ID: 1111861636

View in Genome Browser
Species Human (GRCh38)
Location 13:93714730-93714752
Sequence GCTTCTCCACAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111861634_1111861636 -1 Left 1111861634 13:93714708-93714730 CCAAAGTAAAGTTTATTGGAGTG 0: 1
1: 0
2: 0
3: 16
4: 132
Right 1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG 0: 1
1: 0
2: 2
3: 30
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111861636 Original CRISPR GCTTCTCCACAGATGGAGCA AGG Intronic
900345514 1:2208550-2208572 GCTGCCCCACAGATGCTGCAGGG - Intronic
900506906 1:3033948-3033970 GCTGCAGCACAGATGGAGGATGG + Intergenic
900742940 1:4341781-4341803 GCTTCCCCAGGGCTGGAGCATGG - Intergenic
903231856 1:21927098-21927120 GCTTCTCCACGGGTGGGGCTGGG - Intronic
904469178 1:30725489-30725511 TCTTCTCCAGAGATGCTGCAAGG + Intergenic
906493468 1:46286051-46286073 GCCTCTCCACAGAGGCGGCAGGG + Exonic
907902900 1:58757417-58757439 GCTGCGACACAGGTGGAGCATGG - Intergenic
907965342 1:59323429-59323451 GATTCTCCTCAGATGGAGTATGG + Intronic
909303069 1:74038110-74038132 GCTTTTCCCCTGATGGAGCCAGG + Intronic
909830261 1:80180009-80180031 CCTTCTTAACTGATGGAGCAAGG - Intergenic
910309805 1:85810451-85810473 GCTGCTCCATAGATAGAGCAGGG - Intronic
911109404 1:94166499-94166521 GGTTCTCCACATATGGTGAAAGG + Intronic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
913373736 1:118129094-118129116 GCTCCTACACAGATGAAGGAAGG + Intronic
914437465 1:147672371-147672393 GCTACTCCATAGACAGAGCAGGG - Intergenic
914991791 1:152505148-152505170 GCATCTCCATAGCTGGAGCCTGG - Intergenic
915111435 1:153566633-153566655 GCTACTCGACAGCTGGAGCAGGG - Intronic
917224338 1:172765548-172765570 GCTTGTCCACTGAAGCAGCATGG + Intergenic
917465137 1:175269628-175269650 GCTACTCCATAGACAGAGCAGGG - Intergenic
919506931 1:198410610-198410632 GCTTCTCAACAGCTGGGGAAGGG + Intergenic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
921853835 1:219959378-219959400 GTTTCTGCACACACGGAGCATGG - Intergenic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
922757796 1:228106147-228106169 GCCTCTGGACAGATGAAGCAGGG + Intergenic
924870917 1:248043744-248043766 GCTACTCCACAGACAGAGTAGGG + Intronic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1064373941 10:14778707-14778729 GCTGCTCCACAGGCAGAGCAGGG + Intergenic
1069753081 10:70757297-70757319 TCTTCTTCCCTGATGGAGCAGGG - Intronic
1070546038 10:77453412-77453434 GATTCTCCAAAGAAGTAGCATGG + Intronic
1070606455 10:77901768-77901790 GCTGCTCCACCGTTGGAGCCGGG - Intronic
1076032814 10:127173988-127174010 GCCTCTCCACTGCTGGAGCTGGG + Intronic
1079965577 11:26976193-26976215 GCTACTCCATAGACAGAGCAGGG + Intergenic
1081351933 11:42064739-42064761 GCTACTCCATAGATAGAGTAGGG - Intergenic
1082634872 11:55583586-55583608 GGTCCTCCACAGAGGGGGCATGG - Intergenic
1084022831 11:66428013-66428035 GTTTCTCCACAAGTGAAGCAGGG + Intergenic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1087049005 11:93867691-93867713 GGTCCTCCACAGAAGGGGCATGG + Intergenic
1088650672 11:111955401-111955423 GCTGATCCAGAGCTGGAGCAGGG + Intronic
1088667503 11:112108181-112108203 GCTTATCCACAAATGGGTCATGG + Intronic
