGAATTTGACTACTCTAGG - Intergenic
1089850241 11:121489429-121489451 TCTATGCTTTTGCCTACTCTAGG + Intronic
1089904442 11:122023982-122024004 TCTGTGAATTTGACTACTCTAGG - Intergenic
1090030958 11:123205840-123205862 TCTATGAATTTGACTACTCTGGG - Intergenic
1090573179 11:128069829-128069851 TCTAAGAATTTGACTACTCTAGG + Intergenic
1090790192 11:130085773-130085795 TCTATGAATTTGCCTATTCTGGG + Intronic
1090940774 11:131386257-131386279 TCCATGAATTTGCCTACCCTAGG - Intronic
1090958166 11:131532273-131532295 TCTCTGAATTTGCCTATTCTAGG + Intronic
1091261306 11:134236750-134236772 TCTATGAATTTGACTGCTCTGGG - Intronic
1091405423 12:206284-206306 TCTATGCATTTGCCTATTCTAGG + Intronic
1091608659 12:1982424-1982446 TGTATGAATTTGACTACTCTAGG + Intronic
1091630086 12:2153518-2153540 TCTATGAATTTGACCACTCTGGG + Intronic
1091664335 12:2408180-2408202 TCTGTGAATTTGCCTAGTCTGGG - Intronic
1091919342 12:4291891-4291913 TCTACGAATTTGACTATTCCAGG - Intronic
1093944432 12:25091301-25091323 TCTATGAATTTGACAACTTTAGG + Intronic
1094059896 12:26302416-26302438 TCTATCAATTTGCCCACTTTAGG - Intergenic
1094106764 12:26820916-26820938 TCTATGAATTTGCCTATTCTAGG - Intronic
1094299839 12:28950719-28950741 TCTATGAATTTGACTTCTCTAGG + Intergenic
1094360895 12:29629607-29629629 TCTATGAATTTGCCTATTCTGGG - Intronic
1095614177 12:44168908-44168930 TCTAGGAATTTGACTACACTAGG + Intronic
1095725974 12:45453682-45453704 TCTATGATTTTGACTACTCTTGG - Intergenic
1095941859 12:47732679-47732701 TCTATGAATTTGGCAACTCAGGG - Intergenic
1096133671 12:49181660-49181682 TCTATGAATTTGACTATTCTAGG - Intergenic
1097287899 12:57891725-57891747 TCTGGGAATTTGGCTACTCTAGG + Intergenic
1097411697 12:59262370-59262392 TCTATGAATTTGAATACTCTAGG - Intergenic
1097609301 12:61798602-61798624 TCTATGAACTTGGCAACTCTTGG + Intronic
1097615300 12:61878088-61878110 TCAACGAATTTGACTATTCTAGG - Intronic
1097669149 12:62515408-62515430 TCTATGAATTTGACTACTCAAGG - Intronic
1097877473 12:64656930-64656952 TCTATGAATGTGGCTACTCTAGG - Intronic
1098066340 12:66621310-66621332 TCTATGAATTTGCCTATTCTAGG + Intronic
1098298285 12:69027087-69027109 TCTATGAATCTGCCTATTCTAGG - Intergenic
1098343917 12:69480329-69480351 TCTACAAATTTGACTATTCTAGG + Intronic
1098430446 12:70413827-70413849 TCTATGAATTTGCCTATTTTAGG - Intronic
1098517035 12:71389043-71389065 TTTATGAATTTGACTACTCTAGG + Intronic
1098889250 12:75992092-75992114 TCTAGGAATTTGACTACTGTAGG + Intergenic
1099215014 12:79842996-79843018 TCTATGAATTTGACTATTCTAGG + Intronic
1099714260 12:86270466-86270488 TCTATGAATTTGACTACTCTAGG + Intronic
1099847088 12:88041148-88041170 TCTATGAATTTGACTACTCTAGG + Intronic
1099964029 12:89426174-89426196 TCTAGGAATTTACCTATTCTAGG - Intronic
1100198670 12:92275489-92275511 TCTATGAATTTGCTTACTCCAGG - Intergenic
1100285189 12:93158483-93158505 TCTATGAATTTGACTACTCTAGG + Intergenic
1100365266 12:93914811-93914833 TCTAAGAATTGGACTACTCTAGG - Intergenic
1100400911 12:94228616-94228638 TCTATGAATTTGACTACTCTAGG + Intronic
1100621361 12:96277579-96277601 TCTGTGAATTTGCCCATTCTAGG - Intergenic
1100625691 12:96329084-96329106 TCTATGAATTTGCCTATTCTAGG - Intronic
1100672327 12:96829928-96829950 TCTACGAATTTGTCTATTCTAGG + Intronic
1100996790 12:100309432-100309454 TCTATGAATTTGACTACTCTAGG + Intronic
1101103219 12:101415677-101415699 TCTATGAATTTGCCTAATCTAGG + Intergenic
1101208900 12:102516541-102516563 TCTATGAATTTGACTACTCTAGG - Intergenic
1101210726 12:102533117-102533139 TCTATGAATTTGACTACTATAGG - Intergenic
1101380539 12:104210507-104210529 TTTGCGAATTTGACAACTCTGGG + Intergenic
1101458899 12:104868924-104868946 TCTTCGGATTTGCCTATTCTGGG - Intronic
1101511451 12:105396683-105396705 TCGAGGCATTTGCCCACTATGGG + Intergenic
1101513455 12:105413059-105413081 TCTATGAATTTAACCATTCTAGG + Intergenic
1101682495 12:106983359-106983381 TCTATGAATTTGCCTATTCTAGG + Intronic
1101760441 12:107653990-107654012 TCTATGAATTTGACTACTCAAGG + Intronic
1101922201 12:108942046-108942068 TCTATGAATTTGATTACTCTAGG + Intronic
1101927773 12:108987147-108987169 TCTATGAATTTGACTCCTCTAGG + Intronic
1101964392 12:109272492-109272514 TCTATGAATTTGACTACTCTAGG + Intergenic
1102669847 12:114608769-114608791 TCTACGAGTTTGATGACTCTAGG + Intergenic
1102796090 12:115689954-115689976 TCTATGAATTTTACTACTCTAGG - Intergenic
1102989630 12:117305576-117305598 TCTATTAATTTGCTCACCCTGGG + Intronic
1103057903 12:117836022-117836044 TCTAGAAACTTGCCCACTCTTGG + Intronic
1103297597 12:119901370-119901392 TCTATGAATTTGCCCATTTTAGG + Intergenic
1103424610 12:120822035-120822057 TCTATGAATTTGCCTAATCTAGG - Intronic
1103550157 12:121731010-121731032 TCTACGAATTTGACTACTCTAGG - Intronic
1103580455 12:121910972-121910994 TCTATGAATTTGACTACTCCAGG + Intronic
1103734137 12:123048319-123048341 TCTATGAATTTGACTACTTTAGG - Intronic
1103747502 12:123135564-123135586 TCTATGAATTTGACTACTCTAGG + Intronic
1103840253 12:123857911-123857933 TCTACAAATTTGACTACTCTAGG + Intronic
1103840365 12:123858866-123858888 TCTACGGATTTGCGTATTCTGGG - Intronic
1104009300 12:124917862-124917884 TCTCCAAATTTGCCTACTTTAGG + Intergenic
1104495910 12:129238529-129238551 TCTATAAATTTGCCTACTCTAGG + Intronic
1105341585 13:19531049-19531071 TCTATGAATTTGCCTATTCTAGG + Intronic
1105454946 13:20531799-20531821 TCTATGAATTTGACGACTCTAGG - Intergenic
1105731957 13:23226693-23226715 TCTATGAATTTGACTACTCTAGG - Intronic
1105774678 13:23646487-23646509 TCTATGAATTTGCCAATTCTAGG + Intronic
1105810114 13:23987809-23987831 TCTATGAATTTGGCTACTCTAGG + Intronic
1105820219 13:24074219-24074241 TCTATGAATTTGCCTACTCTAGG + Intronic
1105835222 13:24204650-24204672 TCTACAAATTTGACTTCTCTAGG + Intronic
1105905447 13:24805404-24805426 TCTATGAAATTGCCTATTCTAGG + Intronic
1105929451 13:25038845-25038867 TCTCTGAATTTGCCTACTCTAGG - Intergenic
1106034649 13:26032839-26032861 TCTATGAATTTGACTACTCTAGG - Intergenic
1106111218 13:26778922-26778944 TCTATGGATTTGACTACTCTAGG + Intergenic
1106139048 13:26995474-26995496 TCTATGAATCTGACTACTCTAGG + Intergenic
1106158496 13:27179572-27179594 TCTATGAATTTGACTACTCTAGG - Intergenic
1106200254 13:27530313-27530335 TCTATGAATTTGACTACTCTGGG + Intergenic
1106346475 13:28884343-28884365 TCTATGAATTTGCCTAATGTAGG - Intronic
1106355888 13:28982819-28982841 TCTATGAATTTCACCACCCTAGG - Intronic
1106382265 13:29251653-29251675 TCTATGAATTTGCCTACTCTAGG + Intronic
1106400619 13:29426578-29426600 TCTGTGAATTCGACCACTCTAGG + Intronic
1106439003 13:29748900-29748922 TCTATGAATTTACCTGCTCTTGG + Intergenic
1106520671 13:30494848-30494870 TCTATGAATTTGACTACTCTAGG + Intronic
1106772439 13:32974846-32974868 TCTATGAATTTGACTACTCTAGG + Intergenic
1106882414 13:34146017-34146039 TCTATGAATTTGGCTACTCTAGG + Intergenic
1107353685 13:39543064-39543086 TCTATGAATTTACCTATTCTAGG + Intronic
1107463925 13:40631701-40631723 TCTATGAATTTGACTACTTTAGG - Intronic
1107473824 13:40715706-40715728 TCTATGAATTTGCCTATTCTAGG + Intergenic
1107599381 13:41997644-41997666 TCTGTGAATTTGACTACTCTAGG + Intergenic
1107640461 13:42437953-42437975 TCTATGAATTTGACTACTCTAGG + Intergenic
1107747420 13:43525311-43525333 TCTATGAATGTGACTACTCTAGG + Intronic
1107820334 13:44280136-44280158 TCGATGAATTTGACTACTCTAGG + Intergenic
1107829351 13:44360575-44360597 TCTATGAATTTGCCTATTCTAGG - Intergenic
1108068062 13:46599039-46599061 TCTATGAATTTGACTACCCTAGG + Intronic
1108198448 13:48018557-48018579 TCTATGAATTTGCCTACTCTAGG + Intergenic
1108419093 13:50230456-50230478 TCTATGAATTTGACTACTCTAGG - Intronic
1108508302 13:51133259-51133281 TCTATGAATCTGACTACTCTAGG - Intergenic
1108568902 13:51730032-51730054 TCTATGAATTTGACTAGTCTAGG + Intronic
1108578453 13:51808874-51808896 CCTATGAATTTGACTACTCTAGG + Intergenic
1108639396 13:52368865-52368887 TCTATGAATTTGAGCACTCTAGG - Intergenic
1109483063 13:62982049-62982071 TCTATGAATTTGCCTATTCTAGG - Intergenic
1109751406 13:66698063-66698085 TCTATGAATTTGACAACCCTAGG - Intronic
1110284471 13:73733355-73733377 TCTATGAATTTGCCTACTTTAGG + Intronic
1110313573 13:74079173-74079195 TCTACGAATTTGACTGCTTTAGG - Intronic
1110568395 13:76979137-76979159 TCTAAGACTTTGTCTACTCTAGG - Intergenic
1110714435 13:78684914-78684936 TCCAGGAATTTGCTAACTCTGGG + Intergenic
1111809846 13:93086372-93086394 TCTATGAATTTAACTACTCTAGG - Intergenic
1111859824 13:93688708-93688730 TCTACGAATTTGCCCACTCTAGG - Intronic
1112003208 13:95231070-95231092 TCTATGAATTTGATGACTCTAGG - Intronic
1112313219 13:98338361-98338383 TTTATGAATTTGCCTGCTCTAGG + Intronic
1112321263 13:98409804-98409826 TCTATGAATTTGCCTACTCTAGG + Intronic
1112370542 13:98789193-98789215 TCTATGAATTTGCCTACTCTAGG + Intergenic
1112441868 13:99430173-99430195 TCTAAGAATTTGATGACTCTAGG + Intergenic
1112517828 13:100070777-100070799 ACTATGAATTTGGCTACTCTAGG - Intergenic
1112552293 13:100432836-100432858 TCTATGAATTTGACTACTGTGGG + Intronic
1112568565 13:100572336-100572358 TGTATGAATTTGACTACTCTAGG - Intronic
1112607232 13:100918933-100918955 TCTATGAATTTGACTATTCTAGG - Intergenic
1112702258 13:102023646-102023668 TCTATGAATTTGCCAATACTGGG + Intronic
1112710788 13:102126270-102126292 TCTATGAATTTCCCTATTCTAGG + Intronic
1112741116 13:102473573-102473595 TCTATGAATTTGACTACTTTAGG - Intergenic
1112830446 13:103443376-103443398 TCTATGATTCTGACCACTCTAGG + Intergenic
1112932413 13:104758476-104758498 TCTATGAATTTGACGTCTCTAGG - Intergenic
1113640677 13:111954765-111954787 TCTAGGAATGTGGCCACCCTGGG + Intergenic
1114660865 14:24343365-24343387 TCTATGAATTTGACTATTCTAGG - Intergenic
1115495426 14:33999616-33999638 TCTATAAATTTGCCCATTCTGGG - Intronic
1115668523 14:35582161-35582183 TCTATGAATTTGCCAGTTCTAGG - Intronic
1115823283 14:37235790-37235812 TCTATGAATCTGCCTATTCTAGG + Intronic
1116486446 14:45454594-45454616 TCTCTGAATTTGACTACTCTGGG + Intergenic
1116614527 14:47117685-47117707 TCTATGAATTTGACTACTTTAGG - Intronic
1116803962 14:49473167-49473189 TCTATGAATTTGACTACTGTAGG - Intergenic
1116857405 14:49965179-49965201 TCTGTGAATTTGCCTATTCTAGG - Intergenic
1116906594 14:50409640-50409662 TCTATGAATTTGACTACTATAGG + Intronic
1117427437 14:55615427-55615449 TTTATGAATTTGACTACTCTGGG + Intronic
1117702744 14:58430940-58430962 TCTATGAATTTGACTACCCTAGG + Intronic
1117758646 14:59003125-59003147 TCTATGAATTTGACTATTCTGGG - Intergenic
1118185753 14:63536810-63536832 TCTATGAATTTGACTACTCTAGG - Intronic
1118228518 14:63926279-63926301 TCTACGAATTTCCCTATTTTGGG + Intronic
1118601651 14:67474763-67474785 TCTATGAATTTGACTACTCTGGG + Intronic
1118772242 14:68949894-68949916 TCTATGAATTTGACTACTCTAGG - Intronic
1118794086 14:69124024-69124046 TCTATGGATTTGTCTACTCTAGG + Intronic
1118800053 14:69181398-69181420 TCTATGAATTTGTCTATTCTAGG + Intergenic
1119239498 14:73047148-73047170 TCTATGAATTTGCCTATTCTGGG - Intergenic
1119314901 14:73685317-73685339 TTTACGAATTTAACTACTCTAGG + Intronic
1119485395 14:74983646-74983668 TCTCCAAATTTGGCAACTCTAGG - Intergenic
1119561853 14:75596833-75596855 CCTATGAATTTGCCTATTCTAGG + Intronic
1119596311 14:75937570-75937592 TCTATGAATTTGACTACTCTAGG + Intronic
1119735818 14:76981114-76981136 TCTAGGAATTTATACACTCTGGG + Intergenic
1119902042 14:78269381-78269403 TCTATGAACTTGACCATTCTAGG - Intronic
1120752546 14:88211293-88211315 TCTATGAATTTCACCACTCCGGG - Intronic
1120868230 14:89313923-89313945 TCTACGAATTTGACTACTCTGGG - Intronic
1120918520 14:89731608-89731630 TCTATGAATTTGACTACTCTAGG + Intergenic
1121092469 14:91192284-91192306 CCTATGAGTTTGCCTACTCTAGG - Intronic
1121212328 14:92217127-92217149 TCTATGAATTTGACGGCTCTAGG - Intergenic
1121700494 14:95950276-95950298 TCTACAATTTTGACTACTCTAGG + Intergenic
1121800716 14:96771921-96771943 TCTATGAATTTGACTACTATTGG - Intergenic
1122017017 14:98804928-98804950 TCTATGAATCTGACTACTCTAGG - Intergenic
1122048046 14:99037360-99037382 TCTATGATTTTGACCACTTTGGG - Intergenic
1122158463 14:99765426-99765448 TCTATGAATTTGACTGCTCTAGG + Intronic
1122161647 14:99788865-99788887 TCTATGAATTTGACAACCCTAGG + Intronic
1122254309 14:100465409-100465431 TCTATGATTTTGACTACTCTGGG + Intronic
