ID: 1111861916

View in Genome Browser
Species Human (GRCh38)
Location 13:93718392-93718414
Sequence CTTTTCAAAAGAAGACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1302
Summary {0: 9, 1: 86, 2: 91, 3: 198, 4: 918}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111861916_1111861917 10 Left 1111861916 13:93718392-93718414 CCTAAATGTCTTCTTTTGAAAAG 0: 9
1: 86
2: 91
3: 198
4: 918
Right 1111861917 13:93718425-93718447 TATCCTTCGCCTACTTTTGATGG 0: 4
1: 8
2: 86
3: 217
4: 439
1111861916_1111861918 11 Left 1111861916 13:93718392-93718414 CCTAAATGTCTTCTTTTGAAAAG 0: 9
1: 86
2: 91
3: 198
4: 918
Right 1111861918 13:93718426-93718448 ATCCTTCGCCTACTTTTGATGGG 0: 4
1: 7
2: 90
3: 376
4: 3142
1111861916_1111861919 12 Left 1111861916 13:93718392-93718414 CCTAAATGTCTTCTTTTGAAAAG 0: 9
1: 86
2: 91
3: 198
4: 918
Right 1111861919 13:93718427-93718449 TCCTTCGCCTACTTTTGATGGGG 0: 4
1: 11
2: 93
3: 221
4: 852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111861916 Original CRISPR CTTTTCAAAAGAAGACATTT AGG (reversed) Intronic
900560234 1:3301516-3301538 ATTTTTAAAAGAAGACGTCTCGG + Intronic
901375773 1:8838162-8838184 TTTTTCATAATAAAACATTTTGG + Intergenic
901954441 1:12773922-12773944 GTTTTCAGAAGAACAAATTTAGG + Intergenic
904000238 1:27334815-27334837 GTTCTGAAAAGAAGACTTTTAGG + Intronic
904986909 1:34558806-34558828 CATTTCAAAATAAAACATTTAGG + Intergenic
905100545 1:35517922-35517944 CTTTTCAAAAGAAGACATACAGG + Intronic
905366740 1:37455743-37455765 GCTTTCAAAAGGAGACACTTCGG - Intergenic
906057007 1:42925055-42925077 CCTTTCAACAGAAGTCTTTTGGG + Intergenic
906070201 1:43010879-43010901 CTTATAAAAAGGGGACATTTGGG - Intergenic
906332579 1:44899528-44899550 CTTCTCAAAAGAAGACATACAGG + Intronic
906355329 1:45101246-45101268 CTTCTCAAAAGGAGACATTTAGG + Intronic
906441531 1:45850234-45850256 CTTCTCAAAAGAAGATATACAGG - Intronic
906605880 1:47171259-47171281 CTTCTCAAAAGAAGACATTTAGG + Intergenic
906855868 1:49303774-49303796 CTTCTCAAAAGAAGACATTTAGG - Intronic
906903806 1:49866461-49866483 CTTTTTAAAAAAAGACTTTCTGG + Intronic
906992068 1:50749818-50749840 CTTTGCAGAAGAAGAGATTGAGG - Intronic
907637815 1:56154075-56154097 ATTTTTAAAAATAGACATTTAGG + Intergenic
907875427 1:58482500-58482522 GTTTTAAAAGAAAGACATTTAGG + Intronic
908154532 1:61338943-61338965 TCTTTCAAAAGAAACCATTTGGG + Intronic
908311030 1:62884098-62884120 CCTTTGGTAAGAAGACATTTTGG - Intergenic
908682492 1:66677813-66677835 CTTTTCAAAAAAAGGTGTTTGGG + Intronic
908904848 1:68996405-68996427 CTGCTTAAAAGAAGACATTTAGG - Intergenic
909016757 1:70388364-70388386 CATTTCCAAAGAAGAGAATTGGG - Intergenic
909213197 1:72850536-72850558 CATTTCAAAATAAGAATTTTGGG - Intergenic
909775637 1:79481435-79481457 CTTCTTAAAAGAAGACATATGGG + Intergenic
909809593 1:79915964-79915986 ATTTTCTTAAGAAGACATATTGG + Intergenic
909811699 1:79939174-79939196 CTTCTCAAAAGAAGACATTTAGG - Intergenic
909964572 1:81892132-81892154 CTTTTCAAATGAAGAGATTGGGG + Intronic
910057308 1:83048136-83048158 GTTTTAAAAAAAAGACATCTTGG + Intergenic