1089124574 11:116167787-116167809 CCTTCGGCTCAGATGGAGCAGGG - Intergenic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1089740195 11:120577179-120577201 GCCTCTCCACATATGCACCAAGG - Intronic
1092074985 12:5665583-5665605 GCTTCTCCCCACCTGGAGCCAGG + Intronic
1093025194 12:14239426-14239448 GCTTCACCAGGGAGGGAGCACGG + Intergenic
1093035862 12:14332026-14332048 GGTTCTCCACATATGGTCCATGG - Intergenic
1093049289 12:14487870-14487892 GGTTCTCCACATATGGTCCAAGG + Intronic
1093050038 12:14493970-14493992 GGTTCTCCACATATGGTCCAAGG + Intronic
1096188067 12:49596421-49596443 GCTGCTCCACAGACAGAGCAGGG - Intronic
1099232088 12:80038742-80038764 TCTCCTCCACACATCGAGCATGG - Intergenic
1099463307 12:82950669-82950691 GCTTCTCCTGAGATTGAACATGG - Intronic
1099799468 12:87439691-87439713 GCTACTCCATAGATAGAGCAGGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101043454 12:100780345-100780367 GCTGCTCCACAGACAGAGCAGGG + Intronic
1101284072 12:103291486-103291508 ACTGCTCCACAGACAGAGCAGGG + Intronic
1103138176 12:118525970-118525992 GCTACTCCACAGGTGGAGGCAGG - Intergenic
1103458418 12:121085453-121085475 GCTGTTCCACAGACAGAGCAGGG - Intergenic
1104361277 12:128135521-128135543 GATTTTTCACAGATGAAGCAGGG - Intergenic
1104671643 12:130684845-130684867 GCTACTCCATAGACGGAGCAGGG - Intronic
1105570576 13:21599119-21599141 GTTTCTCCACTGATGGAGGTGGG - Intronic
1108917760 13:55636737-55636759 GCTCCTCCACAGACAGAACATGG + Intergenic
1110866262 13:80399249-80399271 CCTTCTCCACAAAAGGAGAAAGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1113274425 13:108712718-108712740 GGTTCTTACCAGATGGAGCAGGG - Exonic
1113357224 13:109592406-109592428 GCTACTCCAAAGATGCAACAAGG + Intergenic
1113574608 13:111385734-111385756 GCTCCTCAACAGAGGGAGGAGGG + Intergenic
1113581218 13:111430882-111430904 GTGTCTCCCCAGATGGAACAAGG + Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1117633726 14:57721345-57721367 GCTTCTCCACATATGGTCAAAGG - Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1118760509 14:68878103-68878125 GCGTCACCTCACATGGAGCATGG - Intronic
1122426060 14:101606227-101606249 GCTCATCCACAGATGGGACATGG + Intergenic
1122867358 14:104613268-104613290 TCTCCTCCACAGAGGGAGCTGGG - Intergenic
1123587030 15:21769930-21769952 GCTTCTCCCCACCTGGAGCCAGG - Intergenic
1123623668 15:22212495-22212517 GCTTCTCCCCACCTGGAGCCAGG - Intergenic
1125106583 15:35978901-35978923 GCTACTCCACAGACAGAGCAGGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126688157 15:51266259-51266281 GCATCTCCACGGACAGAGCAGGG + Intronic
1129255811 15:74333354-74333376 GCATCTTCAGAGGTGGAGCAGGG - Intronic
1129957596 15:79653701-79653723 GTTTCTTCACCTATGGAGCAGGG - Intergenic
1130573007 15:85065750-85065772 GCTTCTGAAGGGATGGAGCACGG + Intronic
1131040242 15:89257864-89257886 CATTCTCCACACAAGGAGCAAGG + Intronic
1131193837 15:90339212-90339234 GCTACTCCAGAGATGGAGGCAGG + Intergenic
1131631770 15:94184759-94184781 GCTTATTCACAGATGGGTCACGG + Intergenic
1132032118 15:98446852-98446874 GTTTTTCCACGGATGGGGCAGGG - Intronic
1132543365 16:521705-521727 GCTTCTCCACAGGTGCGGCCTGG + Exonic
1133434887 16:5770566-5770588 GCTGCTCCACAGAAATAGCAGGG - Intergenic
1136177144 16:28524981-28525003 GCTGTTCCACAGACAGAGCAGGG - Intergenic
1136481588 16:30545371-30545393 GGTCCTCCACAGAGGGGGCATGG + Intronic