1122295374 14:100702650-100702672 TCTACGAGTTTGACTACTCTGGG + Intergenic
1122404876 14:101494472-101494494 TCTATGAATTTGACTATTCTAGG - Intergenic
1122449869 14:101797112-101797134 TCTATGATTTTGCCCACAGTAGG + Intronic
1122450837 14:101805841-101805863 TCTATGAACTTGTCTACTCTGGG - Intronic
1122485165 14:102074462-102074484 TCTCTGAATTTGCCTACTCTAGG + Intergenic
1122665001 14:103323219-103323241 TCTATGAATTTGCCTGCTCTGGG + Intergenic
1122679982 14:103452415-103452437 TCTATGAATTTGACTACTCTTGG + Intronic
1122703287 14:103604698-103604720 TCTATGAATTTGCCTGCTTTGGG + Intronic
1122777324 14:104126396-104126418 TCTATGAATTTGATGACTCTAGG + Intergenic
1123889907 15:24766644-24766666 TCTATGAATTTGACTACCCTAGG - Intergenic
1123982991 15:25620965-25620987 TCTAGGAATTTGAAGACTCTTGG - Intergenic
1124169041 15:27355899-27355921 TCTATGAATTTGTCTATTCTAGG - Intronic
1124188750 15:27552965-27552987 TCTATGAATTGGGCCACTCTAGG - Intergenic
1124594949 15:31084412-31084434 TCTATGGATTTGCCTATTCTGGG + Intronic
1124692134 15:31832649-31832671 TCTATGAATTTGACGACTCTAGG + Intronic
1125275579 15:37986653-37986675 TCTATGAATTTGACTACTTTAGG + Intergenic
1125312903 15:38399930-38399952 TCTGTGAATTTGACAACTCTAGG + Intergenic
1125456034 15:39859750-39859772 TCTACGAATTTGACTACTTTAGG - Intronic
1125735594 15:41923201-41923223 TCTATGAATTTGACTACTCTAGG + Intronic
1125771677 15:42171805-42171827 TCCATGAATCTGCCTACTCTAGG + Intronic
1125865355 15:43042466-43042488 TCTATGAATTTGACTACTCTAGG - Intronic
1125871798 15:43108918-43108940 TCTATGAATTTGACTACTCTAGG - Intronic
1125873735 15:43125539-43125561 TCTGTGAATTTGACTACTCTAGG + Intronic
1125917111 15:43497665-43497687 TTTCTGAATTTGCCTACTCTAGG - Intronic
1126427507 15:48545508-48545530 TCTATGAATTTGACTGCTCTGGG - Intronic
1126640032 15:50814936-50814958 TCTATGAATTTGACTACTTTAGG + Intergenic
1126646316 15:50878228-50878250 TCTATGAATTTGACTATTCTAGG - Intergenic
1127315050 15:57787225-57787247 TCTATGAATTTTACTACTCTAGG - Intergenic
1127331711 15:57946320-57946342 TCTATGAATTTGACTACTCTAGG + Intergenic
1127442556 15:59024875-59024897 TCTATGAATTTGACTACTCTGGG + Intronic
1127710304 15:61590820-61590842 ACTATGAATTTGACTACTCTAGG - Intergenic
1127929580 15:63583680-63583702 TCTATGAATTTGTCTATTCTAGG + Intronic
1128081359 15:64858973-64858995 TCTATGATTTTGACAACTCTAGG + Intronic
1128164708 15:65453805-65453827 TCTACAATATTGCCAACTCTGGG + Intronic
1128287349 15:66448228-66448250 TCTATGAGTTTGACTACTCTAGG + Intronic
1128643331 15:69356687-69356709 TCTAGGAATTTGACTACTCCAGG + Intronic
1128804440 15:70520086-70520108 TCTATGGATTTGCTCACTCTGGG + Intergenic
1128897549 15:71389331-71389353 TCTCTGAATTTGACTACTCTAGG + Intronic
1129042235 15:72698439-72698461 TCTATGAATTTGACTATTCTAGG + Intronic
1129432558 15:75510919-75510941 TCTATGAATTTGCCTATTTTAGG + Intronic
1129593297 15:76936985-76937007 TCTCTGAATTTGGCTACTCTAGG + Intronic
1129602147 15:77005691-77005713 TCTATGGATTTGCCTATTCTAGG + Intronic
1129765975 15:78167710-78167732 TCTATGAATTTGACTACTCTAGG + Exonic
1129947704 15:79555247-79555269 TCTGTGAATTTGACCAGTCTGGG + Intergenic
1129984964 15:79910961-79910983 TCTATGATTTTGACCACTCTAGG - Intronic
1130001258 15:80049071-80049093 TCTATGAATTTGATAACTCTAGG + Intergenic
1130084045 15:80762345-80762367 TCTATAAATTTGACCACTCTAGG + Intergenic
1130114763 15:80997153-80997175 TCTATGAATTTGACTACCCTAGG - Intergenic
1130164647 15:81441027-81441049 TCTATGAATTTGACTACTCTAGG - Intergenic
1130338862 15:82981790-82981812 TTTATGAATTTGACTACTCTAGG - Intronic
1130533380 15:84765120-84765142 TCTATGAATTTGCCTACTCTAGG + Intronic
1130584072 15:85166239-85166261 TCTATGAATTTGCCTTTTCTAGG - Intergenic
1130628961 15:85546026-85546048 TCTAAGAATTTGCCCATTCTAGG + Intronic
1130636531 15:85626454-85626476 TCTATGAATTTGACTGCTCTAGG + Intronic
1130932074 15:88436780-88436802 TCTAGAAATGTGCCAACTCTGGG - Intergenic
1131006779 15:88984923-88984945 TCTACAGATTTGCCTAGTCTGGG - Intergenic
1131065424 15:89432079-89432101 TCTGCGAATTTGCCTTTTCTAGG - Intergenic
1131123686 15:89839998-89840020 TCTCTGAATTTGACTACTCTGGG - Intronic
1131159717 15:90097608-90097630 TCTATGAATTTGACTATTCTAGG - Intronic
1131359071 15:91773285-91773307 TCTATGCATTTGGCGACTCTAGG - Intergenic
1131451320 15:92542610-92542632 TTTACGGATTTGCCTATTCTAGG - Intergenic
1131761848 15:95632161-95632183 TCTACGAATCTGACCACTCCAGG + Intergenic
1132007554 15:98243052-98243074 TCTATGAATTTGACTACTCCAGG - Intergenic
1132041793 15:98531143-98531165 TCTATGAATTTGCCTATTTTAGG - Intergenic
1132241152 15:100257956-100257978 TCTACGAATCTGACTACTGTAGG + Intronic
1132301370 15:100778127-100778149 TCTATGGATTTGCCTATTCTGGG + Intergenic
1132393316 15:101454562-101454584 TCTATGAATTTGGCCATTCCAGG - Intronic
1132476378 16:140717-140739 TCTATGGATTTGCCTATTCTGGG - Intergenic
1133160211 16:3906689-3906711 TCTATGAATTTGACTCCTCTAGG - Intergenic
1133330828 16:4972536-4972558 TCTGCAAATTTGACCATTCTAGG + Intronic
1134323613 16:13186769-13186791 TCTATGAATTTGACTACTCCAGG + Intronic
1134763636 16:16736373-16736395 TCTATGGATTTGCCCATTCTGGG + Intergenic
1134786197 16:16946064-16946086 TCTGTGAATTTGCCTATTCTGGG + Intergenic
1135055648 16:19229997-19230019 TCTATGAGTTTGACTACTCTAGG - Intronic
1135067766 16:19324979-19325001 TCTATGAATTTGCCTGCTTTGGG - Intergenic
1135068044 16:19327538-19327560 TCTATGAATTTGACTACTCTGGG + Intergenic
1135146177 16:19964722-19964744 TCTATGAATTTGACTACTCTAGG + Intergenic
1135199687 16:20426695-20426717 TCTATGAATTTGACTACTCTTGG - Intronic
1135219015 16:20596915-20596937 TCTATAAATTTGACTACTCTTGG + Intergenic
1135223398 16:20634633-20634655 TCTATGAATTTGCCTATTTTAGG - Intronic
1135337813 16:21618575-21618597 TCTATGAATTTGACTATTCTGGG + Intronic
1135346414 16:21692479-21692501 TCTATGAATTTGACTGCTCTAGG - Intronic
1135377585 16:21962125-21962147 TCTACAAATTTGACTACTCCAGG + Intronic
1135510524 16:23079005-23079027 TCTGTGAATTTGACTACTCTTGG - Intronic
1135606225 16:23827338-23827360 TCTATGAATTTGACTACTCCAGG - Intergenic
1135702843 16:24647922-24647944 TCTATGAGTTTGACTACTCTAGG + Intergenic
1135770585 16:25215166-25215188 TCTATGAATTTGACTAGTCTAGG + Intergenic
1136094097 16:27941887-27941909 TCTATGAATTTGACTACTTTGGG - Intronic
1136129220 16:28209122-28209144 TCTATGAATTTGACTACTTTAGG - Intronic
1136472349 16:30489597-30489619 TCTAGGAATTTGCCTACCCTGGG - Intronic
1137065676 16:35840467-35840489 TCGATGAATTTGCCTGCTCTGGG - Intergenic
1137255924 16:46775496-46775518 TCTATGAATTTGCCTATTCTAGG - Intronic
1137267148 16:46878389-46878411 TCTATGTATTTGCCTATTCTGGG + Intergenic
1137773590 16:51037752-51037774 TCTATGAATTTGGCTTCTCTAGG + Intergenic
1137779193 16:51083044-51083066 TCTATGAATTTGACTACTCTAGG - Intergenic
1137912725 16:52394653-52394675 TCTATGAATTTGATTACTCTAGG - Intergenic
1137996896 16:53226275-53226297 TATACAAAATTGCCAACTCTAGG + Intronic
1138144947 16:54600098-54600120 TCTATGAATTTGTCTATTCTAGG + Intergenic
1138213837 16:55185750-55185772 TCTATGAATTTGGCTACCCTAGG - Intergenic
1138407046 16:56804494-56804516 TCTGTGAATTTGACTACTCTAGG - Intronic
1138618385 16:58191159-58191181 TCTATGAATTTGACTACTCCAGG - Intronic
1138625191 16:58246204-58246226 TCTATGAATTTGACTACTCTAGG - Intronic
1138628910 16:58277863-58277885 TCTATGAATTTGACTACTCTGGG - Intronic
1138636530 16:58343383-58343405 TCTGTGAATTTGACTACTCTAGG + Intronic
1138698913 16:58842368-58842390 TCTATGAGTTTGACAACTCTAGG + Intergenic
1139142032 16:64277199-64277221 TCTAGGAATTTGACTACTCTAGG + Intergenic
1139142317 16:64281465-64281487 TCTTTGAATTTGACTACTCTAGG + Intergenic
1139993317 16:70957190-70957212 TCTATGAATTTGACCAGTCTGGG + Intronic
1140184601 16:72756235-72756257 TCTATGCATTTGACTACTCTAGG + Intergenic
1140323819 16:73980723-73980745 TCTACGAATTTGCCTGTTCTAGG - Intergenic
1140390357 16:74581429-74581451 TCTGTGAATTTGACTACTCTAGG - Intronic
1140418142 16:74792287-74792309 TCTATGAATTTGCATATTCTAGG + Intergenic
1140862797 16:79033765-79033787 TCTATGAATTCGACTACTCTTGG + Intronic
1141162645 16:81639454-81639476 TCTAAGAATTTGTCTACTCTAGG + Intronic
1141403901 16:83774723-83774745 TCTATGAATCTGACGACTCTGGG - Intronic
1141729931 16:85815241-85815263 TCTACGAATTTGACTAGTCTAGG + Intergenic
1141732412 16:85831530-85831552 GCTACGATTTTGACTACTCTAGG + Intergenic
1141862088 16:86724519-86724541 TCTATGATTCTGCCTACTCTAGG - Intergenic
1142475869 17:189528-189550 TCTACGAATTTGCCTATTCTAGG - Intergenic
1142543124 17:677392-677414 TCTATGAATTTGCCTATTCTGGG - Intronic
1142598810 17:1042979-1043001 TGTACGAATTTGTCCAGTCTGGG - Intronic
1142793414 17:2287836-2287858 ACTATGAATTTGGCTACTCTAGG - Intronic
1142820448 17:2462265-2462287 TCTATGAACTTGACTACTCTAGG - Intronic
1142878876 17:2869244-2869266 CCTAGGAATTTGCCTATTCTAGG - Intronic
1142985686 17:3694281-3694303 TCTATGGATTTGCCTATTCTGGG - Intronic
1143068558 17:4269503-4269525 TCGACGAATCTGCCCGCTTTGGG - Exonic
1143278899 17:5735488-5735510 TCTATCAATTTGACCACTCTAGG - Intergenic
1143381802 17:6501342-6501364 TCTAGGAATTAGCCAGCTCTGGG - Intronic
1143671985 17:8403280-8403302 TCTACGATTTTGACTGCTCTAGG - Intergenic
1143715500 17:8765304-8765326 TCTATGAATTTGATTACTCTAGG + Intergenic
1143726654 17:8852060-8852082 TCTGTGAATTTGCCTATTCTAGG - Intronic
1143852522 17:9823388-9823410 TCTATGAATTTGACTACTCTAGG + Intronic
1143910128 17:10241589-10241611 TCTATGAATTTGCCTACTCTAGG + Intergenic
1143930326 17:10416156-10416178 TCTGTGAATTTGACTACTCTAGG + Intronic
1143931043 17:10425392-10425414 TCTATGGATTTGCCTATTCTGGG - Intergenic
1143991152 17:10963394-10963416 CCTATGAATTTGACCACTCTAGG - Intergenic
1144009088 17:11128294-11128316 TCTATGAATTTGACTACTCTAGG - Intergenic
1144202453 17:12953786-12953808 TCTATGAGTTTGACCACTCCAGG - Intronic
1144337423 17:14284114-14284136 TCTAGGAATCTGACTACTCTGGG - Intergenic
1144371477 17:14595721-14595743 TCTACAACTTTGGCCACACTTGG + Intergenic
1144392438 17:14807116-14807138 TCTATGAATTTGGCCACTCTAGG - Intergenic
1144511035 17:15876954-15876976 ACTATGAATTTGACTACTCTAGG + Intergenic
1144511569 17:15881629-15881651 TCTCTGAATTTACCCATTCTGGG + Intergenic
1144549687 17:16228851-16228873 TCTATGAATTTGTCTATTCTAGG + Intronic
1144566248 17:16362039-16362061 TCTACTGATTTGACTACTCTAGG - Intergenic
1144696715 17:17308802-17308824 TTTAGGAATTTGCCTATTCTGGG + Intronic
1144805309 17:17962187-17962209 ACTATGAATTTGACTACTCTAGG - Intronic
1145094425 17:20012893-20012915 TCTATGAATTTGCCTATTTTAGG + Intronic
1145175193 17:20694641-20694663 ACTATGAATTTGACTACTCTAGG + Intergenic
1145304367 17:21665061-21665083 TCTATGGATTTGACTACTCTAGG + Intergenic
1146023109 17:29295514-29295536 TCTACGAACTTGACTATTCTAGG + Intergenic
1146149740 17:30457179-30457201 TCTATGAATTTGCCTATTCTAGG + Intronic
1146606401 17:34261837-34261859 TCTATGAATTTGACTACTTTAGG + Intergenic
1146927743 17:36756622-36756644 TCTCTGAATTTGCCTATTCTGGG + Intergenic
1147222930 17:38950223-38950245 TCTATGAATTTGCCCGTTCTAGG + Intronic
1147475203 17:40704789-40704811 TCTGTGAATTTGACTACTCTAGG - Intergenic
1148035012 17:44653739-44653761 TCTATGAATTTGACTACTCTAGG - Intergenic
1148514762 17:48206204-48206226 TCAAGGCATTTGCCAACTCTAGG + Intronic
1148709566 17:49668026-49668048 TCTAGGAATTTCACTACTCTAGG - Intronic
1148829620 17:50422807-50422829 TCTAAGAATTTGACTACTCTAGG + Intergenic
1149017556 17:51925877-51925899 TCTATGAATTTGCCTGCTCTAGG - Intronic
1149232090 17:54546171-54546193 TCTATGAGTTTGTCTACTCTAGG - Intergenic
1149398781 17:56272354-56272376 TCTATGAATTTGACTACTCTAGG + Intronic
1149428791 17:56580057-56580079 TCTATGAATGTGACCACTCTAGG + Intergenic
1149510382 17:57236389-57236411 TGTAGGAATTTGACTACTCTGGG + Intergenic
1149663502 17:58349820-58349842 TCTATGAATTTGGCCACCTTAGG - Intronic
1149748955 17:59127047-59127069 TCTATCAATTTGACTACTCTAGG - Intronic
1149786077 17:59436201-59436223 TCTATGAACTTGACTACTCTAGG + Intergenic
1149801480 17:59571894-59571916 TCTACAAATTTGCCTACTCCGGG + Intronic
1150032218 17:61751269-61751291 TCTAAGAATTTGTCTATTCTAGG - Intronic
1150110296 17:62493175-62493197 TCTGTGAATTTGACTACTCTAGG + Intronic