910330396 1:86066694-86066716 TTTTACAAAATAAGACATTGAGG - Intronic
910867674 1:91803001-91803023 CTGCTCTATAGAAGACATTTTGG - Intronic
911167662 1:94738714-94738736 CTTCTCAAAAGAAGACATACAGG - Intergenic
911308824 1:96267153-96267175 TTTTTCAAAAGAAAATGTTTAGG + Intergenic
911986751 1:104636496-104636518 CCTTTCAGAAGAAGCAATTTTGG + Intergenic
912093863 1:106115348-106115370 CTTCTCAAAAGAAGACATTTAGG + Intergenic
913402442 1:118450981-118451003 CTTTTCAAATAAATAGATTTTGG - Intergenic
913405342 1:118484665-118484687 CTTTTCAAATGATGAAATTGCGG - Intergenic
914504108 1:148273864-148273886 CTTCATAAAAGAAGACATATAGG + Intergenic
914966221 1:152260032-152260054 CTTCTCAAAAGAAGACATTTAGG - Intergenic
915374785 1:155384166-155384188 ATTTTAAAAAAAAGACACTTTGG - Intronic
916023221 1:160812782-160812804 CTATTCAAAAGAAGAAATATTGG + Intronic
917041244 1:170808500-170808522 TTTTTCATATCAAGACATTTGGG - Intergenic
917177977 1:172260656-172260678 TTTTTAAAAAGCAGAAATTTTGG - Intronic
917180635 1:172293273-172293295 CATTTCATAAGAATACCTTTGGG - Intronic
917218754 1:172705053-172705075 CTTTTGGTAAGTAGACATTTGGG + Intergenic
917251370 1:173065354-173065376 CTTCTCAATAGAAGACTTTCAGG + Intergenic
917435227 1:175014504-175014526 CTTTTAAAATGAAGACATTTGGG - Exonic
917575606 1:176318329-176318351 CTTTTCACAAGTAGATATTTTGG + Intergenic
917832163 1:178903293-178903315 AATCTAAAAAGAAGACATTTTGG - Intronic
918617890 1:186568622-186568644 AGTTTCAAAAGAAGACAGTGTGG + Intergenic
918645904 1:186904194-186904216 CTTTTCACAAGAATACATAATGG + Intronic
918667862 1:187174383-187174405 TTTCTCAAAAGAAGACATACAGG + Intergenic
918703410 1:187633388-187633410 CTTCTCAAAAGAAGACATTTAGG + Intergenic
918791666 1:188838170-188838192 CTTCTCAAAAGAAGACATTTAGG + Intergenic
918827885 1:189350346-189350368 CCTGTTAAAACAAGACATTTGGG + Intergenic
918869786 1:189954845-189954867 CTTTTCAAAAGATTACTTTCAGG - Intergenic
918998744 1:191800108-191800130 CTTTTTAAAAGATGCCATTCTGG - Intergenic
918998855 1:191801215-191801237 CTTCTCAACAGAAGACATTTAGG - Intergenic
919009271 1:191938777-191938799 CTTCTCAAAAGAGGATATATAGG - Intergenic
919044648 1:192435469-192435491 CTTCTGAATAGATGACATTTAGG + Intergenic
919137789 1:193532371-193532393 CTTTTCAAAAGAAGACATACAGG + Intergenic
919254498 1:195104109-195104131 CTTCTCAAAAGAGTACATTTAGG - Intergenic
919316411 1:195976223-195976245 CTTTTCAAAAGAAGACATACTGG - Intergenic
919364868 1:196646440-196646462 CCTTTGAAATGAAGACATTGAGG - Intergenic
919503454 1:198367863-198367885 CATTTTAAAAGAAGACTTTTAGG - Intergenic
919526565 1:198659884-198659906 GTTTTCAAAGAAAGATATTTTGG + Intronic
919614405 1:199787496-199787518 CTTTTCAAAATGAGTCACTTTGG - Intergenic
919782823 1:201232478-201232500 CTTCTCAAAAGAAGACATTTAGG + Intergenic
920207030 1:204299704-204299726 CCTTTCTAAAGAAGACATGAGGG - Intronic
920817201 1:209345776-209345798 CTTTCCTCAAGAAGACATTCTGG + Intergenic
921044322 1:211463053-211463075 TTTCTCAAAAGAAGACATACAGG + Intergenic
921195037 1:212747704-212747726 ATTTTCAAAGGAATAAATTTAGG + Intronic