1137540817 16:49360413-49360435 TCATCACCACAGCTGGAGCAGGG - Intergenic
1137586038 16:49664502-49664524 GATTCTACAGAGATGGAGGAGGG + Intronic
1144097251 17:11911266-11911288 TCTTTTCAACAAATGGAGCAGGG - Intronic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1147839380 17:43360088-43360110 GCTACTCCACAGACAGAGAAGGG + Intergenic
1148853986 17:50568760-50568782 GCTTAGCCTCAGATGGAGCCAGG + Intronic
1149602037 17:57899296-57899318 GCTGCTACACAGGCGGAGCAGGG - Intronic
1149978624 17:61291242-61291264 GTTTCTCCAGAGTTGGAGCCTGG - Intronic
1150375339 17:64676714-64676736 GCATCTCCAGGGATGGAGCCTGG + Intergenic
1151509912 17:74552004-74552026 GCTTCTCCTCAGATGGGCCTGGG + Intergenic
1154086334 18:11309103-11309125 GCCACTCCACAGACAGAGCAGGG + Intergenic
1154164440 18:12003889-12003911 GCTGCTCCACAGAAGGGACAAGG - Intronic
1155728273 18:29117501-29117523 GCTGCTCCACAGACAGAGCAGGG + Intergenic
1156110546 18:33720690-33720712 GCTTCTCCACAATTAGAGAAGGG - Intronic
1157275020 18:46304232-46304254 CCCTCCCCACAGCTGGAGCAAGG - Intergenic
1157388916 18:47284681-47284703 GCTGCTCCACAGACAGAGCAGGG + Intergenic
1158033738 18:52999448-52999470 GCTTCTGTGCGGATGGAGCATGG + Intronic
1158277213 18:55781130-55781152 CCCTCTCCCCAGATGGGGCAGGG + Intergenic
1158339262 18:56447971-56447993 GCTTCTCCTCTGATGTAGCCAGG + Intergenic
1160307117 18:77750255-77750277 GCTTCTGCACAGATGTGGAAAGG + Intergenic
1161981783 19:7633765-7633787 GCATCCCCACAGTTGGAGAAGGG + Intronic
1163030845 19:14543162-14543184 GCTTCTCCCCACAAGGAGCCTGG - Intronic
1167154563 19:47730204-47730226 GCTTTTCCAGAGAGGAAGCAGGG - Intronic
1168610845 19:57798409-57798431 GCTGCTCCACAGACAGAGCAGGG + Intronic
1168617138 19:57847726-57847748 GCTGCTCCACAGACAGAGCAGGG - Intronic
925433204 2:3814887-3814909 GCTTTTCCCCTGATGGAGCCAGG - Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
928768646 2:34677951-34677973 GCTTCCACTCAGATGGAGTAGGG - Intergenic
929038735 2:37722554-37722576 GCATCTCTACTGGTGGAGCAAGG + Intronic
929828371 2:45328255-45328277 GCTGCTCCACAGACAGGGCAGGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934496422 2:94804825-94804847 GCTACAGCACAGATGCAGCATGG + Intergenic
936134703 2:109880101-109880123 GCTACTCCATAGACAGAGCAGGG - Intergenic
936209994 2:110491384-110491406 GCTACTCCATAGACAGAGCAGGG + Intergenic
936429187 2:112446639-112446661 GCTACTCCACAGACAGAGCAGGG + Intergenic
936689906 2:114874227-114874249 GCTTATTCACAAATGGATCACGG - Intronic
937904544 2:127046435-127046457 GCTTCTTGCCAGAGGGAGCAGGG - Intergenic
937963699 2:127484512-127484534 ACTTCCCCATAGGTGGAGCAGGG - Intronic
938707889 2:133949433-133949455 ACTTCTCCAAGGAGGGAGCATGG + Intergenic
939424233 2:142014135-142014157 GCTACTCCACAGACGGAGTAGGG - Intronic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
943997529 2:194789105-194789127 GCTACTCCATAGAAAGAGCAGGG + Intergenic
944515913 2:200511441-200511463 CCTTCTGCAGAGATGGAGGAAGG + Intronic
947480108 2:230491511-230491533 GCTTCTCCTCTGCTGGAGCCAGG - Intronic
948642294 2:239383391-239383413 GCCTCTCGGGAGATGGAGCAGGG + Intronic
948643637 2:239390611-239390633 GCTCCTCCACAGGTGGAGGGTGG - Intronic
1170618877 20:17977477-17977499 GCTACTCCATAGACAGAGCAGGG + Intronic