1150447230 17:65236003-65236025 TCTGTGAATTTGACTACTCTAGG - Intergenic
1150474226 17:65462153-65462175 TCTATGAATTTGGCTACTCTGGG + Intergenic
1150513757 17:65785033-65785055 TCTAGGGATTTTTCCACTCTGGG + Intronic
1150536206 17:66044652-66044674 CTTACGAATTTGACCATTCTAGG - Intronic
1150694561 17:67393373-67393395 TCTGTGAATTTGACTACTCTAGG + Intronic
1150701497 17:67450908-67450930 TCTATGAATTGGCCTATTCTAGG + Intronic
1150744756 17:67807432-67807454 TTTATGAATTTGACCACTCTAGG + Intergenic
1151080782 17:71325976-71325998 TCTATGAATTTGACTACTCTAGG + Intergenic
1151217289 17:72585949-72585971 TCTATGAATTTGGCTACTCTGGG - Intergenic
1151775744 17:76200504-76200526 TCTATGAGTTTGACTACTCTAGG - Intronic
1151863666 17:76785256-76785278 TCCATGAATTTGTCTACTCTAGG - Intergenic
1151949799 17:77345104-77345126 TCTCTGAATTTGACTACTCTAGG - Intronic
1152154612 17:78624708-78624730 TCTACAGATTTGCCTATTCTGGG - Intergenic
1152156358 17:78636042-78636064 TCTACGAATTTGACTCCTCTAGG - Intergenic
1152302287 17:79502296-79502318 TCTATGAATTTGGCTATTCTAGG - Intronic
1152364302 17:79846161-79846183 TCTATGAATTTGACTACTCTGGG + Intergenic
1152863028 17:82706734-82706756 TCTACAGATTTGACAACTCTAGG + Intergenic
1152971123 18:162002-162024 TGTATGAATTTGACCACTTTAGG + Intronic
1153012500 18:551804-551826 TCTATGAAGTTGACTACTCTAGG - Intergenic
1153023205 18:650569-650591 TCTATGAATTTGACTACTCTAGG + Intronic
1153182562 18:2451701-2451723 TCTATGAATTTGATGACTCTAGG - Intergenic
1153319805 18:3761291-3761313 TCTATGAATTTGGTCACTCTAGG + Intronic
1153358694 18:4168601-4168623 TCTATTAATTTGTCTACTCTAGG + Intronic
1153616491 18:6939764-6939786 TCTACACATTTGACCACTCTGGG - Intergenic
1153630392 18:7063796-7063818 TCTATGAATTTGATTACTCTGGG - Intronic
1153640406 18:7152003-7152025 TGTAGGAATCTGACCACTCTAGG - Intergenic
1153709397 18:7782639-7782661 TCTATGAATTTGGCCACTCTAGG + Intronic
1153734013 18:8045605-8045627 TCTACAGATTTTCCTACTCTGGG - Intronic
1153744594 18:8164636-8164658 TCTATGAATTTGACTACTCTAGG - Intronic
1153812136 18:8761541-8761563 TCTATGAATTTGTCTATTCTGGG + Intronic
1153883461 18:9440683-9440705 TCTACAAATTTGACTACTGTAGG - Intergenic
1153885963 18:9466657-9466679 TCTATGAATTTGACTTCTCTAGG + Intergenic
1154001328 18:10484625-10484647 TCTATGAATTTGATCACTCTAGG + Intronic
1154192054 18:12238069-12238091 TCTTTGAATTGGACCACTCTGGG - Intergenic
1154192228 18:12239799-12239821 TCTATGAATTTGACTACTCTAGG + Intergenic
1154282710 18:13020281-13020303 TCTATGAATTTGCCCACTCTGGG + Intronic
1154319909 18:13339987-13340009 TCTATGAATTTGATTACTCTAGG + Intronic
1154391806 18:13943495-13943517 TCTCTGAATTTGACCATTCTGGG - Intergenic
1155025704 18:21938694-21938716 TCTATGAATTTGCCTATTTTAGG - Intergenic
1155067660 18:22281725-22281747 TCTATGAATTTGACTTCTCTAGG - Intergenic
1155096922 18:22565066-22565088 TTTACGAATTTGACCACTGTAGG + Intergenic
1155140941 18:23043970-23043992 TCTATGAATTTGCCTGTTCTAGG - Intergenic
1155189571 18:23417459-23417481 TCTATGAATTTGCCTATTCTGGG - Intronic
1155314335 18:24556676-24556698 TCTATGAATTTGATTACTCTAGG - Intergenic
1155383915 18:25256198-25256220 TCTATGAATTTGACTACTCTAGG - Intronic
1155579834 18:27290965-27290987 TCTATGAATTTGACTATTCTAGG - Intergenic
1155683048 18:28513409-28513431 TCTCTGAATTTTGCCACTCTTGG - Intergenic
1155836181 18:30587650-30587672 TCTATGAATTTGACTATTCTAGG + Intergenic
1156256821 18:35406269-35406291 TCTATGAATTTGACTACTCTAGG - Intergenic
1156636316 18:39034243-39034265 TCTATGAATTTGTCTACTTTAGG - Intergenic
1156717819 18:40032824-40032846 TCTACCAATTTACACACTGTTGG - Intergenic
1157047179 18:44115982-44116004 TCTATGAATTTGGCTATTCTAGG - Intergenic
1157162583 18:45327584-45327606 TCTATGAATTTGACTACTCTAGG + Intronic
1157337358 18:46751179-46751201 TTTATGAATTTGACAACTCTAGG + Intronic
1157556235 18:48614656-48614678 TCTATGAATTTGCCTATTCCAGG - Intronic
1157593499 18:48850066-48850088 TGTATGAATTTGACTACTCTAGG + Intronic
1157658210 18:49414106-49414128 TCTATGAATTTGACTACTCTGGG - Intronic
1157704861 18:49797167-49797189 TCTATGAATTTGACTACGCTAGG + Intronic
1157730344 18:49998801-49998823 TCTCTGAATTTGCCTATTCTAGG - Intronic
1157822832 18:50786357-50786379 TTTATGAATTTGACTACTCTAGG + Intergenic
1157886076 18:51368014-51368036 TCTATGAATTTGACTATTCTAGG + Intergenic
1157886540 18:51372580-51372602 TCTATGAACTTGACCACTTTAGG + Intergenic
1157892521 18:51431542-51431564 TCTATGAATTTGCCTATTTTAGG + Intergenic
1158280941 18:55825532-55825554 TCTATGAATTTGACTACCCTAGG + Intergenic
1158577310 18:58649554-58649576 TCTATAAATTTGACTACTCTAGG - Intergenic
1158651177 18:59287674-59287696 TCTATGAATTTGATTACTCTAGG - Intronic
1158764200 18:60428884-60428906 TCTATAAATTTGACTACTCTAGG - Intergenic
1158826821 18:61230560-61230582 TCTATAAATTTGACTACTCTGGG - Intergenic
1158895223 18:61906333-61906355 TCTATGAATTTGACTTCTCTGGG + Intergenic
1158911675 18:62069632-62069654 TCTATGAATTTGATGACTCTGGG - Intronic
1158917529 18:62150614-62150636 TCTATGCATTTGACTACTCTAGG - Intronic
1159036328 18:63281111-63281133 TCTATGAACTTGACTACTCTAGG - Intronic
1159230085 18:65595427-65595449 TCTATGAATTTGTCTATTCTAGG + Intergenic
1159530546 18:69650390-69650412 TCTAGGGCTTTGCTCACTCTTGG - Intronic
1159580687 18:70231620-70231642 TCTTGGAAATTGCCCAGTCTTGG + Intergenic
1159934537 18:74352184-74352206 TCTATGAATTTGCCCATTCTAGG - Intronic
1159949198 18:74467782-74467804 TCTATGAATTTGACAATTCTAGG + Intergenic
1160033959 18:75284597-75284619 TCTATGAATGTGGCAACTCTAGG + Intronic
1160470103 18:79124139-79124161 TCTATGAGTTTGCCTATTCTGGG - Intronic
1161276183 19:3419011-3419033 TCTATGAATCTGACGACTCTAGG - Intronic
1161472291 19:4464439-4464461 TCTATGAATTTGACAACCCTAGG + Intergenic
1161641899 19:5429191-5429213 TCCAGGAATTTGCCTCCTCTAGG - Intergenic
1161753443 19:6114209-6114231 TCTAAGAATTTGCCACCTGTTGG - Intronic
1161928354 19:7318213-7318235 TCTATGAATCTGACAACTCTAGG + Intergenic
1161942128 19:7411808-7411830 TCTATGAATCTGACAACTCTAGG + Intronic
1162505614 19:11082729-11082751 TGTATGAATTTGCCTATTCTAGG + Intergenic
1162601187 19:11671032-11671054 TCTATGAATTTGGCTATTCTAGG + Intergenic
1162669372 19:12241982-12242004 TCTATGAATTTGCTGATTCTAGG - Intronic
1162773036 19:12961463-12961485 TCTATGAATTTGACTACTCTAGG + Intergenic
1162863013 19:13522189-13522211 CCTATGAATTTAACCACTCTAGG + Intronic
1162866642 19:13552925-13552947 TCTATGAATTTGACTACTCTAGG + Intronic
1163119258 19:15206787-15206809 TCTATGAATTTATCCATTCTGGG + Intergenic
1163171361 19:15533457-15533479 TCTATGTATTTGCCTATTCTGGG + Intronic
1163370518 19:16898651-16898673 TCTACGGATTTGCCTGTTCTGGG + Intronic
1163507143 19:17714576-17714598 CCTAAGGATTTGCCCACTCTAGG - Intergenic
1163537565 19:17885787-17885809 TCTATGAATTTGCCTGTTCTGGG + Intronic
1163620019 19:18353691-18353713 TCTATGGATTTGCCTGCTCTGGG + Intronic
1163759541 19:19128062-19128084 TCTGTGAATGTGACCACTCTGGG - Intronic
1164403173 19:27917199-27917221 TCTATGAATTTGCCCATTCTAGG - Intergenic
1164701799 19:30290076-30290098 TCTGTGAATTTGACTACTCTAGG + Intronic
1164976765 19:32579590-32579612 TCTATGAATTTGCCTATTCTGGG - Intergenic
1165007244 19:32817323-32817345 TCTACGAATCTGCCAATCCTGGG + Intronic
1165220523 19:34312495-34312517 TCTATAAATTTGACTACTCTAGG + Intronic
1165250907 19:34533290-34533312 TCTATGAATTTGCCTATTCTAGG + Intergenic
1165286099 19:34843358-34843380 TCTATGAATTTGCCTATTCCAGG + Intergenic
1165299025 19:34955966-34955988 TGTATGAATTTGACCACTCTAGG - Intergenic
1165500961 19:36188964-36188986 TGTATGAATTTGCCTATTCTAGG - Intronic
1165864584 19:38928848-38928870 TCTATGAATTTGATTACTCTAGG + Intronic
1165897168 19:39149431-39149453 TCTTTGTATTTGCCTACTCTAGG - Intronic
1166471984 19:43085798-43085820 TCTATGAATTTGCCTATTCTTGG + Intronic
1167539935 19:50079325-50079347 CCTATGAATTTGACTACTCTAGG + Intergenic
1167629767 19:50618443-50618465 CCTATGAATTTGACTACTCTAGG - Intergenic
1167707223 19:51088551-51088573 TCTATGAATTTGACTACTCTAGG + Intergenic
1167758945 19:51431404-51431426 TCCATGAATTTGCCAATTCTAGG + Intergenic
1168090347 19:54078936-54078958 TCTATGAATTTGCTTATTCTAGG - Intronic
1168234994 19:55057176-55057198 TCTATGGATTTGCCTATTCTGGG - Intronic
1168408675 19:56124689-56124711 TCTATGAATTTGACTTCTCTAGG - Intergenic
1168462116 19:56567877-56567899 TCTAGGACTTTGCCCACACTGGG - Exonic
1168505412 19:56929851-56929873 TTTATGAATTTGACTACTCTAGG - Intergenic
1168505968 19:56935355-56935377 TCTATGAATTTGACTACTTTTGG + Intergenic
1202694005 1_KI270712v1_random:111640-111662 TATTTGAATTTGCCCATTCTGGG - Intergenic
926015200 2:9445205-9445227 TCTATGAATTTGACTATTCTAGG + Intronic
926033778 2:9617413-9617435 TCTATGAATTTGACTACTCTAGG - Intronic
926109978 2:10175912-10175934 CCTATGAATTTGACCATTCTAGG + Intronic
926216123 2:10906514-10906536 TCTATGAATGTGCCTATTCTAGG - Intergenic
926354760 2:12031445-12031467 TCTATGAATTTGGCGGCTCTAGG + Intergenic
926633723 2:15159560-15159582 TCTATGAATTGGACTACTCTAGG - Intergenic
926712601 2:15893721-15893743 TCTATGAATTTGCCTCCTCTAGG - Intergenic
926713437 2:15902838-15902860 TCTATGAATTTGACTATTCTAGG - Intergenic
927116387 2:19906756-19906778 TCTATGAATTTGACTACTCTGGG - Intergenic
927144340 2:20151879-20151901 TCTACGAATTTGACTATTCCAGG + Intergenic
927687376 2:25180809-25180831 TCTATGGATTTGCCTATTCTGGG - Intergenic
927750826 2:25669061-25669083 TCTATGAATTCGACTACTCTAGG - Intronic
927767489 2:25825490-25825512 TCTATGAATCTGACTACTCTAGG + Intronic
928017861 2:27675288-27675310 TCTATGAATTTGACTACTTTAGG + Intronic
928178079 2:29048544-29048566 TCTACGATTTTGGCTATTCTAGG + Intronic
928232108 2:29507313-29507335 TATATGAATTTGACTACTCTAGG - Intronic
928248025 2:29648556-29648578 TCTGTGAATTTGACTACTCTAGG + Intronic
928887444 2:36165941-36165963 TCTATGAATTTGTCTACTGTAGG - Intergenic
929473851 2:42224957-42224979 TCAATGAATTTGCCTATTCTAGG + Intronic
929715888 2:44309260-44309282 TCTATAAATTTGCCTATTCTAGG + Intronic
929747681 2:44675874-44675896 TTTGTGAATTTGACCACTCTGGG + Intronic
929761614 2:44811663-44811685 TCTATAAATTTGCCTATTCTAGG + Intergenic
929906817 2:46053552-46053574 TCTATGAATTTGACCATTCTAGG + Intronic
930138800 2:47930875-47930897 TCTAAGAATTTGACTGCTCTAGG - Intergenic
930213559 2:48669230-48669252 TCTATGAATTTGCCTATTCTAGG + Intronic
930256256 2:49096394-49096416 TCTATATATTTGCCCATTCTGGG - Intronic
930644205 2:53886941-53886963 TCTCTGAATTTGCCCATTCTAGG - Intronic
930748137 2:54905735-54905757 TCTATGAATGTAACCACTCTAGG + Intronic
930996037 2:57719666-57719688 TCTATGAATTTGACTACTTTAGG - Intergenic
931239026 2:60436082-60436104 TCTATGAATTTACCCAGTATAGG + Intergenic
931260949 2:60618660-60618682 TCTGTGAATTTGCCTATTCTAGG + Intergenic
932164119 2:69490599-69490621 TCTATGAATTTTACTACTCTAGG - Intronic
932204921 2:69871306-69871328 CCTATGAATTTGTCTACTCTAGG - Intronic
932643462 2:73476097-73476119 TCTATGAATTTGGCTACTCTAGG + Intronic
932883002 2:75521610-75521632 TCTATGAATATGACCACTGTTGG - Intronic
933046707 2:77547093-77547115 TCTACGAATTTGACTATTCTAGG - Intronic
933737839 2:85509594-85509616 TCTATGAATTTGACTACACTAGG - Intergenic
933809517 2:86024298-86024320 TCTACGAATTTGACTTCTCTAGG - Exonic
933952557 2:87342935-87342957 TATTTGAATTTGCCCATTCTGGG + Intergenic
934049628 2:88199471-88199493 TCTATGAATTTGACTACTCTAGG - Intergenic
934515586 2:94984480-94984502 TCTATGGATTTGCCCACTCTAGG - Intergenic
934777039 2:96946045-96946067 TCTATGAATTTGACTACCCTGGG + Intronic
935133623 2:100279625-100279647 TCTAAGAATTGGCTCACCCTGGG - Exonic
935192596 2:100790933-100790955 TATATGAATTTGACAACTCTAGG + Intergenic
935277677 2:101489551-101489573 TCTATGAATTTGACTACTCTAGG + Intergenic
935335420 2:102010941-102010963 TCTATGATTTTGACGACTCTAGG + Intronic
935398871 2:102639753-102639775 TCTATGAATTTGTCCATTCTAGG + Intronic
935570142 2:104651186-104651208 TCTACGAATCTGACTACTCTAGG - Intergenic
935595631 2:104875042-104875064 TCTAGGAATCTGACTACTCTAGG + Intergenic
935641162 2:105291709-105291731 TCTATGAATTTGACTACTCTAGG - Intronic
935661930 2:105474190-105474212 TGTAAGAATTTCCCCACTCTAGG + Intergenic