921385693 1:214567445-214567467 CTTTTTAAAATCAGACATTTGGG - Intergenic
921495863 1:215840791-215840813 CTGGTCAAAAGAAGACAATACGG + Intronic
921581276 1:216899104-216899126 TCTTTAAAAAGAAAACATTTGGG + Intronic
921612755 1:217231651-217231673 CTTGTAAGAAGAAGAGATTTGGG + Intergenic
921675047 1:217967666-217967688 CTTTTCAAAAGAAGACATGTGGG - Intergenic
921742124 1:218697108-218697130 TTATTCAAAAGAATACAGTTGGG - Intergenic
921846826 1:219892032-219892054 CTTCTCAAAAGAAGACATTTAGG + Intronic
922125625 1:222719126-222719148 CTTTTCCAAAGAATACAGTCTGG - Intronic
922511883 1:226175261-226175283 CTTTTCACAAGAAGATATTAAGG + Intronic
923304754 1:232678240-232678262 CTTTTTAAAAAAAGATCTTTTGG - Intergenic
923675450 1:236077189-236077211 CTTTTCAAAAGAAGACATATGGG + Intergenic
924000531 1:239546301-239546323 CTTTTCAAATGAAGAAACTGAGG - Intronic
924022244 1:239796698-239796720 CTTTTTAAAAAAACAGATTTAGG + Intronic
924031812 1:239893218-239893240 TTTTGCAAAAGAACACATTTTGG + Intronic
924259878 1:242218692-242218714 CTTTTAAAATAAATACATTTAGG - Intronic
924945181 1:248841619-248841641 ACTTTCAAAAGAATATATTTGGG + Intronic
1064504944 10:16018488-16018510 ATTCTCAAAAGAAGACATTTAGG - Intergenic
1064518164 10:16172361-16172383 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1064522432 10:16217056-16217078 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1064598587 10:16970847-16970869 TTTTTTAAAAAAAGACATTGAGG - Intronic
1064613210 10:17125130-17125152 CTTTTTAAAAGCAGAGAATTAGG - Intronic
1064667494 10:17670682-17670704 CTTTTCTAATGAAGTCCTTTGGG + Intronic
1064922508 10:20533728-20533750 CTTTTTAAAAACTGACATTTGGG + Intergenic
1064958377 10:20936974-20936996 CATTTCAAAGCAAAACATTTTGG + Intronic
1065737808 10:28770409-28770431 CTTTTTAAAAGCTGACATTTGGG - Intergenic
1065867080 10:29923673-29923695 CTTTTAAAGAGAAGACATGTTGG - Intergenic
1065943857 10:30589295-30589317 ATTTTCAAAAGTAGACACTTTGG + Intergenic
1066154030 10:32655845-32655867 TTTCTCAAAAGAAGACATATAGG - Intronic
1066529565 10:36321764-36321786 CTTTTCAAAAGAATACATACAGG + Intergenic
1067732934 10:48825744-48825766 TTTCTCCAAAGAAGACATTCAGG - Intronic
1068535308 10:58235021-58235043 CTTCTCAAAAGAAGACATCTAGG + Intronic
1068545510 10:58340217-58340239 ATTTTGAAATGATGACATTTTGG + Intronic
1068898758 10:62240437-62240459 CTTTACAAAGGAATACATGTGGG - Intronic
1069001011 10:63265002-63265024 CTTTTTAAAAGTAAACAGTTGGG - Intronic
1069017066 10:63442450-63442472 CTTCTAAAAAGAAGAGACTTAGG + Intronic
1069159549 10:65076855-65076877 CTCTTCATATGAAGACACTTTGG - Intergenic
1069347257 10:67484657-67484679 CTTCTCAAAAGAAGACATACAGG + Intronic
1070122843 10:73595452-73595474 CTGATCCAAAGAATACATTTTGG + Intronic
1070709723 10:78671740-78671762 CTTCTCAAAAGAAGACACTTAGG + Intergenic
1071331053 10:84561089-84561111 CTTTTCTAACGAAGACATCATGG - Intergenic
1071401960 10:85281655-85281677 GTTTTCAAAATATGAAATTTGGG + Intergenic
1071455088 10:85841680-85841702 CTTTTCAAAAGAAGACATACAGG + Intronic
1071690194 10:87810047-87810069 CTTTTCAAAAAAACAATTTTGGG + Intronic