1170674911 20:18470039-18470061 GTTTCTGGACAGATGGAGAATGG - Intronic
1170723826 20:18908070-18908092 GCTACTCCACAGACAGAGCAGGG - Intergenic
1171013527 20:21521572-21521594 GCTTCTCCTCAGACGGAACTGGG - Intergenic
1171887736 20:30671586-30671608 GCTACAGCACAGATGTAGCATGG + Intergenic
1173532028 20:43777266-43777288 TCTTCTCCCCAGATGTAGCAGGG - Intergenic
1174145970 20:48452825-48452847 GCTTCTTTTCAGAAGGAGCAGGG - Intergenic
1175898542 20:62350959-62350981 GCTTCTCCGCAGAATGAGCCCGG + Intronic
1177062100 21:16388755-16388777 GCTACTCCATAGATAGAGTAGGG + Intergenic
1178421266 21:32445315-32445337 GCTTATCCACAGATGTGGAATGG - Intronic
1178474842 21:32928743-32928765 GCTTGCCCCCAGATGGAGCTTGG - Intergenic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1181595164 22:23909501-23909523 GCTGCTCCACAGACAGAGCAGGG + Intergenic
1181622499 22:24100659-24100681 GCTTCTCCTCAGCTGTACCAGGG - Intronic
1182424855 22:30266563-30266585 GCATCTCCACAGGTAGAGAAGGG - Intronic
1182644707 22:31798839-31798861 GCTACTCCATAGAAAGAGCAGGG + Intronic
1183560298 22:38567741-38567763 GCTTCTCTAGAGATTGAGGAAGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184858302 22:47158514-47158536 GGTTCTTCACACATGGATCACGG + Intronic
949126047 3:446158-446180 GCTTCTCCACAAATGGTCAAAGG + Intergenic
949602389 3:5614195-5614217 ACTGTTCCACAGATAGAGCAGGG - Intergenic
950705269 3:14775571-14775593 GCTGCTCCATAGACAGAGCAGGG + Intergenic
951959371 3:28299414-28299436 GCTTCTCTCTAGATGGATCATGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
957050124 3:75405209-75405231 GCTTATCCACAGATGCGGGACGG + Intergenic
958421976 3:93940137-93940159 GGTTCTGCACAGATGGGACATGG - Intronic
959378408 3:105612932-105612954 GTTTCTCCAGAGATGGGGCTGGG - Intergenic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
964856267 3:161149335-161149357 GCTACTCCATAGATAGAGCGGGG - Intronic
965872214 3:173276848-173276870 GGTCCTCCACAGAGGGGGCATGG - Intergenic
968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG + Intronic
969146187 4:5125988-5126010 GCTTCTCAACAAATGGTGCCAGG - Intronic
969809260 4:9635219-9635241 GCAGCCCCACAGATGGAGTAGGG - Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
971314990 4:25560231-25560253 GCTACTCCAGAGGTGGAGCCAGG + Intergenic
972900789 4:43680606-43680628 TCTTTTTCACAGTTGGAGCACGG + Intergenic
974574302 4:63698138-63698160 GCTACTCCATAGACAGAGCAGGG - Intergenic
976846409 4:89493174-89493196 GCTACTCCATAGACAGAGCAGGG + Intergenic
977475222 4:97498955-97498977 GCTTCTTGAGAGATGGGGCAAGG - Intronic
979063895 4:116102182-116102204 GTTTATCCATAGATTGAGCATGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
981111607 4:140940857-140940879 GCTGCTCCATAGACAGAGCAGGG - Intronic
982497637 4:156110630-156110652 GCCTCACCTCAGATGGAGGAGGG + Intergenic
985698485 5:1356671-1356693 GCTGCTCCACAGACAGAGCAGGG + Intergenic
986146123 5:5079422-5079444 GCTACTCCATAGGTAGAGCAGGG + Intergenic
986680715 5:10230922-10230944 GCATCCGCACAGATGGAGCCTGG - Intronic
986959452 5:13196199-13196221 GGTTCTCCACATATGGTGAAAGG - Intergenic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987848222 5:23315652-23315674 GCTACTCCATAGACAGAGCAGGG - Intergenic