935683466 2:105659926-105659948 TCTGTGAATTTGACTACTCTGGG - Intergenic
935711950 2:105907012-105907034 TCTACGAATTTGACTATTCTAGG + Intergenic
935901307 2:107796645-107796667 TCTATGAATCTGACTACTCTAGG + Intergenic
935973651 2:108556147-108556169 TCTATGAATTTGCCTACTCTAGG + Intronic
936024323 2:109019814-109019836 TGAAAGGATTTGCCCACTCTGGG + Intergenic
936107938 2:109641531-109641553 TCTATGAATTTGACTACTGTAGG - Intergenic
936264281 2:110989554-110989576 TCTACGAATTTGACTACTCTAGG - Intronic
936395858 2:112129100-112129122 TTTATGAATTTGCCTATTCTGGG - Intergenic
936415345 2:112303590-112303612 TCTATGGATTTGCCTATTCTAGG + Intronic
936897040 2:117439421-117439443 TCTATGAATTTGACTATTCTAGG - Intergenic
937142735 2:119616002-119616024 TCTACGGATTTGCCTTTTCTGGG + Intronic
937299096 2:120827818-120827840 TCTACGATTCTGACGACTCTAGG - Intronic
937413809 2:121698611-121698633 ACTACAAATTTGACTACTCTAGG - Intergenic
937424137 2:121783866-121783888 ACTACAAATTTGACTACTCTAGG - Intergenic
937669049 2:124519122-124519144 TCTATGGATTTGCCTATTCTGGG - Intronic
937824439 2:126351542-126351564 TCTATGAATTTGAGTACTCTAGG - Intergenic
937892862 2:126952720-126952742 TCTTCCAATTTTCACACTCTGGG + Intergenic
937893364 2:126957378-126957400 TCTATGAATTTGCCTATTCTAGG - Intergenic
937895260 2:126972879-126972901 TGTATGAATTTGCCTATTCTGGG + Intergenic
937937613 2:127258748-127258770 TCTACAAATATGCCTGCTCTAGG - Intronic
938054897 2:128207632-128207654 TATATGAATTTGCCTATTCTGGG + Intergenic
938184642 2:129219011-129219033 TCTACAATTGTGACCACTCTAGG - Intergenic
938254935 2:129849995-129850017 TCAACACCTTTGCCCACTCTTGG - Intergenic
938321050 2:130364266-130364288 CCTATGAATTTGCCTATTCTAGG + Intronic
938368310 2:130753303-130753325 TCTCTGATTTTGACCACTCTAGG - Intergenic
938480067 2:131654769-131654791 ACTATGAATTTGCCTATTCTGGG + Intergenic
938760009 2:134416338-134416360 TCTGTGAATTTGCCTATTCTAGG + Intronic
938859004 2:135346990-135347012 TCTATGAATTTGCCTATTCTGGG + Intronic
938925744 2:136040322-136040344 TCTATAGATTTGCCTACTCTAGG - Intergenic
938974822 2:136466252-136466274 TCTATGAATTTGCCTACTATAGG - Intergenic
939998612 2:148944353-148944375 TCTATGAATTTGACTGCTCTAGG + Intronic
940137178 2:150451056-150451078 TCTATGAATTTTCCTATTCTAGG + Intergenic
940212732 2:151272873-151272895 TCTATGAATTTGCCTATTCTAGG - Intronic
940803957 2:158164410-158164432 TCTATGAATTTGTCTATTCTAGG - Intergenic
940839469 2:158562429-158562451 TCTATGAATTCGACTACTCTAGG - Intronic
940920618 2:159302178-159302200 TCTATGAATTTGACTACTCTAGG - Intergenic
940941219 2:159563610-159563632 TCTATGAATTTGACTATTCTGGG - Intronic
940963570 2:159812895-159812917 TCTATGAATTTGACAACTCTGGG + Intronic
941097396 2:161254628-161254650 TCTATGAATCTGACTACTCTAGG - Intergenic
941359006 2:164529197-164529219 TCTATGAATTTGACTATTCTAGG - Intronic
941429850 2:165400910-165400932 TCTATTGATTTGCCCATTCTGGG - Intergenic
941687849 2:168465671-168465693 TCTATGAATCTGACTACTCTAGG - Intronic
941728911 2:168894011-168894033 TCTATGAATCTGACTACTCTAGG + Intronic
941955830 2:171203395-171203417 TGTATGAATTTGACTACTCTAGG + Intronic
942728603 2:179038304-179038326 TCTATGAATTTGTCTATTCTAGG - Intronic
943021230 2:182576267-182576289 TCTATGAATTTGACTACTGTAGG + Intergenic
943445076 2:187974629-187974651 CCAATGAATTTGCCCACTGTAGG + Intergenic
943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG + Intergenic
943715466 2:191147447-191147469 TCTGTGAATTTGACTACTCTAGG - Intronic
943787346 2:191892638-191892660 TCTATGAATTTGACTACTCTAGG + Intergenic
943804631 2:192108976-192108998 TCTATGAATTTACCTATTCTAGG - Intronic
943984314 2:194600146-194600168 TCTATCAATTTGCCTATTCTGGG + Intergenic
944103073 2:196050281-196050303 TCTATGTATTTGACTACTCTAGG - Intronic
944135594 2:196396156-196396178 TCTATGAATTTGATTACTCTAGG - Intronic
944155842 2:196606750-196606772 TCTATAAATTTGGCTACTCTAGG - Intergenic
944185269 2:196941057-196941079 TCTATGAATATGACTACTCTAGG - Intergenic
944216140 2:197257938-197257960 TCTCTGAATTTGACTACTCTAGG + Intronic
944356803 2:198799717-198799739 TCTACAAATTTTCCTATTCTAGG + Intergenic
944839690 2:203613118-203613140 TCTAAGAATTTGACTATTCTAGG - Intergenic
945157496 2:206855068-206855090 TCTATGAATTTGACTACTCTGGG - Intergenic
945255913 2:207802944-207802966 TCTGTGAATTTGACTACTCTAGG + Intergenic
945459916 2:210093999-210094021 TATATGAATTTGACTACTCTAGG - Intronic
945852042 2:215020472-215020494 GCTATGAATTTGACAACTCTAGG - Intronic
945944467 2:215981445-215981467 TCTATGAATTTGGCTACTTTAGG - Intronic
946176591 2:217925840-217925862 TTTATGAATTTGCCTATTCTAGG + Intronic
946459061 2:219852820-219852842 TCCATGAGTTTGACCACTCTAGG + Intergenic
946471058 2:219961397-219961419 TTTATGAATTTGACTACTCTAGG + Intergenic
946713638 2:222531461-222531483 TCTATGAATTTGATTACTCTAGG - Intronic
946902761 2:224388509-224388531 TCTATGAGTTTGCCTATTCTTGG - Intronic
947161156 2:227216016-227216038 TCTATGAATTTGACTACTGTAGG - Intronic
947491689 2:230601232-230601254 TCTATGAATTTGCTTATTCTAGG - Intergenic
947497908 2:230652030-230652052 TCTATGACTTTGACTACTCTAGG + Intergenic
947539457 2:230965044-230965066 TCTGTGAATTTGACTACTCTAGG - Intergenic
947726333 2:232403097-232403119 TCTATGAATTTGACTCCTCTAGG + Intergenic
948170303 2:235896152-235896174 TCTATGAATTTGTCTGCTCTAGG + Intronic
948306219 2:236948828-236948850 TCTATGAATTTGACTACTCTAGG - Intergenic
948493301 2:238327787-238327809 TCTATGAATCTGACTACTCTAGG + Intronic
948927713 2:241110241-241110263 TCTATGAATCTGACTACTCTAGG - Intronic
1168871193 20:1130108-1130130 TCTACAAATTTGACTAATCTAGG - Intronic
1169370341 20:5024028-5024050 TCTATGAATTTGATGACTCTAGG + Intergenic
1169387220 20:5160758-5160780 TCTACGAATTTGACTACTCTAGG + Intronic
1169536621 20:6550703-6550725 TCTATGGATTTGCCTATTCTCGG - Intergenic
1169604257 20:7297964-7297986 TTTACGAATTTAACTACTCTAGG + Intergenic
1169915684 20:10680885-10680907 TCTATGAATTTGACTACCCTAGG + Intergenic
1170474612 20:16702366-16702388 TCTATGAATTTGACTACTCTAGG + Intergenic
1170504175 20:17007581-17007603 TCTATGAATTTGACTACACTAGG + Intergenic
1170712070 20:18800369-18800391 TCTATGAATTTGACTACTCCAGG + Intergenic
1170784823 20:19458579-19458601 TGTATGAATTTGACTACTCTAGG + Intronic
1170966847 20:21081371-21081393 TCTATGAATTTGACTACTGTGGG - Intergenic
1170986095 20:21260309-21260331 TCTATGAATTTGCCTACTCTAGG + Intergenic
1171017211 20:21552890-21552912 TCTATGAATGTGGCCACTCTAGG + Intergenic
1171061339 20:21965034-21965056 TCTACAAATTTGCCTATTCTAGG + Intergenic
1171131341 20:22656366-22656388 TCTATGAATTTGACTACTCTAGG + Intergenic
1171401764 20:24877766-24877788 TCTCTGAATTTGCCTATTCTAGG - Intergenic
1171468404 20:25349684-25349706 TGTATGAATTTGCCTATTCTAGG - Intronic
1172321259 20:33996828-33996850 TCTGTGAATTTGACTACTCTAGG + Intronic
1172336572 20:34121573-34121595 TCTATGAATTTGACTATTCTAGG - Intergenic
1172485483 20:35295375-35295397 TCTATGAATTTGACTCCTCTAGG + Intergenic
1172611254 20:36254382-36254404 TCTATGAATCTGACTACTCTAGG - Intronic
1172711941 20:36931963-36931985 TTTATGAATTTGGCTACTCTAGG - Intronic
1172724962 20:37032357-37032379 TCTGTGAATTTGACTACTCTAGG - Intronic
1173145096 20:40517891-40517913 TCTATGAACTTGACTACTCTAGG - Intergenic
1173216460 20:41089367-41089389 TCTATGAATTTGACTACTTTAGG + Intronic
1174208744 20:48860314-48860336 TCTATGATTTTGACTACTCTAGG - Intergenic
1174500900 20:50983430-50983452 TCTGTGAATTTGACTACTCTAGG - Intergenic
1174502982 20:50999278-50999300 TCTAGGAATTGGCCAACTCTGGG + Intergenic
1174508573 20:51033525-51033547 TCTATGAATTTGAAAACTCTAGG - Intergenic
1174936293 20:54873877-54873899 TCTATGGATTTGCCTATTCTAGG - Intergenic
1175141109 20:56860732-56860754 TCTATGAATTCGACAACTCTAGG + Intergenic
1175435314 20:58943136-58943158 TCTATGAATTTGCCTCTTCTAGG - Intergenic
1175956869 20:62615586-62615608 TCTACGCGTGTGGCCACTCTAGG - Intergenic
1175977644 20:62719632-62719654 TCTGTGAATTTGACCACTCCGGG + Intronic
1176642454 21:9318827-9318849 TATACTAATTTTCCCTCTCTTGG + Intergenic
1176655696 21:9587490-9587512 TCTATGGATTTGACTACTCTAGG + Intergenic
1177002438 21:15631023-15631045 TCTATGAATTTGACTACTCTAGG - Intergenic
1177253198 21:18623796-18623818 TCAAGGAAGTTACCCACTCTGGG + Intergenic
1177520667 21:22218739-22218761 TCTACGAATTTGACTACTCTAGG + Intergenic
1178367157 21:31997524-31997546 TCTATGAATCTAACCACTCTAGG - Intronic
1178370080 21:32020287-32020309 TCTGTGAATTTGACTACTCTAGG + Intronic
1178468109 21:32867197-32867219 TCTACGAACTTGATTACTCTAGG + Intergenic
1178670669 21:34588949-34588971 TCTATGAATTTGACTACTTTAGG - Intronic
1178677077 21:34640107-34640129 TCTATGAATTTGACTATTCTAGG + Intergenic
1178826524 21:36021783-36021805 TCTATGAATTTGCCTGTTCTAGG - Intergenic
1178988967 21:37335694-37335716 TCTATGATTTTGCCTATTCTAGG + Intergenic
1179031921 21:37728243-37728265 TCTATGAATTTGGCTATTCTAGG - Intronic
1179076306 21:38125072-38125094 TCTAGGAATTTGACTACTCTAGG + Intronic
1179217845 21:39382461-39382483 TCTGTGAATTTGACTACTCTTGG + Intronic
1179268994 21:39834009-39834031 TCTATGAATTTGACCACTCTAGG + Intergenic
1179311563 21:40200352-40200374 TCTATGAATTTGACTTCTCTGGG + Intronic
1179416979 21:41206578-41206600 TCTATGAATTTGCCTTCTCCAGG - Intronic
1179477012 21:41653402-41653424 TCTATGAATTAGCCTATTCTGGG + Intergenic
1179920704 21:44505617-44505639 TCTATGAATTTGACCACTCTAGG + Intronic
1180114093 21:45685182-45685204 TCTCTGAATTTGACTACTCTTGG - Intronic
1180123129 21:45767260-45767282 TCTACAGATTTGCCCATGCTGGG + Intronic
1180351468 22:11808180-11808202 TATACTAATTTTCCCTCTCTTGG + Intergenic
1180386736 22:12183897-12183919 TATACTAATTTTCCCTCTCTTGG - Intergenic
1180822725 22:18842495-18842517 TCTACGGATTTGCCTAGTCTAGG - Intergenic
1180914653 22:19477476-19477498 TCCATGAATTTGCCTACTCTAGG - Intronic
1180924968 22:19547353-19547375 TCTATGAATTTGACTACTCTAGG + Intergenic
1181190238 22:21133531-21133553 TCTATGGATTTGCCTAGTCTAGG + Intergenic
1181208964 22:21276993-21277015 TCTATGGATTTGCCTAGTCTAGG - Intergenic
1181347663 22:22231840-22231862 TGTAGGAATTTGACTACTCTAGG - Intergenic
1181487491 22:23240882-23240904 TCTATGAATTTGACTACTCTAGG + Intronic
1181502937 22:23329205-23329227 TCTATGGATTTGCCTAGTCTAGG + Intergenic
1181579331 22:23818695-23818717 TCTATGAATTTGACTACTCGAGG + Intronic
1181611631 22:24017530-24017552 TCTATGAATTTGACTACTGTAGG + Intronic
1181653741 22:24277580-24277602 TCTATGGATTTGCCTAGTCTAGG + Intronic
1181749616 22:24979834-24979856 TCTATGAATTTGACTACTTTAGG + Intronic
1181784465 22:25216829-25216851 TCCATGAATTTGCCTACCCTAGG + Intergenic
1181791166 22:25267684-25267706 TCTATGAATTTGCCTATTCTGGG - Intergenic
1181826974 22:25524714-25524736 TCTATGAATTTGCCTATTCTGGG - Intergenic
1182252263 22:29010303-29010325 TCTAGGAATTTGACCACTCCAGG + Intronic
1182275602 22:29186621-29186643 TCTATGATTTTGACTACTCTAGG - Intergenic
1182402408 22:30089928-30089950 TCTGTGAATTTGCCTACTGTAGG + Intronic
1182514126 22:30843310-30843332 TCTACGAATTTGCCACCAATGGG - Intronic
1182636261 22:31729695-31729717 TCTATGAATTTGACTACTCTAGG - Intronic
1182674519 22:32027822-32027844 TCTATGAATTTGCCTGTTCTAGG - Intergenic
1182900740 22:33896137-33896159 TCTACAAATTTGACTACTGTAGG + Intronic
1183473730 22:38024149-38024171 TCTATGATTTTGACTACTCTGGG + Intronic
1183850757 22:40585352-40585374 TCTATGATTTTGACCTCTCTAGG - Intronic
1184016483 22:41789684-41789706 TCTATGAATTTGACTACTGTAGG + Intronic
1184346862 22:43918895-43918917 TCTATGAATCTGACTACTCTAGG - Intergenic
1184382834 22:44156812-44156834 TCTATGAATTTGACTCCTCTGGG - Intronic
1184537616 22:45098201-45098223 TCTATGAATTTGACTATTCTAGG - Intergenic
1184674557 22:46033928-46033950 TCTATGAATTTGACTATTCTCGG + Intergenic
1184756822 22:46520931-46520953 TCTATGAATTTGACTCCTCTAGG + Intronic
1184933491 22:47699397-47699419 TCTATGAATTTGACTATTCTAGG + Intergenic
1185327783 22:50235624-50235646 TCTAGGATTTTGGCCACTGTAGG - Intronic
1203217975 22_KI270731v1_random:18455-18477 TCTACGGATTTGCCTAGTCTAGG + Intergenic
1203272862 22_KI270734v1_random:68402-68424 TCTATGGATTTGCCTAGTCTAGG - Intergenic