1071874621 10:89831226-89831248 CTTTTCATGAGAAGACATGGGGG - Intergenic
1072352687 10:94573256-94573278 CTTTACAAAAGAAAACATACAGG - Intronic
1072494099 10:95937233-95937255 GTTTTCAAAAACACACATTTAGG - Intronic
1072842790 10:98794188-98794210 CTTTTCTATAAAGGACATTTTGG - Intronic
1072863054 10:99027174-99027196 CTTTTCAAAAAAACAACTTTTGG - Intronic
1072883693 10:99253813-99253835 CTTCTCAAAAGAAGATATACAGG + Intergenic
1072985139 10:100132858-100132880 CTTATAAAAAGGGGACATTTGGG + Intergenic
1073202018 10:101743153-101743175 CTTTTGAAATGATAACATTTGGG + Intergenic
1073236714 10:102022878-102022900 TTTTTAAAAAGAAAAAATTTCGG - Intronic
1074024263 10:109617412-109617434 CTGTAGAAAATAAGACATTTGGG + Intergenic
1074463420 10:113659745-113659767 TTTTTCAAAGGGTGACATTTAGG + Intronic
1074483708 10:113853149-113853171 CATTTCCGAAGAAGACATTTGGG - Exonic
1074623457 10:115151508-115151530 CTTCTCAAAAGAAGACATTTAGG - Intronic
1074660286 10:115647586-115647608 CTTCTCAAAAGAAGACATTTAGG - Intronic
1074887766 10:117707966-117707988 CATTTCAAAAGAATTCTTTTAGG + Intergenic
1075367263 10:121903187-121903209 TTTTTTAAAAAAAGATATTTGGG - Intronic
1075954000 10:126506717-126506739 CTTCTCAAGACAACACATTTTGG + Intronic
1076743329 10:132499158-132499180 CTTTTTTTAAGAAGACATTGGGG - Intergenic
1077597884 11:3549883-3549905 CTTTTCTAATGAAGACATCATGG + Intergenic
1077780062 11:5317914-5317936 CTTCTCAAGAGAAGACATACAGG - Intronic
1077786869 11:5393513-5393535 ATTTTCTGAAGAAGACATTTCGG + Intronic
1077792740 11:5459583-5459605 CTTCTCAAAAGAAGATATACAGG + Intronic
1078124545 11:8547513-8547535 CTTCTCAGAAGAAGACATACAGG - Intronic
1078655286 11:13233194-13233216 CCTTCCTAAAGAAAACATTTTGG - Intergenic
1078867539 11:15312065-15312087 CTTCTCAAAAGAAGAGATACCGG + Intergenic
1079052088 11:17170534-17170556 ATTTTGAAAAGGAGAAATTTTGG - Intronic
1079581793 11:22074245-22074267 TTTCTCAAAAGAAGACATACAGG + Intergenic
1079702975 11:23572338-23572360 CTTTTTAAAAGAAGGCATACAGG - Intergenic
1080021821 11:27569683-27569705 CTTTTCTAAAGATGACATACTGG + Intergenic
1080113868 11:28600308-28600330 TTTTTCAAAACAAGCTATTTGGG - Intergenic
1080187088 11:29502935-29502957 CTTTTTAAAAAAAAACATTTGGG - Intergenic
1080256966 11:30301257-30301279 ATTTTTAAAAGAAGACATACAGG + Intergenic
1080453096 11:32394970-32394992 CTTTTCAAATGATCCCATTTGGG + Intronic
1080658583 11:34277464-34277486 TTTTTTTAAATAAGACATTTAGG - Intronic
1080692362 11:34568947-34568969 TTTTTAAAAAGAAGACCTATTGG + Intergenic
1080782021 11:35438456-35438478 CTTTTCAAAAGAAAAAACTAAGG + Intronic
1080903237 11:36515386-36515408 ATTTTCAAAGGCAGGCATTTTGG + Intronic
1080982794 11:37428683-37428705 CTTCTCAAAAGAAGATATTTAGG - Intergenic
1081013217 11:37842075-37842097 CCTTTCACAAGAAGAAATTGAGG + Intergenic
1081022628 11:37966994-37967016 CTTTTTAAAAGAAGATATACAGG + Intergenic
1081167589 11:39824932-39824954 CTTTTCAAAAGAAGACACACAGG + Intergenic
1081316433 11:41636837-41636859 CAATTCAAAAGATGAGATTTGGG + Intergenic
1081705108 11:45178297-45178319 TTTTGCAAAAGAAGACACTAAGG + Intronic