988107381 5:26769473-26769495 GGTTCTCCACATATGGTGAAAGG - Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
989638967 5:43564998-43565020 GCTACTCCATAGACAGAGCAGGG - Intergenic
989641138 5:43584524-43584546 GCTGCTCCATAGATAGAGCAGGG - Intergenic
989641928 5:43590941-43590963 GCTGCTCCATAGACAGAGCAGGG - Intergenic
989775953 5:45207003-45207025 GCTTCCACTCAGATGGAGCGGGG - Intergenic
989961220 5:50417817-50417839 GCTTCTACACAAATGAAGCCAGG + Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991945740 5:71897129-71897151 GCTTCTCCACATATGGTCAAAGG - Intergenic
992770432 5:80042321-80042343 GCTGATCCACAGATGAAGAACGG - Intronic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
993634965 5:90332141-90332163 GCTTCTCCAAAGAGGGAGAAGGG - Intergenic
993720195 5:91314633-91314655 GATTCTCTACACTTGGAGCATGG - Intergenic
998477376 5:142433140-142433162 GCATCTCCACACCTGCAGCATGG - Intergenic
999942413 5:156558294-156558316 TCTTCTCCACCAATGGAGGAAGG - Intronic
1000317624 5:160108155-160108177 GCTTCTCCATAGACAGAGCAGGG + Intronic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003945443 6:11071317-11071339 GCATTTCCATAGATGGAGAAAGG - Intergenic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1006343709 6:33462734-33462756 GCTGCTCCATAGACAGAGCAGGG - Intergenic
1007779567 6:44245195-44245217 TCTGCTCCAGAAATGGAGCAGGG - Intergenic
1008308848 6:49940026-49940048 GCTGCTCCATAGACAGAGCAGGG + Intergenic
1011629469 6:89310319-89310341 GCTTCTCCACAGCTGCAGACAGG + Intronic
1012721402 6:102750749-102750771 GCTGCTCCATAGACAGAGCAGGG - Intergenic
1013145743 6:107389713-107389735 CCCTCTCCACAGACAGAGCAAGG - Intronic
1013213494 6:108007163-108007185 GCTACTCCACAGACAGAGTAGGG - Intergenic
1013333649 6:109133219-109133241 GTTTTTCCACAGATGCGGCAGGG + Intronic
1015220354 6:130797188-130797210 GCTGCTCCACAGACAAAGCAGGG + Intergenic
1015352686 6:132241335-132241357 GCTTCTTCACAAATGAAGCCTGG + Intergenic
1019307350 7:342107-342129 GCTGCTCCACAGCTGGGGCCAGG - Intergenic
1019990809 7:4689335-4689357 GCCTCTCAGCAGATGGAGCATGG - Intronic
1021981371 7:26058804-26058826 GCCTTTCCCCAGATGCAGCATGG - Intergenic
1024817953 7:53293552-53293574 GATTCTCCACGGATGTATCAAGG - Intergenic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029421576 7:100474583-100474605 CCTTCTCCAGAGCTGGAGGAGGG - Intronic
1029960846 7:104688146-104688168 GGTTCTCCACAGATGGTCAAAGG - Intronic
1030221360 7:107102449-107102471 GCTGCTCCATAGACAGAGCAGGG - Intronic
1032185021 7:129717327-129717349 GCTTCTCAGGAGATGCAGCAGGG + Exonic
1032421767 7:131786102-131786124 GCTGCTCCACAGACAGAGGAGGG + Intergenic
1033351204 7:140563585-140563607 GCCTTTCTACAGAGGGAGCAAGG + Intronic
1034169492 7:149052003-149052025 GGTTCTCCACATATGGTGAAAGG - Intergenic
1034180949 7:149137329-149137351 GCTTCCCCTCAGATTGAGAAAGG - Intronic
1035131129 7:156654677-156654699 TCTTCTTTACAGATGGGGCATGG - Exonic
1036386345 8:8285117-8285139 GCTTCTCCCCCGCTGGAGCCTGG + Intergenic
1036646207 8:10612565-10612587 GCCTATGCATAGATGGAGCAGGG - Exonic
1038032823 8:23659534-23659556 GCTTCTTCACAGATGCTGGAAGG + Intergenic
1038671063 8:29583436-29583458 ACTTCTCCACAAATGGCCCAGGG - Intergenic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1039351385 8:36767458-36767480 GCTACTCCAGAGATGGAGGCAGG - Intergenic