949276037 3:2282934-2282956 TCTATGGATTTGCCTATTCTGGG - Intronic
949407979 3:3734634-3734656 TCTATGAATTTGACTACTCTAGG - Intronic
949724657 3:7029643-7029665 ACTATGAATTTGACCACTCTAGG - Intronic
949910458 3:8901585-8901607 TCTATGAGTTTGCCCATTCCAGG - Intronic
949941958 3:9162102-9162124 TCTATGAACTTGACAACTCTAGG - Intronic
949956411 3:9272452-9272474 TCCATGAATTTGACTACTCTAGG + Intronic
950278720 3:11686449-11686471 TCTAGGAATTTGACTATTCTGGG - Intronic
950286044 3:11745616-11745638 TCTATGAATTTGACTACTCTAGG - Intergenic
950385490 3:12655860-12655882 TCTATGAATTTGCCTATTCCAGG - Intronic
950394916 3:12726819-12726841 TCTATGAATTTGCCTATTCTAGG + Intergenic
950409860 3:12828772-12828794 TCTATGAATTTGACTACTCTAGG + Intronic
950418180 3:12880706-12880728 TCTATGAATTTTCCTATTCTAGG + Intergenic
950736687 3:15014696-15014718 TCCATGAATTTGACTACTCTAGG + Intronic
950769323 3:15298740-15298762 TCTATGAATTTGACTACCCTAGG - Intronic
950842476 3:15980605-15980627 TCTATGAATTTGACTCCTCTAGG - Intergenic
951448380 3:22808576-22808598 TTTATGAATTTGCCTACTCTAGG - Intergenic
951537674 3:23754437-23754459 TCTATGAATTTGACTATTCTAGG + Intergenic
951678562 3:25270417-25270439 TCTATGAATTTGACTACTTTAGG - Intronic
952205586 3:31178853-31178875 TCTATGAATTTGACTACTCTGGG + Intergenic
952486835 3:33820608-33820630 TCTATGAATTTGATTACTCTAGG + Intronic
952770823 3:36998616-36998638 TCTATGAATGTGACTACTCTAGG - Intronic
952796827 3:37246554-37246576 TCTAAGAATTTGACTACTCTAGG - Intronic
952804799 3:37338790-37338812 TCTATGGATTTGCCTATTCTGGG + Intronic
952916137 3:38244477-38244499 TCTATGAATTTGCCTACTCTAGG + Intronic
952927415 3:38330819-38330841 TCTATGGATTTGCCTATTCTGGG - Intergenic
952938302 3:38419093-38419115 TCTATGGATTTGCCTATTCTAGG + Intronic
953008569 3:39001332-39001354 TCTATGAATCTGCCTACTCTGGG + Intergenic
953207011 3:40840072-40840094 TCTATGAATTTGACTACTCCAGG - Intergenic
953266610 3:41395562-41395584 TCTATGAATTTGACTACTCTAGG - Intronic
953406243 3:42661219-42661241 TCCAGGAAATTCCCCACTCTGGG - Intronic
953423961 3:42777619-42777641 TCTATGAATTTGTTCATTCTAGG - Intronic
953532458 3:43750797-43750819 TCTATGAATTTGACTATTCTAGG + Intergenic
953593506 3:44284320-44284342 TCTATGAATTTGTCTATTCTAGG + Intronic
953695623 3:45156074-45156096 TCTATGAATTTGCCTATTCTAGG + Intergenic
953833041 3:46318489-46318511 GCTATGAATTTGACTACTCTAGG + Intergenic
953903288 3:46855207-46855229 TGTATGAATTTGACTACTCTAGG + Intergenic
953924301 3:46974132-46974154 TCTCTGAATTTGACTACTCTAGG - Intronic
954283929 3:49604418-49604440 TCTATGAATTTGACAATTCTAGG + Intronic
954339805 3:49944197-49944219 TCTATGAATTTGACTACTCTAGG + Intronic
954471341 3:50698224-50698246 TCTAAGGATTTGCCTATTCTAGG + Intronic
954522122 3:51237944-51237966 TCTATGAATTTGACTACTTTAGG + Intronic
954657029 3:52200372-52200394 TCTATGAATTTGACTATTCTAGG + Intronic
954730480 3:52657086-52657108 TCTATGAATTTGACTATTCTAGG - Intronic
954770258 3:52961225-52961247 TCTATGAATTTGACTACTGTAGG - Intronic
954829434 3:53407034-53407056 TCTATGAATTTGACTACTTTAGG - Intergenic
955152703 3:56383902-56383924 TCTATGAATTTGACTACTCTAGG + Intronic
955159933 3:56454991-56455013 TCTATGAATTTGACTATTCTAGG - Intronic
955302541 3:57795875-57795897 TCTAGGACTTTGCCTATTCTAGG + Intronic
955335798 3:58084810-58084832 TCTATGAATTTGCTTATTCTAGG + Intronic
955495443 3:59527168-59527190 TCTATGAATTTGCCTGTTCTAGG - Intergenic
955765321 3:62338447-62338469 TCTATGAATTTGATTACTCTAGG - Intergenic
956011428 3:64835576-64835598 TCTACGGATTTGCCTATTCTAGG + Intergenic
956188756 3:66587771-66587793 TCTATGAATTTGCCTATTCTGGG - Intergenic
956289239 3:67644419-67644441 TCTGTGAATTTGCCTACTCTAGG - Intronic
956315580 3:67932099-67932121 TCTACAAATTTGACAATTCTAGG - Intergenic
956393305 3:68797732-68797754 TTTATGAATTTGACTACTCTAGG - Intronic
956426004 3:69135920-69135942 TCTATGAATTTCACTACTCTGGG - Intergenic
957097652 3:75791821-75791843 TATACTAATTTTCCCTCTCTTGG - Intergenic
957192147 3:77022996-77023018 TCTATAAATTTGACTACTCTAGG + Intronic
958851364 3:99329825-99329847 TCTATGAATTTGAATACTCTGGG - Intergenic
958893706 3:99807501-99807523 TCTATGAATTTGACTACTCTAGG - Intergenic
958922025 3:100118025-100118047 TCTATGAATTTGACAATTCTGGG - Intronic
959511938 3:107223557-107223579 TCTATGAATTTGACTATTCTAGG - Intergenic
959608177 3:108264704-108264726 TCTGTGAATTTGACTACTCTAGG - Intergenic
960109574 3:113832643-113832665 TCTATGAATTTGACTACTCTAGG + Intronic
960529326 3:118745498-118745520 TCTATGATTTTGACTACTCTAGG - Intergenic
961053292 3:123765856-123765878 TCTATGAATTTTACTACTCTAGG - Intronic
961325878 3:126109050-126109072 TCTGAGAATTGTCCCACTCTGGG - Intronic
961361248 3:126369061-126369083 TCTATGAATTTGACTGCTCTAGG + Intergenic
961380789 3:126495351-126495373 TCTATGAATTTGACTGCTCTAGG + Intronic
961416340 3:126760543-126760565 TCTATGAATTTCACTACTCTAGG + Intronic
961560338 3:127724263-127724285 TCTATAAATTTGACTACTCTAGG + Intronic
961584808 3:127913581-127913603 TCTACGAATTTGCCTATTCTAGG - Intergenic
961747358 3:129073075-129073097 TCTTGGAATGTGACCACTCTAGG - Intergenic
961765500 3:129207275-129207297 TTTATGAATTTGACTACTCTAGG + Intergenic
962582505 3:136810923-136810945 TGTATGAATTTGACTACTCTAGG + Intergenic
962591189 3:136890934-136890956 TCTATGAATTTGACAACTCCTGG + Intronic
962759925 3:138501492-138501514 TCTATGGATTTGCCTATTCTAGG + Intronic
962784836 3:138758197-138758219 TCTACCAGTTTGCCTATTCTTGG - Intronic
963121394 3:141779733-141779755 TCTAGGGATTTGCCTATTCTGGG + Intronic
963124910 3:141806676-141806698 TCTATGAATTTGACTGCTCTAGG - Intronic
963125046 3:141808396-141808418 TCTATGAATTCGACTACTCTAGG - Intronic
963361827 3:144283521-144283543 TCTGCGTCTTTGCCAACTCTTGG - Intergenic
963747301 3:149137758-149137780 TCTATGAATTTGACTACTCTAGG - Intronic
963804380 3:149708523-149708545 TCTATGAATTTGACCACTCTAGG + Intronic
963822693 3:149915780-149915802 TCTATGAATTTGGCTACTCCAGG - Intronic
963851386 3:150213904-150213926 TCTATGAATTTGCCTGTTCTAGG + Intergenic
964018780 3:151981355-151981377 TCTATGAATTTGACTACTCTAGG + Intergenic
964235089 3:154516208-154516230 TCTATAAATTTGCCCACTCCAGG + Intergenic
964498520 3:157322161-157322183 TTTATGAATTTGACTACTCTAGG + Intronic
964560619 3:157991712-157991734 TCTATGAATTTGCCAATTCTGGG + Intergenic
964785676 3:160393460-160393482 TCTATGAATTTGACTACTCTAGG - Intronic
964800238 3:160548503-160548525 TCTATGCATTTGCCTATTCTAGG + Intronic
964873256 3:161336533-161336555 TTTAAGAATTTTCCCAGTCTTGG + Intergenic
965505388 3:169509560-169509582 TCTGTGAATTTGCCTATTCTAGG + Intronic
965544874 3:169904962-169904984 TCTACAAATTTGACCACCGTAGG - Intergenic
965616218 3:170595341-170595363 TCTATGAATTTGACTACTTTAGG + Intronic
965753488 3:172000829-172000851 TCTATGATTTTGCCTATTCTAGG - Intergenic
966412810 3:179660329-179660351 TCTATGAATTTGCTTATTCTAGG + Intronic
966502955 3:180666170-180666192 TCTATGAATTTGACTACTCTAGG + Intronic
966700665 3:182846761-182846783 TCTATGAATTTGCCTATTCTGGG - Intronic
966717198 3:183025086-183025108 TCTATGAATTTGACTACTCTAGG - Intronic
966903613 3:184505934-184505956 TCTATGAATTTGACTACTCTGGG - Intronic
966923809 3:184631518-184631540 TCCCCGGATTTGCCCAATCTGGG - Intronic
967013392 3:185459917-185459939 TCTATGAATTTGCCTATTCCAGG + Intronic
967323360 3:188215480-188215502 TCTATGAATGTGACTACTCTAGG + Intronic
967756217 3:193172572-193172594 TCTATGGATTTGCCTATTCTGGG - Intergenic
968034197 3:195531907-195531929 TCTAGAAATGTGACCACTCTAGG + Intronic
968169857 3:196501503-196501525 TCTATGAATCTGGCCATTCTAGG - Intronic
1202744431 3_GL000221v1_random:86191-86213 TATACTAATTTTCCCTCTCTTGG - Intergenic
968374187 4:24300-24322 TCAAGGACTCTGCCCACTCTAGG - Intergenic
968475658 4:805891-805913 TCAATGAATTTGGCTACTCTAGG - Intronic
968740019 4:2322793-2322815 TCTATGAATTGGCCTATTCTGGG + Intronic
968840682 4:3003121-3003143 TCTATGAATTTGACTACTCTAGG + Intronic
968961880 4:3749705-3749727 TCTATGAATTTGACTGCTCTAGG + Intergenic
969088508 4:4674558-4674580 TCTATGATTTTGACTACTCTAGG + Intergenic
969108288 4:4824792-4824814 TCTATGAATTTGAGTACTCTAGG - Intergenic
969241779 4:5903580-5903602 TCTATGAATTTGACCACTCTAGG - Intronic
969287760 4:6216180-6216202 TCTATGAATTTGACTACTCTAGG - Intergenic
969369508 4:6722852-6722874 TCTATGAATTTGACGACTCTAGG + Intergenic
969593682 4:8136230-8136252 TCTATGAAGTTGACGACTCTTGG - Intronic
969744126 4:9056330-9056352 TCTACAGATTTGCCTATTCTGGG - Intergenic
969918304 4:10511569-10511591 TCTATGAATTTGCCTATTCTAGG + Intronic
970176407 4:13344011-13344033 TCTATGAATTTGACTACTCTAGG - Intergenic
970337999 4:15072743-15072765 TCTATGTATTTGAGCACTCTAGG - Intergenic
971368586 4:25996764-25996786 TCTATAAATTTGTCTACTCTAGG + Intergenic
971409747 4:26357773-26357795 TCTATGAATTTGACTACTCTAGG + Intronic
971411397 4:26376330-26376352 TCCATGAATTTGACTACTCTAGG + Intronic
971434301 4:26604011-26604033 TCTATGAATTTAACCACTTTAGG + Intronic
972315818 4:37924578-37924600 TCTATGAATTTGCCTATTCTAGG + Intronic
972586586 4:40443100-40443122 TCTATGAATTTGACTACTCTAGG - Intronic
972679461 4:41291358-41291380 TCTATGAATTTGATCACTCTAGG + Intergenic
972772373 4:42209455-42209477 TCTATGAATTTGAATACTCTAGG + Intergenic
973279852 4:48347815-48347837 TCTATGAATTTGACCACTCTAGG + Intronic
973621517 4:52731126-52731148 TCTATGAATTTGACTATTCTAGG + Intronic
973760674 4:54112367-54112389 TCTATGAATTTGAGTACTCTAGG + Intronic
973919166 4:55667179-55667201 TCTATGAATTTGACTATTCTGGG + Intergenic
974001935 4:56520444-56520466 TCTATGAATCTGACAACTCTAGG - Intronic
974026183 4:56735380-56735402 TCTATGAATTTGACTACTCTAGG - Intergenic
974124396 4:57677653-57677675 TCTATAAATTTGACTACTCTAGG + Intergenic
974244396 4:59295273-59295295 TCTATGAATTTACCCACTCTAGG - Intergenic
974552359 4:63395158-63395180 TCTATGAATCTGACTACTCTAGG - Intergenic
974773304 4:66444775-66444797 TCTATGAGTTTGACTACTCTAGG - Intergenic
975208775 4:71674976-71674998 TTTATGAATTTGACTACTCTAGG - Intergenic
975223387 4:71840435-71840457 TCTACGAATTGGCTAGCTCTGGG + Intergenic
975463671 4:74685165-74685187 TCTATAAATTTGACTACTCTGGG - Intergenic
975488520 4:74962699-74962721 TCTATGAATTTGACTACTTTAGG - Intronic
975658679 4:76667013-76667035 TCTATGAATTTGACTATTCTAGG - Intronic
975872147 4:78791653-78791675 TCTATGAATTTGACTATTCTAGG + Intronic
976456109 4:85248374-85248396 TCTATGAATTTCACTACTCTAGG - Intergenic
976516947 4:85979533-85979555 TCTATGAATTTGTCTACTCTAGG + Intronic
977091123 4:92677058-92677080 TCTATGAATTTGTACACTTTAGG - Intronic
977152303 4:93527910-93527932 TCTACGAATTTGAACATTCTAGG + Intronic
977358029 4:95970909-95970931 TCTATGAATGTGACTACTCTAGG + Intergenic
977494122 4:97753282-97753304 TCTATGAATTTGCCTATTCTAGG + Intronic
977506958 4:97914865-97914887 TCTATGAATTTCACTACTCTAGG + Intronic
978328986 4:107590582-107590604 TCTATGCATTTGCTTACTCTAGG + Intronic
978360127 4:107922731-107922753 TTTATGAATTTGCCTATTCTAGG - Intergenic
978775378 4:112500539-112500561 TCTATGAATTTGCCTTTTCTAGG - Intergenic
978780311 4:112545896-112545918 TCTGTGAATTTGCCTATTCTAGG - Intronic
978883447 4:113737427-113737449 TCTGTGAATTTGACTACTCTGGG - Intronic
979274790 4:118803030-118803052 TCTATGAGTTTGCCTACTCTAGG - Intronic
979623666 4:122823727-122823749 TCTATGGATTTGCCTACCCTAGG + Intergenic
979679263 4:123441811-123441833 TCTAACAATTTGACTACTCTAGG + Intergenic
980044795 4:127975353-127975375 TCTATGAATCTGACTACTCTAGG + Intronic
980193849 4:129561931-129561953 TCTATGAATCTGACTACTCTAGG + Intergenic
980519047 4:133907085-133907107 GCTGTGAATTTGCCCACTCCTGG + Intergenic
981060649 4:140421004-140421026 TCTATGATTTTGACTACTCTAGG + Intronic
981072693 4:140560929-140560951 TCTATGAATTTGACTACTCTAGG + Intronic
981727564 4:147863298-147863320 TCTATGAATTTAACTACTCTAGG + Intronic
981751315 4:148094985-148095007 TCTATGAATTTGGCTACTCTAGG - Intronic
982095932 4:151923392-151923414 TGTATGAATTTGCCTATTCTAGG - Intergenic
982131472 4:152232825-152232847 TCAATGAATTTGACTACTCTAGG - Intergenic
982141931 4:152331505-152331527 TCTATGAGTTTGACTACTCTAGG - Intronic