1082217689 11:49594410-49594432 CTTTTTAATATAAGGCATTTAGG + Intergenic
1082620047 11:55409159-55409181 CTTTTCAAAAAAACACCTCTTGG + Intergenic
1082635586 11:55589290-55589312 CTATTTGAAAGCAGACATTTTGG - Intergenic
1082954428 11:58854128-58854150 CTTTTAAAAAGAAGGAAATTCGG - Intronic
1082969377 11:59003380-59003402 CTTTCCAAACTAAGACTTTTAGG - Intronic
1084588116 11:70074999-70075021 CTTTACAAAAGAGGAAATCTAGG + Intergenic
1084818907 11:71670131-71670153 CTTTTCTAATGAAGACATCAAGG - Intergenic
1084986790 11:72881230-72881252 TTTCTCAAAAGAAGACATAATGG + Intronic
1085002820 11:73056407-73056429 TTTTTAAAAAGATTACATTTTGG - Intronic
1085222535 11:74887417-74887439 CTTTTCAAAAGAAGACATAGTGG + Intronic
1085732421 11:79011119-79011141 CTTTTCTAAAGCATACATTCAGG - Intronic
1086158764 11:83697314-83697336 ATTATCCAAAGAATACATTTAGG + Intronic
1086313581 11:85564774-85564796 TTTTTTAAAAGCAGAGATTTTGG + Intronic
1086413293 11:86564410-86564432 CTTTTTAAAAAAAAAGATTTTGG - Intronic
1086631887 11:89029740-89029762 CTTTTTAATATAAGGCATTTAGG - Intronic
1087462264 11:98460202-98460224 CTTTTGAACAGAAAACATTGAGG + Intergenic
1087543631 11:99554139-99554161 CTTTTCATAAGATGCCATGTAGG - Intronic
1087663433 11:101014360-101014382 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1087671771 11:101115263-101115285 CTTTCCATAAAAACACATTTTGG + Intronic
1087679599 11:101204650-101204672 GTTTTCAAAAGAAGACATACAGG - Intergenic
1087888513 11:103508812-103508834 TTTTTCAAAAGAAGACATTAGGG + Intergenic
1087957604 11:104308047-104308069 CTTATAAGAAGAAGAAATTTGGG + Intergenic
1088052004 11:105528033-105528055 CTGTTCAAAAAAAGACATTTAGG - Intergenic
1088200961 11:107333808-107333830 CTTTCCAAAAGAAGAAATGGGGG + Intronic
1088219565 11:107554876-107554898 CTTTTTAAAACAACATATTTCGG - Intronic
1088337217 11:108719560-108719582 CTTTTGGAAAGAAGATATTCTGG + Intronic
1088677352 11:112207590-112207612 CTTTTCAAAAGAAAAATATTAGG - Intronic
1088691707 11:112334120-112334142 TTTCTAAAAAGAAGACACTTTGG + Intergenic
1088927162 11:114314051-114314073 CTTCTCAAAAGAGGGCATATTGG - Intergenic
1089222268 11:116883631-116883653 GTCCTCAAAATAAGACATTTGGG + Intronic
1089721918 11:120433126-120433148 CTTTACAAAAGAAAAAATTGAGG + Intronic
1090103309 11:123824930-123824952 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1090527700 11:127555398-127555420 CCTTTCAAAACAAGCTATTTAGG + Intergenic
1090618177 11:128535758-128535780 CTTTTCAAAAGTTGAGATTGTGG - Intronic
1090720955 11:129472693-129472715 CTTTTCAAAAGAAGACATTTAGG + Intergenic
1090770476 11:129915302-129915324 CTTTACAAAGGAGGTCATTTTGG - Intronic
1091984439 12:4896985-4897007 TTTTCCAAAATAACACATTTTGG + Intergenic
1092424043 12:8359198-8359220 CTTTTCTAATGAAGACATCATGG + Intergenic
1092536175 12:9389337-9389359 CTTTTCAAAAAAAGACAACAGGG - Intergenic
1092648839 12:10611191-10611213 ATTTTTAAAAGAGAACATTTTGG - Intronic
1092658770 12:10716516-10716538 CTATTCATAAGCAGATATTTAGG - Intronic
1092737489 12:11596426-11596448 GTTTTCAAATGAAGACATCAAGG + Intergenic