1039883809 8:41644314-41644336 GCATCTTCACAGATGGAGGGTGG + Intergenic
1039994213 8:42517616-42517638 GCTCCTCAACAGAAGGACCATGG - Intronic
1040033261 8:42844857-42844879 GCTACTCCACAGACAGAGTAGGG - Intergenic
1041350637 8:56944835-56944857 GCTGCTCCATAGACAGAGCAGGG + Intergenic
1041670055 8:60482925-60482947 GTTCCTCCACACATGGTGCATGG - Intergenic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1043754455 8:83985629-83985651 GCTACTCCATAGACAGAGCAGGG + Intergenic
1044776288 8:95692460-95692482 GCTCCTCCTCAAATGGAGCTTGG + Intergenic
1045290321 8:100827326-100827348 GCTTCTCCAAAGACGGAGTTTGG + Intergenic
1046714618 8:117554005-117554027 GGTTCTCCAAATATGGACCATGG + Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1049846170 8:144802891-144802913 GCTCCTCCACAGAGGGACCCTGG + Exonic
1050337702 9:4605440-4605462 CCTGCTCAACAGATGGAACAGGG + Exonic
1050897004 9:10896069-10896091 GCTACTCCACAGACAGAGTAGGG - Intergenic
1052565176 9:30140657-30140679 GCTGCTCCACAGACAAAGCAGGG - Intergenic
1053660723 9:40275622-40275644 GCTGCAGCACAGATGCAGCATGG - Intronic
1053911100 9:42904967-42904989 GCTGCAGCACAGATGCAGCATGG - Intergenic
1054372846 9:64421838-64421860 GCTGCAGCACAGATGCAGCATGG - Intergenic
1054523887 9:66100662-66100684 GCTGCAACACAGATGCAGCATGG + Intergenic
1054680473 9:67911615-67911637 GCTGCAGCACAGATGCAGCATGG - Intergenic
1054809268 9:69421959-69421981 GCTTCTCCCCAGCTGGAGGAAGG + Intergenic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1057023982 9:91722179-91722201 ACTGCACCACAGATAGAGCAGGG + Intronic
1058723327 9:107778577-107778599 CCTTCTCCAAAGATGGAACCAGG + Intergenic
1058981084 9:110171306-110171328 CCTTATCCACACACGGAGCATGG - Exonic
1062244010 9:135554065-135554087 GGTTCACAGCAGATGGAGCAAGG - Intergenic
1062606465 9:137350846-137350868 GCATCTCCAGGGAGGGAGCAGGG - Intronic
1186011701 X:5141864-5141886 GCTACTCCATAGACAGAGCAGGG + Intergenic
1186154110 X:6707896-6707918 GCTTCTCCACAGTTGCTACAAGG - Intergenic
1186161687 X:6783356-6783378 GCTACTCCATAGACAGAGCAGGG - Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186890577 X:13955568-13955590 ACTTCTCCAGAGAAGGAGCTGGG - Intergenic
1188552673 X:31379838-31379860 GGTCCTCCACAGATGGGACATGG - Intronic
1189072835 X:37883018-37883040 GCTAGTCCATAGATGGAGCAGGG + Intronic
1189205688 X:39236762-39236784 GCTTCTGGAAAGATGGAGAAAGG + Intergenic
1190877381 X:54469779-54469801 ACTTCTCAACAGCTGGAGGAGGG - Intronic
1191925311 X:66302844-66302866 GCTTCTCCATACACAGAGCAGGG + Intergenic
1192084480 X:68082666-68082688 GTTGTTCCACATATGGAGCATGG + Intronic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193574063 X:83177993-83178015 GGTTCTCCACAGATGGTCAAAGG + Intergenic
1193695018 X:84697804-84697826 GGTTCTCCACAGATGGTTAAAGG + Intergenic
1194445869 X:93986690-93986712 GCTTTTCCTCTGCTGGAGCAGGG + Intergenic
1194851944 X:98881102-98881124 GCTTTTCCACTGCTGGAGCCAGG + Intergenic
1197017845 X:121648727-121648749 GCTGCTCCATAGACAGAGCAGGG - Intergenic
1197351302 X:125386877-125386899 GCTACTCCACAGACAGAGCAGGG - Intergenic
1199691037 X:150309132-150309154 AGTTCTCCCCAGATGGTGCAGGG - Intergenic