982188434 4:152826960-152826982 GCTATGAATTTGACTACTCTAGG - Intronic
984855872 4:184195637-184195659 TCTGTGAATTTGACCACTCTAGG + Intronic
984870849 4:184323754-184323776 TCTATGAAGTTGCCAATTCTAGG - Intergenic
984936752 4:184896842-184896864 TCTTTGAATTTGACTACTCTAGG - Intergenic
985094215 4:186396731-186396753 TCTATGTATTTGACTACTCTAGG + Intergenic
985423190 4:189804345-189804367 TCTAGGAATTGGCTAACTCTGGG + Intergenic
985460543 4:190101963-190101985 TCAAGGACTCTGCCCACTCTAGG + Intergenic
985526171 5:403153-403175 CCTCCGAATTTGCCTACACTGGG - Intronic
985710652 5:1426726-1426748 TCTGTGAATTTGTCTACTCTAGG - Intronic
986312798 5:6567153-6567175 TCCATGAATTTGCCTATTCTAGG - Intergenic
986439187 5:7763623-7763645 TCTATGAATTTGCCTATTCTAGG + Intronic
986619505 5:9657684-9657706 TCTAAGAATTTAACTACTCTAGG - Intronic
986658727 5:10040317-10040339 TCTATGAATTTGACGACTCTAGG + Intergenic
986826359 5:11527023-11527045 TCTATGAATTTGCCTACTCTAGG - Intronic
986973791 5:13371259-13371281 TCTAGGAATTTGCCTATTCTAGG - Intergenic
987039128 5:14045537-14045559 TCTATGAATTTGACCTCTCTAGG - Intergenic
987145822 5:14990533-14990555 TCTATGAATTTGCCTATTCTAGG + Intergenic
987199238 5:15557938-15557960 TCTATGAATTTGCCTATTTTAGG - Intronic
988475006 5:31576877-31576899 TCTATCAATTTGCCTACTATAGG - Intergenic
988506984 5:31832206-31832228 TCTATGAATTTGACTATTCTAGG - Intronic
988545352 5:32151907-32151929 TCTATGAATTTGACTATTCTAGG - Intronic
988582148 5:32477714-32477736 TCTATGACTTTGACTACTCTAGG - Intergenic
988830660 5:34984088-34984110 TCTATGAACTTGCCTACTCTGGG + Intergenic
989242247 5:39214967-39214989 TTTATGAATTTGACTACTCTAGG - Intronic
990293310 5:54377132-54377154 TCTATGAATTTGACTATTCTAGG - Intergenic
990312993 5:54557560-54557582 TCTATGAATTTGACTACTGTAGG - Intergenic
990465063 5:56064003-56064025 TCTGTGAATTTGACTACTCTAGG - Intergenic
991279280 5:64893003-64893025 ATTACAAATTTGTCCACTCTTGG + Intronic
991476342 5:67024106-67024128 TCTATGAATTTGACTACTCTAGG + Intronic
991602728 5:68369711-68369733 TCTACGAATTGGACTATTCTAGG + Intergenic
991689939 5:69216193-69216215 TCTATGAATTTGACTACTGTGGG - Intergenic
992195527 5:74335313-74335335 TCTAGGAATTGGCTCACCCTGGG + Intergenic
992247995 5:74847336-74847358 TCTACGAATTGGACTATTCTAGG + Intronic
992268851 5:75045334-75045356 TCTACAAATTTGTTTACTCTAGG + Intergenic
992384050 5:76266597-76266619 TCTATGAATTTGCCTATTCTAGG - Intronic
992404692 5:76445891-76445913 TCTATGAATTTGACTACTCTTGG + Intronic
992734187 5:79702539-79702561 TCTACAGATTTGCCTATTCTGGG - Intronic
992861366 5:80913889-80913911 TCTATGAATTTGACTACTGTAGG - Intergenic
993642306 5:90420117-90420139 TCTATGAATTTCCCTATTCTAGG - Intergenic
993740962 5:91539181-91539203 TCTATGAATTTGCCTCTTCTCGG + Intergenic
993945075 5:94109218-94109240 TCTATGAATTTGACTACTCTAGG - Intronic
993964498 5:94344853-94344875 TCACTGAATTTGACCACTCTAGG - Intronic
994257444 5:97616102-97616124 TCTGGGAATTAGCCCACTGTTGG - Intergenic
995720900 5:115131816-115131838 TCTATGAATGTGCCTATTCTAGG - Intronic
996490772 5:124093095-124093117 TCAACTAATCTGCCCACTTTGGG + Intergenic
996556805 5:124786661-124786683 TCTAAGAATTTGCCTATTTTAGG - Intergenic
996562452 5:124845471-124845493 TCTATGAATTTGACCACTCTAGG - Intergenic
996856012 5:128008085-128008107 TCCAAGAATTTGCCAATTCTAGG - Intergenic
996899393 5:128526671-128526693 TCTATGAATTTGACTACTTTAGG - Intronic
997116676 5:131132827-131132849 TCTATGAATTTGACTACTCTAGG - Intergenic
997183189 5:131854276-131854298 TCTATAAATTTGACTACTCTAGG - Intronic
997289288 5:132714217-132714239 TCTATGAATTTGACTGCTCTGGG - Intronic
997289313 5:132714560-132714582 TCTATGAATTTGACTATTCTAGG - Intronic
997317186 5:132946618-132946640 TCTATGAATTTGCCTATTCTAGG - Intronic
997543966 5:134689928-134689950 TCTATGAATTTGCCTATTCTAGG - Intronic
997555945 5:134798686-134798708 TCTATGCATTTGCCTATTCTGGG + Intronic
997898864 5:137744901-137744923 TCTCTGAATTTGCCTACTCTGGG + Intergenic
998153927 5:139773536-139773558 TCTATGAATTTGACTACCCTAGG + Intergenic
998181424 5:139948118-139948140 TCTATGAATCTGACTACTCTAGG + Intronic
998271896 5:140714011-140714033 TCTATAAATTTGACTACTCTAGG + Intergenic
998272731 5:140721566-140721588 TCTATAAATTTGACTACTCTAGG + Intergenic
998273482 5:140728640-140728662 TCTATAAATTTGACTACTCTAGG + Intergenic
998332031 5:141337561-141337583 TCTATGAATTTGACTAATCTAGG - Intronic
998427071 5:142037924-142037946 TCTATGAATTTGACTACTCCAGG - Intergenic
998594995 5:143519979-143520001 TCTATAAATTTGACTACTCTAGG + Intergenic
998641624 5:144018288-144018310 TCCAGGCATCTGCCCACTCTGGG + Intergenic
999038460 5:148380859-148380881 TCTATGATTTTGACCACTCTAGG - Intergenic
1000022924 5:157334210-157334232 TCCATGAATTTGCCTACTGTAGG - Intronic
1000029777 5:157391489-157391511 TCTATGCATTTGACTACTCTAGG + Intronic
1000068207 5:157715052-157715074 TCTATGAATTTGACTACTGTAGG + Intergenic
1000370378 5:160529476-160529498 TCTGTGAATTTGCCTATTCTAGG + Intergenic
1000578398 5:163005479-163005501 GCTATGAATTTGACTACTCTAGG + Intergenic
1000713684 5:164612808-164612830 TCTATGAATTTGACTACTCTAGG + Intergenic
1000873209 5:166603057-166603079 TCTATGAATGTGACTACTCTAGG + Intergenic
1001114419 5:168927307-168927329 TCTGTGAATTTGGCTACTCTAGG - Intronic
1001128611 5:169044523-169044545 TCTATGGATTTGCCTATTCTGGG - Intronic
1001308278 5:170591652-170591674 TCTACAAATTTGACTACTCTAGG + Intronic
1001472450 5:172024156-172024178 TCTATGAATTTGACTAGTCTAGG + Intergenic
1001477712 5:172062686-172062708 CCTATGAATTTGACTACTCTAGG - Intronic
1001583186 5:172814071-172814093 TCTATGAATTTGACAACTTTAGG - Intergenic
1001714176 5:173801544-173801566 TCTGTGAATTTGACTACTCTGGG - Intergenic
1001883700 5:175269417-175269439 TCTACGATTTTGACAACTCTAGG - Intergenic
1001908632 5:175495241-175495263 TCTCTGAATTTGACTACTCTAGG - Intronic
1002005868 5:176234268-176234290 TCTGTGAATTTGCCTATTCTAGG + Intergenic
1002117677 5:176976715-176976737 TATATGGATTTGCCCATTCTGGG - Intronic
1002143234 5:177157809-177157831 TCTATGTATTTGCCTATTCTAGG + Intronic
1002220508 5:177676357-177676379 TCTGTGAATTTGCCTATTCTAGG - Intergenic
1002333807 5:178464257-178464279 TCTATGAATTTCACTACTCTAGG + Intronic
1002431056 5:179204132-179204154 TCTGAGAATTTGACTACTCTGGG - Intronic
1002856360 6:1041347-1041369 TTTATGAATTTGACCATTCTAGG + Intergenic
1002910565 6:1488130-1488152 TCTACGACTTTGACTACTTTAGG - Intergenic
1002933813 6:1654550-1654572 TTTATGAATTTGACTACTCTAGG - Intronic
1003014003 6:2453222-2453244 TCTGTGAATTTGCCTATTCTAGG + Intergenic
1003159562 6:3623655-3623677 TCTCTGAATTTGACGACTCTGGG + Intergenic
1003161823 6:3642589-3642611 TCTATGAATATGACCACGCTAGG - Intergenic
1003163082 6:3652664-3652686 TCTGTGAATTTGTCTACTCTAGG + Intergenic
1003263687 6:4548188-4548210 TCTATGAATTTGCCTATTGTAGG - Intergenic
1003271191 6:4609380-4609402 TCTACGAGTTTGACTAATCTAGG - Intergenic
1003348845 6:5296625-5296647 TCTCTGAATTTAACCACTCTAGG + Intronic
1003524804 6:6888795-6888817 TCTACGAATGTGGTGACTCTAGG - Intergenic
1003539511 6:7005996-7006018 TCCATGAGTTTGACCACTCTAGG - Intergenic
1003595592 6:7471419-7471441 TCTGTGAATTTGCCTACTCTGGG + Intergenic
1003656986 6:8021188-8021210 TCTATGAATTTGACTGCTCTAGG - Intronic
1003811520 6:9788321-9788343 TCTATGAATTTGCCTACTATAGG - Intronic
1003934270 6:10959340-10959362 TCTATGAATTTGACTATTCTAGG - Intronic
1003988621 6:11463260-11463282 TCTACAAATTTGGCTACTTTAGG + Intergenic
1004285821 6:14319625-14319647 TCTATGAATTTGACTATTCTAGG - Intergenic
1004361849 6:14978259-14978281 TCTATGAATTTGCCCATCCTGGG + Intergenic
1004536577 6:16509045-16509067 TCTATGAATTTGACTGCTCTAGG - Intronic
1004606408 6:17199254-17199276 TCTATGAATTTGCCTATTCTAGG + Intergenic
1004684259 6:17927446-17927468 TCTATGAATTTAACTACTCTGGG - Intronic
1004769053 6:18761246-18761268 TCTCTGAATTTGACCACTCTAGG + Intergenic
1004813459 6:19286554-19286576 TCTATGAATTTGACTACTCTAGG - Intergenic
1005062545 6:21790432-21790454 TCTATGAATTTGACTGCTCTAGG + Intergenic
1005089226 6:22038802-22038824 TCTATGAATTTGACTACTTTTGG + Intergenic
1005304560 6:24500461-24500483 TCTATGAATCTGACAACTCTAGG - Intronic
1005320856 6:24652073-24652095 TCTATGAATTTGACCAGTTTAGG + Intronic
1005380363 6:25227929-25227951 TCTATGAATTTGACTACTTTAGG - Intergenic
1005630323 6:27701164-27701186 TCTATGAATTTGACTATTCTAGG + Intergenic
1006059326 6:31408623-31408645 TCTATGAATTTGACCACTCTAGG + Intronic
1006071808 6:31503504-31503526 TCTATGAATTTGACCACTCTAGG + Intronic
1006371568 6:33647563-33647585 TCTATGAATTTGATTACTCTTGG + Intronic
1006587454 6:35125943-35125965 TCTATGAATTTGACTACTCTAGG - Intronic
1006866728 6:37214636-37214658 TCTATGAATTTGCCTGCTCTAGG + Intronic
1006874994 6:37287579-37287601 TCTAAGAATTTGACTACTCCAGG + Intronic
1007045304 6:38767505-38767527 TTTATGAATTTGCCTATTCTAGG + Intronic
1007238461 6:40408012-40408034 TCTATGAATTTGACTACTCCAGG - Intronic
1007544487 6:42682198-42682220 TCTATAAATTTGACTACTCTAGG - Intronic
1007887348 6:45245487-45245509 ACTATGAATTTGACCATTCTAGG + Intronic
1007926557 6:45654252-45654274 TCTATCAATTTGACCACTCCAGG + Intronic
1008608177 6:53160750-53160772 TCTATGAATTTGCCTATTCTAGG + Intergenic
1009522404 6:64699726-64699748 TCTGTGAATTTGACCAGTCTTGG - Intronic
1009966113 6:70580761-70580783 TCTATGAATTTGCCTATTCTAGG - Intronic
1010086290 6:71922362-71922384 TCTATGAATTTGCCTATTTTAGG + Intronic
1010336011 6:74684237-74684259 TCTATGAATTTGCCTATTTTAGG - Intergenic
1010416651 6:75619279-75619301 TCTATGAATTTACCTATTCTGGG + Intronic
1011148840 6:84246119-84246141 TCTATAAATTTGACTACTCTTGG - Intergenic
1011268182 6:85548034-85548056 TCCATGAATTTGACTACTCTGGG - Intronic
1011735494 6:90306309-90306331 TCTATGAATTTGACTACTCTAGG + Intergenic
1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG + Intergenic
1012458004 6:99428573-99428595 TGTGTGAATTTGCCCATTCTAGG - Intergenic
1012946849 6:105475319-105475341 TCTATGAATTTAACTACTCTAGG + Intergenic
1013028867 6:106310750-106310772 TCTATGAATTTGACTACTCTAGG + Intronic
1013238268 6:108218793-108218815 TCTGTGGATTTGCCCATTCTGGG - Intronic
1013343104 6:109234734-109234756 TCTATGAATTTGACTACTCTAGG - Intergenic
1013353906 6:109330950-109330972 TCTCTGAATTTGGCTACTCTAGG - Intergenic
1013451308 6:110284152-110284174 TCTATGAATTTGCCTAATCTAGG - Intronic
1013468957 6:110443903-110443925 TCTATGAGTTTGGCCACTCTAGG - Intronic
1013591774 6:111624849-111624871 TCTATGAGTTTGACTACTCTAGG - Intergenic
1013626881 6:111947220-111947242 TCTAGGAATTTGACTATTCTAGG - Intergenic
1013855680 6:114569124-114569146 TCTATGAATTTGGTTACTCTAGG + Intergenic
1014224617 6:118833721-118833743 TCTATGGATTTGACTACTCTAGG - Intronic
1014782663 6:125582705-125582727 TCTGCGAATTTGACCACTCTAGG + Intergenic
1014965463 6:127742708-127742730 TCTATGAATTTGACTACTCTAGG - Intronic
1015248549 6:131102888-131102910 TCTATGAATTTGCCTATTCCGGG + Intergenic
1015599580 6:134899453-134899475 TCTCTGAATTTGACTACTCTGGG + Intergenic
1015607449 6:134973383-134973405 TCTGTGAATTTGCCTGCTCTAGG - Intronic
1015762503 6:136680110-136680132 TCTCTGAATTTGACTACTCTAGG - Intronic
1016389764 6:143562917-143562939 TCTAGGAATTTGCCTATTCTAGG - Intronic
1016506949 6:144792880-144792902 TCTTCTATTTTGTCCACTCTTGG - Intronic
1016872333 6:148830745-148830767 TCTATGAATTTGACTACTCTAGG - Intronic
1016904940 6:149138833-149138855 TCCATGAATTTGCCTATTCTAGG + Intergenic
1017520875 6:155201015-155201037 TCTATGGATTTGCCTATTCTGGG + Intronic
1017604439 6:156118839-156118861 TTTATGAATTTGACTACTCTAGG - Intergenic
1017646534 6:156544319-156544341 TCTATGAATTTGACTACTCTAGG + Intergenic
1017649183 6:156565362-156565384 TCTATCAATTTGCCTATTCTTGG + Intergenic
1017661771 6:156681846-156681868 TCTATTAATTTGACTACTCTGGG - Intergenic
1017695240 6:157008362-157008384 TCTCTGAATTTGACTACTCTAGG + Intronic
1017842826 6:158235372-158235394 TCTATGAATTTGACTACTCTAGG + Intronic
1017897748 6:158695727-158695749 TTTATGAATTTGACTACTCTAGG + Intronic
1018034353 6:159868632-159868654 TCTATGTATTTGCCTATTCTAGG - Intergenic
1018072793 6:160180541-160180563 TCTATGAATTTGACTACTCTGGG - Intronic