1093098673 12:15001332-15001354 CTTTGCAAGAGAAGATATTTGGG - Intergenic
1093216125 12:16363084-16363106 CTGTTATAAAGAAAACATTTAGG + Intronic
1093274145 12:17103134-17103156 ATTTGAAAAGGAAGACATTTAGG + Intergenic
1093489219 12:19685694-19685716 CTTTTTAAAAGAATCCATCTGGG + Intronic
1094006372 12:25756629-25756651 GCTTTCAAAAGAAAACAGTTTGG + Intergenic
1094051764 12:26227931-26227953 ATTTTTAAAAGATGACTTTTTGG - Intronic
1094067196 12:26373856-26373878 ATTTTCCAAAGAATACATTTTGG - Intronic
1094093789 12:26680340-26680362 CAATTCAAATGGAGACATTTTGG + Intronic
1094138883 12:27160006-27160028 CTTCTCAAAAGAAGACATACAGG + Intergenic
1094265540 12:28555140-28555162 CTATTCAAAAAAGGACATGTTGG - Intronic
1094310013 12:29069946-29069968 CTTTTCATAAAAAGATACTTTGG - Intergenic
1094407411 12:30132092-30132114 CTTTTCGAAAGAAGACATACAGG + Intergenic
1094669725 12:32557782-32557804 TTTTTAAAAAAAAGACATTAAGG - Intronic
1094734375 12:33217810-33217832 CTTTTCAAAAGAAGACATACAGG - Intergenic
1095041302 12:37444168-37444190 CTTCTCAAAAGAAGACATTGAGG + Intergenic
1095165220 12:38964251-38964273 CTTCTCAAAAGAAGACATCTAGG - Intergenic
1095202566 12:39401426-39401448 CTTTTAAAAAGACAATATTTGGG + Intronic
1095353984 12:41249381-41249403 CATGTCAAAAGAAGTTATTTTGG + Intronic
1095446187 12:42285236-42285258 CTTTTCAAAAGCACATTTTTGGG + Intronic
1095555917 12:43504348-43504370 CTTTTCAAAAGAAGACATACAGG - Intronic
1096752049 12:53766392-53766414 CTTTGCAAAAGGAATCATTTTGG + Intergenic
1097550898 12:61067227-61067249 ATTTTCTAATGAAAACATTTGGG + Intergenic
1097646817 12:62245778-62245800 CTTTTCAAAAGATCAGATTTGGG + Intronic
1098354429 12:69598226-69598248 CTTTTTAAAATTATACATTTAGG - Intronic
1098520202 12:71426948-71426970 CTTATCAAAATACAACATTTTGG + Intronic
1098683575 12:73390411-73390433 CTGTACAAGAGAAGAAATTTTGG + Intergenic
1098838358 12:75448491-75448513 TTTTTCAAAAGAATACAGTTTGG + Intergenic
1098965057 12:76778961-76778983 CTTTTAAAAAGGAGAAAATTTGG - Intronic
1099152462 12:79132148-79132170 TTTCTCAAAAGAAGACATACAGG + Intronic
1099344257 12:81478347-81478369 CTTTTCAAAAAACCACATTCTGG + Intronic
1099511301 12:83541790-83541812 CTTTTGTAAACAATACATTTTGG - Intergenic
1100076549 12:90791883-90791905 CATTCCAAAATAAGACTTTTAGG + Intergenic
1100080107 12:90838754-90838776 CTATTCAAAATACCACATTTTGG + Intergenic
1100165132 12:91908388-91908410 CTTTTCAAAAGAAGACATTTAGG + Intergenic
1100361741 12:93885654-93885676 TTTTTCAAAAGAAGAAACTGAGG - Intronic
1100671263 12:96815341-96815363 CTTCTCAAAAAAAGACATTTAGG - Intronic
1101057496 12:100933887-100933909 CTTCTCAAAAGAAGACATCTAGG - Intronic
1101184129 12:102255409-102255431 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1101267718 12:103107788-103107810 CTTTTCAATAGAAAAGCTTTTGG - Intergenic
1101361079 12:104027725-104027747 TTTTTCAAATGAGGACATTGTGG + Intronic
1101600761 12:106207582-106207604 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1101808558 12:108087607-108087629 TTTTTTAAAAAAAGACATTTAGG + Intergenic
1101861789 12:108488383-108488405 CTTCTCAAAAGAAGACAGACAGG + Intergenic