1018189750 6:161300175-161300197 TCTATGACTTTGCCTATTCTAGG - Intergenic
1018293095 6:162313316-162313338 TCTATGAATTTGGCTACTCTAGG + Intronic
1018652582 6:166004583-166004605 TCTATGAATTTGTCTACTCCAGG + Intergenic
1018970177 6:168522844-168522866 TCTACAAATTTGCCTATTCTGGG - Intronic
1019495132 7:1334547-1334569 TCTACGGATTTGCCTGTTCTAGG + Intergenic
1019785857 7:2977064-2977086 TCTATGGATTTGCCTATTCTGGG - Intronic
1019836672 7:3392660-3392682 TTTATGAATTTGTCTACTCTAGG + Intronic
1019868436 7:3735369-3735391 TCTATGAGTTTGACTACTCTAGG + Intronic
1019923332 7:4176688-4176710 TCGACGGATTTGACGACTCTGGG + Intronic
1020229728 7:6308782-6308804 TCTATGAATTTGACTACTCTAGG - Intergenic
1020574981 7:9914495-9914517 TCTATGAATTTGACTATTCTAGG + Intergenic
1020714355 7:11651222-11651244 TCTATGAATTTGACCATTCTAGG - Intronic
1020961652 7:14811993-14812015 TCTGCGAATTTGACGACTCTAGG + Intronic
1021330422 7:19331615-19331637 TCTATGAATTTCACTACTCTAGG + Intergenic
1021436132 7:20618248-20618270 TCTATGGATTTGCCTGCTCTAGG + Intronic
1021536590 7:21712084-21712106 TCTATGAATTAGACTACTCTAGG + Intronic
1021988797 7:26122821-26122843 TCTATGAATTTGCCTATTCTAGG - Intergenic
1022080006 7:27010724-27010746 ACTATGAATTTGACTACTCTAGG + Intergenic
1022378008 7:29833104-29833126 TCTATGAATTTGTCTAGTCTAGG - Intronic
1022440954 7:30432825-30432847 TCTATGGATTTGCCTACTCTGGG - Intronic
1022602001 7:31769810-31769832 TCTATGGATTAGCCCATTCTGGG + Intronic
1022658047 7:32339294-32339316 TCTATGAATTTGACTACTCTAGG - Intergenic
1022759564 7:33333036-33333058 TCTACAAATCTGACTACTCTAGG + Intronic
1023152140 7:37212167-37212189 TCTATGAATTTGACTACTCCAGG - Intronic
1023235621 7:38082841-38082863 TCTATGTATTTGACTACTCTAGG - Intergenic
1023240651 7:38143215-38143237 TCTGTGAATTTGACTACTCTAGG - Intergenic
1023240689 7:38143787-38143809 TCTATCAATTTGCCTAATCTAGG - Intergenic
1023326737 7:39069066-39069088 TCTGCGACATTGCCCACTGTGGG + Intronic
1023341259 7:39222610-39222632 TCTATGAATTTGACCACTCTGGG + Intronic
1023347212 7:39283474-39283496 TCTATGAATTTGATTACTCTAGG + Intronic
1023751148 7:43373841-43373863 TCTAGGAATTTGACCACACTAGG + Intronic
1023877882 7:44299325-44299347 TCTATGAATTTGTCTATTCTAGG - Intronic
1023879589 7:44310732-44310754 TCTATGAATTTGACAACTTTAGG - Intronic
1023906925 7:44529717-44529739 TCTATGAGTTTGACCACTCTAGG - Intronic
1024306833 7:47936371-47936393 TCTATGAATGTGACTACTCTAGG + Intronic
1024490227 7:49974079-49974101 TCTATGAATTTGTCTACTTTTGG - Intronic
1024566218 7:50683251-50683273 TCTAGGAATTTGACTACTCCAGG - Intronic
1024847353 7:53662422-53662444 TTTATGAATTTGTCTACTCTAGG + Intergenic
1024855766 7:53777069-53777091 TCTAGGAATTCACCCAATCTAGG + Intergenic
1024979830 7:55147831-55147853 TCTATGAATTTGACTGCTCTGGG + Intronic
1025067180 7:55867330-55867352 TCTATGAATTTGACTACTTTAGG + Intergenic
1025282385 7:57637675-57637697 TCTATGGATTTGACTACTCTAGG + Intergenic
1025302345 7:57827844-57827866 TCTATGGATTTGACTACTCTAGG - Intergenic
1026433991 7:70377680-70377702 TCTATGAATTTGACTACTCTAGG + Intronic
1026487576 7:70834742-70834764 TCTATGAATTTGCCTATTCTAGG + Intergenic
1026512680 7:71039933-71039955 TCTATGAATTTGCCCATTCTAGG + Intergenic
1027191533 7:75999296-75999318 TCTGTGAATTTGACTACTCTAGG - Intronic
1027505152 7:79007602-79007624 TCTATAAATTTGACTACTCTAGG + Intronic
1028510936 7:91625495-91625517 TCTATAAATTTGACTACTCTAGG - Intergenic
1028924358 7:96341405-96341427 TCTTTGAATTTGCCTATTCTAGG + Intergenic
1029104307 7:98163067-98163089 TCTAGGAATCTGACTACTCTAGG - Intronic
1029242907 7:99177161-99177183 TCTATGAATTTGACTATTCTAGG - Intronic
1029647017 7:101863752-101863774 TCTATGCCTTTGACCACTCTAGG + Intronic
1029801466 7:102952130-102952152 TCTATGAATTTGATGACTCTAGG - Intronic
1029962140 7:104699482-104699504 TCTATGAATTTGACTACTCATGG - Intronic
1030063974 7:105645033-105645055 TCTATGAATTTGACTACTCCAGG - Intronic
1030343119 7:108403088-108403110 TGTATGAATTTGGGCACTCTGGG - Intronic
1030378017 7:108776140-108776162 TCTATGAATTTGACTGCTCTAGG + Intergenic
1030622380 7:111804374-111804396 TCTATGAATTTAACTACTCTAGG - Intronic
1030749923 7:113218839-113218861 TTTATGAGTTTGACCACTCTAGG + Intergenic
1031056103 7:116994208-116994230 TCTATGAATTTGACTACACTAGG + Intronic
1031651406 7:124295084-124295106 TCTATGAATTTGATTACTCTAGG - Intergenic
1031893086 7:127317915-127317937 TCTCTGAATTTGCCTATTCTAGG - Intergenic
1031945363 7:127833902-127833924 TCTAAGAATTTGACTACTCTAGG + Intronic
1032039316 7:128545490-128545512 TCTGTGAATTTGACTACTCTAGG + Intergenic
1032124295 7:129181180-129181202 TCTATGAATTTGCCTGTTCTGGG + Intergenic
1032133321 7:129249787-129249809 TCTATGAATTTGCCTATTCTGGG + Intronic
1032178433 7:129653124-129653146 TCTATGAATTTGACTACTCTAGG + Intronic
1032221248 7:129995889-129995911 TCTATGAATTTACCTATTCTAGG + Intergenic
1032255080 7:130290636-130290658 TCTACGAATTAGCCTATTCTAGG + Intergenic
1032447150 7:131994136-131994158 TCTATGAATTTGCCTATTCTGGG - Intergenic
1032496035 7:132363392-132363414 TCTAGGAGTTTGACAACTCTAGG + Intronic
1032658002 7:133952695-133952717 TCTATGAATTTGACTACTCTAGG + Intronic
1032805179 7:135347096-135347118 TCTAGGAGTTTGACTACTCTAGG + Intergenic
1033065509 7:138150069-138150091 TCTACGAATTTGACTGCCCTAGG - Intergenic
1033218457 7:139511473-139511495 TGTATGAATTTGACTACTCTAGG - Intergenic
1033222168 7:139535310-139535332 TCTATGAATTGGACCACTCTAGG - Intronic
1033317963 7:140314175-140314197 TGTATGAATTTGCCTATTCTAGG - Intronic
1033319052 7:140323056-140323078 TCTAAGAACTGGCTCACTCTGGG + Intronic
1033383370 7:140846453-140846475 TCTATGAATTGGACTACTCTAGG - Intronic
1033442384 7:141391735-141391757 TCTATGAATTTGCTGACTCTAGG + Intronic
1034261172 7:149756821-149756843 TCTATGAATCTGACTACTCTAGG - Intergenic
1034530660 7:151694497-151694519 TCTGGGAATCTGGCCACTCTAGG + Intronic
1034545723 7:151787411-151787433 TCTTTGAATCTGACCACTCTAGG + Intronic
1035047335 7:155976841-155976863 TCTATGAATTTGACTATTCTAGG + Intergenic
1035124912 7:156601545-156601567 TCCATGAATATGCCCACACTAGG + Intergenic
1036153851 8:6323909-6323931 TCTATGAATTTGACTACTCTAGG + Intergenic
1036192579 8:6684214-6684236 TCTATGAATTTGACTACTCTAGG - Intergenic
1036395152 8:8363506-8363528 TCTCTGAATTTGACTACTCTAGG - Intronic
1036483299 8:9156444-9156466 TCAATGAATCTGCCCACTTTGGG - Intronic
1036589240 8:10152945-10152967 TCTATGAATTTCACTACTCTAGG - Intronic
1036617713 8:10401844-10401866 TCTATGAATTTGACTACTCTAGG - Intronic
1036666404 8:10745564-10745586 TCTATGAATTTGACCACTCTAGG + Intronic
1036699787 8:11004976-11004998 CCTATGAATTTGACTACTCTTGG - Intronic
1036772810 8:11590781-11590803 TCTATGAATTTGACCCCTCTAGG - Intergenic
1036781733 8:11652390-11652412 TCTATGAATTTGACTACTCCAGG + Intergenic
1036790585 8:11715917-11715939 CTTATGAATTTGACCACTCTAGG + Intronic
1037257222 8:16969125-16969147 TCTATGAATTTGGCTATTCTAGG - Intergenic
1037315206 8:17594068-17594090 TCTATGAGTTTGACAACTCTAGG + Intronic
1037512372 8:19597044-19597066 TCTATAAATGTGACCACTCTAGG + Intronic
1037928071 8:22860431-22860453 TCTATGAATTTGACTCCTCTAGG + Intronic
1038022151 8:23559700-23559722 TCTACAAATTTGACTACTCTAGG + Intronic
1038100042 8:24362980-24363002 TCTCTGAATTTGCCTATTCTAGG + Intergenic
1038189116 8:25302852-25302874 TCTGAGAATTTGACTACTCTAGG - Intronic
1038223006 8:25628492-25628514 TCTATGAATTTGCCTGTTCTAGG - Intergenic
1038313466 8:26463529-26463551 TCTATGAATTTGACTTCTCTAGG + Intronic
1038397895 8:27260562-27260584 TCTATGAATTTGCCTATTCTAGG + Intergenic
1038427748 8:27475486-27475508 TCTATGAATTTGACTATTCTAGG - Intronic
1038602578 8:28961408-28961430 TCTGTGAATTTGACTACTCTAGG + Intronic
1038631724 8:29251551-29251573 TCTATGAATTTGACTACCCTAGG - Intronic
1038657186 8:29464039-29464061 TCTGTGAATTTGCCTATTCTGGG + Intergenic
1038795939 8:30709483-30709505 TCTATGAATTTGCCAATTCTAGG - Intronic
1038938695 8:32280512-32280534 TCTATGAATTTGCCTATTCTAGG - Intronic
1039054074 8:33520835-33520857 TCTACAGATTTGCCTATTCTGGG - Intergenic
1039076168 8:33692399-33692421 TCTACAAATTTGCTTAATCTAGG + Intergenic
1039294546 8:36135698-36135720 TCTACAAATTTGACTACTCTAGG - Intergenic
1039349648 8:36748518-36748540 TCTAAGAATTCGACTACTCTAGG + Intergenic
1039506137 8:38053839-38053861 TCTCTGAATTTGACTACTCTAGG - Intronic
1039721213 8:40166592-40166614 TCTATGAATTTGGCTACTCTAGG - Intergenic
1039901639 8:41756976-41756998 TCTACGAATTTTACTACTATAGG - Intronic
1039931701 8:41996965-41996987 TCTATGAATTTGTCTATTCTAGG - Intronic
1040022070 8:42749801-42749823 TCTATGAATTTGACCACTCTGGG - Intergenic
1040665859 8:49632465-49632487 TCTACGACTTCTCCCACTGTAGG + Intergenic
1040753848 8:50745810-50745832 TCTAAGAATTTGCCTATTCTAGG - Intronic
1040759395 8:50820733-50820755 TCTAAGAATTTGCCAGCTCTGGG - Intergenic
1040856170 8:51950358-51950380 TCTATGAATTTGACTACTCTGGG - Intergenic
1041079723 8:54204640-54204662 TCTATGAATTTGACTACTCCAGG + Intergenic
1041100557 8:54392493-54392515 TCTACGGATTCGACTACTCTGGG + Intergenic
1041206308 8:55501505-55501527 TCTATGAATATGACTACTCTAGG + Intronic
1041220068 8:55641780-55641802 TCTATGAATTTGACTAGTCTAGG + Intergenic
1041253303 8:55955727-55955749 TCTATGAATTTAACCACTCTAGG + Intronic
1041557820 8:59177922-59177944 TCTATGAATTTGACTACTTTGGG + Intergenic
1041688665 8:60667980-60668002 TCTATGAATTTGCCTGCTTTAGG - Intergenic
1041731116 8:61063928-61063950 TCTATGAATTTGCCTATTCTAGG + Intronic
1041847697 8:62350406-62350428 TCTACCAATTTGATTACTCTAGG - Intronic
1041911760 8:63096460-63096482 TCTATGAATTTGCCTATTATAGG + Intergenic
1042220098 8:66464917-66464939 TCTATGAATTTGCCTATCCTAGG + Intronic
1042223457 8:66496005-66496027 TCTATGAATTTGACTACTCTAGG + Intronic
1042266899 8:66917612-66917634 TCTATGAATTTGACTATTCTAGG + Intronic
1042339270 8:67661812-67661834 TCTATGAACTTGACTACTCTGGG + Intronic
1042358013 8:67850634-67850656 TCTACGAATTTGGCTATTCTAGG + Intergenic
1042585690 8:70335645-70335667 TCTATGAATTTGACTACTCTAGG + Intronic
1042811030 8:72825097-72825119 TCTATGAATTTGACTACTCTAGG + Intronic
1042815161 8:72870130-72870152 TCTATGAATGTGACTACTCTAGG - Intronic
1042867636 8:73369623-73369645 TCTATGAATTTACCTATTCTAGG - Intergenic
1042868337 8:73375564-73375586 TCTATGAATTTGCCTATTCTGGG - Intergenic
1042951871 8:74208710-74208732 TCTATGAATTTGCCTATTCTAGG + Intergenic
1042957410 8:74266481-74266503 TCTCTGAATTTGACTACTCTAGG - Intronic
1043141492 8:76595343-76595365 TCTATGAATTTGACTACTCTAGG - Intergenic
1043916806 8:85932352-85932374 TCTATGAATTTGACTACTTTAGG - Intergenic
1043941143 8:86197294-86197316 TCTATGAATTTGACTACTCCAGG - Intergenic
1044348637 8:91136755-91136777 TCTCTGAATTTGACTACTCTAGG + Intronic
1044863008 8:96541634-96541656 TCTATGAATTTGACTACTCTAGG - Intronic
1045014024 8:97983085-97983107 TCTGTGAATTTCACCACTCTCGG + Intronic
1045015606 8:97999045-97999067 TCTATGAATTTGACTATTCTAGG + Intronic
1045180175 8:99772407-99772429 TTTATGAATTTGACTACTCTTGG - Intronic
1045394943 8:101751277-101751299 TCTAAGAATTTGCCCATTCTAGG - Intronic
1045429551 8:102100841-102100863 TCTATGAATTTGACTACTCTAGG - Intronic
1047014404 8:120708177-120708199 TCTAGGAATTTGTGCACTCCAGG - Intronic
1047433864 8:124817950-124817972 GCTATGAATTTGACTACTCTAGG + Intergenic
1047719056 8:127621727-127621749 TCTACGAATTTGACTAGTCTAGG - Intergenic
1047794758 8:128243112-128243134 TCTATGAATTTGACTACTCTAGG + Intergenic
1048002547 8:130391216-130391238 TGTATGAATTTGACTACTCTAGG - Intronic
1048021069 8:130539613-130539635 TCTATGAACTTGACTACTCTAGG - Intergenic
1048050721 8:130813435-130813457 TCTATGAATTTGACCACTCTAGG + Intronic
1048330636 8:133468406-133468428 TCTATGAATTTGACTACTCTAGG - Intronic
1048365133 8:133731880-133731902 TCTAGGAATTGGCCAGCTCTGGG + Intergenic
1048614312 8:136057666-136057688 TCTATGAATTTTACCACTCTAGG - Intergenic
1049295421 8:141831483-141831505 TCTGCGAATTGGCCCATTCTGGG + Intergenic
1049841052 8:144772251-144772273 TCTTTGAATTTGCCTATTCTAGG - Intergenic
1049894270 9:99131-99153 TCCACGATTTTGACTACTCTAGG - Intergenic
1049916598 9:323712-323734 TCTATGAATTTTACTACTCTAGG + Intronic
1050002597 9:1094192-1094214 TCTACGGATTTGACTGCTCTAGG + Intergenic
1050412011 9:5376129-5376151 TCTATTAATTTGACTACTCTAGG - Intronic
1050785789 9:9399879-9399901 TCTACTAAATTACCCAGTCTTGG + Intronic
1050837682 9:10104105-10104127 TCTATGACTTTGACTACTCTGGG - Intronic
1051435939 9:17031827-17031849 TCTATGAATTTGACTACTGTAGG + Intergenic
1051464143 9:17357058-17357080 TCTATGGATTTGCCTATTCTAGG + Intronic
1051485427 9:17603423-17603445 TCTATGAATTTGACTACTCTAGG - Intronic
1051812967 9:21071393-21071415 TCTATGAATTTGACTACTCTTGG - Intergenic
1052041956 9:23748917-23748939 TCTATGAATTTGCCTATTCTCGG - Intronic
1052869549 9:33490373-33490395 TGTATGAATTTGCCTATTCTAGG + Intergenic
1053030720 9:34775328-34775350 TCTATGAATTTGGCTATTCTAGG - Intergenic
1053254193 9:36601772-36601794 TCTATGAATTTGACTAATCTAGG + Intronic
1053398420 9:37796764-37796786 TCTGTGAATTTGACGACTCTAGG + Intronic
1053448790 9:38175250-38175272 TCTGTGAATTTGCCTATTCTAGG - Intergenic
1053525233 9:38823202-38823224 TCTGTAAATTTGCCTACTCTAGG + Intergenic
1053548172 9:39045633-39045655 TCTATGAATTTGATTACTCTGGG + Intergenic
1053566260 9:39255800-39255822 TCTATGAATTTGACTACTCTAGG + Intronic
1053832037 9:42093661-42093683 TCTATGAATTTCACTACTCTAGG + Intronic
1054130889 9:61363213-61363235 TCTATGAATTTGACTACTCTAGG - Intergenic
1054197463 9:62047650-62047672 TCTGTAAATTTGCCTACTCTAGG + Intergenic
1054598509 9:67093764-67093786 TCTATGAATTTCACTACTCTAGG - Intergenic
1054640947 9:67541052-67541074 TCTGTAAATTTGCCTACTCTAGG - Intergenic
1054727718 9:68668510-68668532 ACTATGAATTTGTCTACTCTAGG - Intergenic
1054796837 9:69310143-69310165 TCTATGAATTTGACTACTCTAGG + Intergenic
1055182701 9:73407758-73407780 TCTATGAATATGACTACTCTAGG - Intergenic
1055230700 9:74061454-74061476 GCTACCAAATTGCCCACTTTGGG + Intergenic
1055456572 9:76477833-76477855 TCTGCGCATTTGACTACTCTAGG + Intronic
1055576854 9:77668980-77669002 TCTATGAATTTGCCTATTTTAGG - Intergenic
1055636636 9:78285445-78285467 TCTATGAATTTGACTACTCCAGG - Intergenic
1055639330 9:78307244-78307266 TCTGTGAATTTGACTACTCTAGG + Intronic
1056142725 9:83699039-83699061 TCTCTGAATTTGACTACTCTAGG - Intronic
1056147900 9:83752510-83752532 TCTGTGAATTTGCCCATTCTAGG - Intronic
1056616132 9:88167554-88167576 TCTATGAATTTGGCTAATCTTGG - Intergenic
1056736799 9:89216645-89216667 TCTGTGAATTTGACTACTCTTGG - Intergenic
1056882602 9:90412115-90412137 TCTATGAATTTGCCTATTCTAGG - Intergenic
1057048324 9:91902893-91902915 TCTATGCATTTGACCACCCTAGG - Intronic
1057102965 9:92381178-92381200 TCTATGAATTTGACTATTCTAGG + Intronic
1057242580 9:93424371-93424393 TCTATGAATTTGTCAATTCTAGG + Intergenic
1057350223 9:94290449-94290471 TGTATGAATTTGCCTATTCTAGG + Intronic
1057365105 9:94412773-94412795 TCTATGGATTTGCCTATTCTGGG - Intronic
1057384997 9:94599085-94599107 TCTATGAATTTGGCTACACTGGG + Intergenic
1057603689 9:96482334-96482356 TTTATGAATTTGCCTATTCTAGG + Intronic
1057647569 9:96891064-96891086 TCTATGAATTTGCCAATTCTAGG - Intergenic
1057658219 9:96975317-96975339 TCTATGGATTTGCCTATTCTGGG + Intronic
1057825149 9:98367414-98367436 TCTATGAATTTGACTCCTCTAGG - Intronic
1057985258 9:99706888-99706910 TCTACTATTATGCCAACTCTGGG - Intergenic
1058096048 9:100861551-100861573 TCTATAAACTTGCCTACTCTAGG + Intergenic
1058764764 9:108171164-108171186 TCTATGAATTTACCTATTCTAGG - Intergenic
1058884198 9:109310977-109310999 TCTATGAATTTAGCTACTCTAGG - Intronic
1058893793 9:109383008-109383030 TCTATGAATTGGACGACTCTAGG + Intronic
1059163340 9:112055944-112055966 TTTATGAATTTGACTACTCTAGG - Intronic
1059226414 9:112677102-112677124 TCTATGAATTTGACTACTCTAGG + Intergenic
1059289073 9:113205957-113205979 TTTATGAATTTGCCCTTTCTAGG - Intronic
1059789859 9:117629657-117629679 TCTAAGAATGTGGCCACTCAGGG - Intergenic
1060095130 9:120782151-120782173 TCTATGAATTTGACTACTCTAGG - Intronic
1060239344 9:121889575-121889597 TCTATGAATTTGACTACTCTAGG + Intronic
1060251867 9:121993068-121993090 TCTATGAATTTGACTGCTCTAGG - Intronic
1060257530 9:122045834-122045856 TCTATGAATTTGACTACTCTAGG - Intronic
1060360082 9:122947279-122947301 TCTAAGAAATTGACTACTCTAGG - Intronic
1060475208 9:123981686-123981708 TCTATGAATTTGGCTATTCTAGG - Intergenic
1060577864 9:124714179-124714201 TCTATGAATTTGTCTACTCTAGG - Intronic
1061223477 9:129266387-129266409 TCTATGAATTTGACTGCTCTAGG + Intergenic
1061389357 9:130308881-130308903 TCTATGAATTTGACATCTCTAGG - Intronic
1061409530 9:130411746-130411768 TCTATGCTTTTGGCCACTCTAGG - Intronic
1061459498 9:130725286-130725308 TCTATGAATTTGCTCATTCTAGG + Intronic
1061515692 9:131088779-131088801 TCTATGAATTTGACTACTCTGGG + Intronic
1061538247 9:131262831-131262853 TCTATGAATTTGACAACACTAGG - Intronic
1061622665 9:131821855-131821877 TCTATGGATTTGACAACTCTAGG - Intergenic
1061656122 9:132091608-132091630 TCTATGAATTTGACTACTCCAGG - Intergenic
1061660832 9:132129202-132129224 TCTATGAATTTGACTATTCTAGG + Intergenic
1061674011 9:132205397-132205419 TCTATGAATTTGACGACTCTGGG - Intronic
1061782853 9:133006002-133006024 TCGATGAATTTGACTACTCTAGG - Intergenic
1062153800 9:135034737-135034759 TCTGTGAATCTGCCTACTCTGGG + Intergenic
1203688953 Un_GL000214v1:24104-24126 TATACCAATTTTCCCTCTCTTGG + Intergenic
1203713063 Un_KI270742v1:116140-116162 TATACTAATTTTCCCTCTCTTGG - Intergenic
1203633411 Un_KI270750v1:90951-90973 TCTATGGATTTGACTACTCTAGG + Intergenic
1203647322 Un_KI270751v1:79949-79971 TATACCAATTTTCCCTCTCTTGG - Intergenic
1185564107 X:1083014-1083036 TCTACAAATTTGACGACTCTAGG - Intergenic
1185950177 X:4423530-4423552 TCTATGAATTTGAGCATTCTAGG + Intergenic
1186193911 X:7093206-7093228 TCTATGGATTTGACAACTCTAGG + Intronic
1186261485 X:7784716-7784738 TCTATGGATTTGACTACTCTAGG - Intergenic
1186413742 X:9365432-9365454 TCTACGGATTTGACTTCTCTGGG + Intergenic
1186519262 X:10191239-10191261 TCTATGGATTTGCCTATTCTGGG + Intronic
1187178824 X:16923011-16923033 TCTATGAATTTGACTACTCTAGG + Intergenic
1187379143 X:18784602-18784624 TCTACGAATTTCACCACTCTAGG + Intronic
1187381951 X:18810579-18810601 TCTATGGATTTGCCTATTCTCGG + Intronic
1187600410 X:20823432-20823454 TCTATGATTTTGACTACTCTGGG - Intergenic
1187758451 X:22552235-22552257 TCCATGAATTTGACCACTCGAGG - Intergenic
1187777418 X:22777701-22777723 TTTATGAATTTGACTACTCTAGG + Intergenic
1187901001 X:24026208-24026230 TTTATGAATTTTCCCACCCTTGG - Intronic
1187947548 X:24441171-24441193 TCTATGAATTTGACTACTCTAGG + Intergenic
1188011537 X:25061361-25061383 TCTATGGATTTGACTACTCTAGG + Intergenic
1188290895 X:28387451-28387473 TCTATAAATTTGACAACTCTAGG - Intergenic
1188346680 X:29075475-29075497 ACTACTTAATTGCCCACTCTTGG + Intronic
1188374749 X:29414129-29414151 TCTATGAATTTGCCTATTCTAGG - Intronic
1188435829 X:30157513-30157535 TCTATGAATTTGACTACTCTAGG - Intergenic
1188623454 X:32255043-32255065 TCTAAGAATTTAACTACTCTAGG + Intronic
1188712913 X:33424071-33424093 TCTATGATTTTGACTACTCTGGG - Intergenic
1188867954 X:35337914-35337936 TCTGTGAATTTGACTACTCTAGG + Intergenic
1188912752 X:35869971-35869993 TTTATGAATTTGACTACTCTAGG + Intergenic
1188993266 X:36850675-36850697 TCTATGAATTCGACAACTCTAGG + Intergenic
1189345264 X:40236258-40236280 TCTATAAATTTGCCTATTCTAGG + Intergenic
1189425150 X:40893270-40893292 TCTATGAATTTGACTACTCTAGG + Intergenic
1189504747 X:41601039-41601061 CCTATGAATTTGACTACTCTAGG - Intronic
1189685418 X:43559195-43559217 TTTATGAATTTGCCTATTCTAGG - Intergenic
1189791502 X:44609672-44609694 TTTATGAATTTGACTACTCTTGG - Intergenic
1190012250 X:46795474-46795496 TCTATGAATTTGACTACTCTAGG + Intergenic
1190052943 X:47165055-47165077 TCAATGAATTTGCCTATTCTAGG - Intronic
1190211815 X:48454962-48454984 CCTACGGATTTGCCTATTCTTGG - Intergenic
1190796729 X:53752267-53752289 TCTATGAATTTGACTAATCTAGG + Intergenic
1190843078 X:54164460-54164482 TCTATGAATTTGACTACTTTAGG + Intronic
1190859880 X:54334416-54334438 TCTATGAATTTGCTTATTCTAGG + Intronic
1191709181 X:64130684-64130706 TTTATGAATTTGCCCATTTTAGG - Intergenic
1191721683 X:64235140-64235162 TCTATGAATTTGCCTATTCTAGG + Intergenic
1191999600 X:67134717-67134739 TCTATGAATTTGACTACTCTAGG + Intergenic
1192268059 X:69553943-69553965 TCTGTGAATTTGACTACTCTAGG - Intergenic
1192331727 X:70180747-70180769 TCTATGAATTTGCCTATTCTAGG + Intronic
1192374020 X:70540810-70540832 TCTATGAATTTGACCACTCTGGG + Intronic
1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG + Intronic
1192475514 X:71438318-71438340 TCTATGAAATTGCCTATTCTAGG + Intronic
1192626989 X:72739094-72739116 TCTATGAATTTTCCTATTCTAGG + Intergenic
1192780397 X:74288363-74288385 TCTGCCAATTAGCCCACTCCTGG + Intergenic
1193098118 X:77576820-77576842 TCTACAAATTTCACTACTCTAGG + Intronic
1193104561 X:77655075-77655097 TCTATGAATTTTACTACTCTAGG - Intronic
1193108865 X:77707152-77707174 CCTAGGAATTTGACTACTCTAGG - Intronic
1193120794 X:77821015-77821037 CCTATGAATTTGACTACTCTAGG + Intergenic
1193125029 X:77861840-77861862 TCTATGAATTTGACTACTCTAGG - Intronic
1193131025 X:77919974-77919996 TCTATGAATTTACCTATTCTAGG + Intronic
1193730910 X:85101957-85101979 TCTACAAATTTGTCTATTCTAGG - Intronic
1193913609 X:87337795-87337817 TCTAAGAATTTGATTACTCTAGG - Intergenic
1194480598 X:94417428-94417450 TCAATAAATTTGACCACTCTAGG + Intergenic
1194702412 X:97130544-97130566 TCTACAAATTTGACTATTCTAGG - Intronic
1194910498 X:99637034-99637056 TCTATGAATTTGACTACTTTGGG - Intergenic
1194948631 X:100098159-100098181 TTTATGAATTTGACTACTCTAGG - Intergenic
1195019780 X:100815487-100815509 TCTATGAATTTGACTACTCTAGG - Intergenic
1195053062 X:101115857-101115879 TCTATGAATTTGCCTATTCTAGG + Intronic
1195072938 X:101298425-101298447 TCTATGAATTTGCCTATTATAGG + Intergenic
1195280225 X:103326102-103326124 TCTATGAATTTGACTACTCTAGG + Intergenic
1195304680 X:103569296-103569318 TCTATGAATTTGACTACTCTAGG - Intergenic
1195921077 X:109984421-109984443 TCTATGCATTTGACTACTCTAGG - Intergenic
1195950056 X:110260978-110261000 GCTATGAATTTGACTACTCTAGG - Intronic
1196036781 X:111154081-111154103 TCTATGAATTTGACTCCTCTAGG - Intronic
1196121132 X:112051825-112051847 TCTATGAATTTGGCAACACTGGG + Intronic
1196682130 X:118480010-118480032 TCTATAAATTTGCCTATTCTGGG + Intergenic
1196756687 X:119163542-119163564 TCTATGAATTTGAGCACTCTAGG - Intergenic
1196871150 X:120115005-120115027 TCTATGATTTTGACTACTCTAGG - Intronic
1197220104 X:123904047-123904069 TCTATAAATTTGACTACTCTAGG + Intronic
1197799335 X:130333375-130333397 TCTATGAATTTGCCTATTCTTGG - Intergenic
1198037069 X:132811519-132811541 TCTATGAATATGACTACTCTAGG + Intronic
1198101807 X:133428533-133428555 TCTATCAATTTGCCTATTCTAGG + Intergenic
1198231069 X:134690066-134690088 TCTATAAATTTGACTACTCTAGG + Intronic
1198309456 X:135416007-135416029 TCAATGAATTTGACTACTCTAGG - Intergenic
1198558021 X:137816671-137816693 TCTATGAATTGGACTACTCTTGG + Intergenic
1198690714 X:139281490-139281512 TCTATGAATTTGACTACACTAGG + Intergenic
1198857658 X:141034529-141034551 TTTTGGAAATTGCCCACTCTTGG + Intergenic
1198905040 X:141552842-141552864 TTTTGGAAATTGCCCACTCTTGG - Intergenic
1199548983 X:149037730-149037752 TCTATGACTTTGACTACTCTAGG - Intergenic
1199723404 X:150559407-150559429 TCTATGAATTTGACTACTCTAGG + Intergenic
1199726715 X:150590389-150590411 CCTATAAATTTGCCCACTTTGGG - Intronic
1199749356 X:150800165-150800187 TCTAAGAATTTGCCCATTCTAGG - Intronic
1199754083 X:150848331-150848353 TCTGTGAATTTGACTACTCTAGG - Intronic
1200006093 X:153085322-153085344 TCTATGGATTTGACCACTCTAGG + Intergenic
1200082252 X:153583503-153583525 TCTATGGATTTGACCACTCTAGG + Intergenic
1200179538 X:154141814-154141836 TCTATGGATTTGACCACTCTAGG + Intergenic
1200733140 Y:6764154-6764176 TCTACAAACTTGCCTATTCTAGG - Intergenic
1201224679 Y:11807413-11807435 TCTATGAATTTTCCTATTCTAGG - Intergenic
1201508256 Y:14728694-14728716 TCTATGAATTTGACAACTCTAGG - Intronic
1201565870 Y:15364885-15364907 TCTATGGATTTGACAACTCTAGG + Intergenic
1201682058 Y:16657208-16657230 TCTATGAATTTTACTACTCTGGG - Intergenic
1201968490 Y:19765413-19765435 TCTATGAATTTGCCTGCTCTGGG - Intergenic
1202590597 Y:26479415-26479437 TCTATGAATTTGCCTATTCTAGG - Intergenic