1101950718 12:109172560-109172582 CTTTTCAAAGGAAGACACACAGG + Intronic
1102863646 12:116357304-116357326 TTTTTAAAAAGAAGAAATTTGGG + Intergenic
1103283659 12:119782273-119782295 ATTTTTAAAAGCAGACATTATGG + Intronic
1104405415 12:128512526-128512548 CTTTTTAATAACAGACATTTGGG - Intronic
1104793956 12:131503478-131503500 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1104995777 12:132654828-132654850 CTTTTCAAAGAACAACATTTTGG + Intronic
1105649951 13:22366011-22366033 GTTTTCAAAAGAAGACACAATGG + Intergenic
1105724088 13:23143407-23143429 TTTTTAAAAAGCAGACATTGGGG - Intergenic
1106089536 13:26577504-26577526 CTTTTCTAACGAAGACATCATGG - Intronic
1106652140 13:31703158-31703180 GTGTTCAAGAGAATACATTTTGG - Intergenic
1106654109 13:31724052-31724074 GTTTTCAGAGAAAGACATTTTGG + Intergenic
1106688180 13:32084496-32084518 CTTTTCAGATGATGAGATTTTGG - Intronic
1106743659 13:32675920-32675942 CTTCTCAAAACAAGCCACTTTGG + Exonic
1107119769 13:36783746-36783768 CTTTTTAAAAGTATACCTTTTGG - Intergenic
1107185454 13:37513960-37513982 GTACTTAAAAGAAGACATTTGGG + Intergenic
1107189063 13:37558032-37558054 CTTTTCAAAAGAAAACATACAGG + Intergenic
1107221029 13:37980350-37980372 CTTTTAGGAGGAAGACATTTAGG - Intergenic
1107288756 13:38827427-38827449 CTATTCAAAAGTAATCATTTTGG - Intronic
1107581631 13:41795153-41795175 CTTTTCAAAAGAATACATTTAGG + Intronic
1107866625 13:44709540-44709562 CTTCACCAAAGAAGACATTCAGG - Intergenic
1107898269 13:44987717-44987739 CTTTTCTAAACAAGAGATATTGG - Intronic
1108307528 13:49153305-49153327 CTTCTCAAAAGAAGACATTTAGG - Intronic
1108384327 13:49885043-49885065 CTTTTCAAAAGAAGACATTTAGG + Intergenic
1108741153 13:53339648-53339670 ATTTTAAGAAGCAGACATTTGGG - Intergenic
1108801813 13:54105780-54105802 CTCTTGAAAACAATACATTTTGG + Intergenic
1108898408 13:55365090-55365112 CTTTTCAAATGATGAGAGTTTGG + Intergenic
1108954960 13:56141673-56141695 CTTTTAACAATAAGAGATTTGGG - Intergenic
1109213030 13:59556765-59556787 CTTCTCAAAAGAAGACATACGGG + Intergenic
1109431695 13:62245044-62245066 CTTATGAAAAGAAGGGATTTAGG - Intergenic
1109517055 13:63457484-63457506 CTTCTCAAAAGAAGACATAGAGG - Intergenic
1109531407 13:63653420-63653442 CTTCTCGAAAGAAAACATTTAGG - Intergenic
1109628154 13:65006006-65006028 CTTAACAAAAGAAGACATTTTGG - Intergenic
1110032931 13:70639841-70639863 TTGTTCAAAACTAGACATTTTGG - Intergenic
1110136290 13:72071406-72071428 ATTTTCAAAAGGAGACCTTGAGG + Intergenic
1110366083 13:74687546-74687568 CTTTTCAAAAGAAGGCAGACCGG - Intergenic
1110382844 13:74874429-74874451 CTTCTCAAAAGAAGGCATTTAGG + Intergenic
1110458582 13:75718481-75718503 CTTTTTAAAAGAACAGTTTTGGG + Intronic
1110507988 13:76311977-76311999 CTTTTCAAAAGCACAAATTTTGG + Intergenic
1110675178 13:78234253-78234275 CTTCTCAAAAGAAGATATACAGG - Intergenic
1110876380 13:80515927-80515949 CTTCTCAAAAGAAGACATATAGG - Intergenic
1110890762 13:80694945-80694967 CTTCTCAAAGGAAGACATTTAGG + Intergenic
1110907633 13:80912464-80912486 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1111069411 13:83144906-83144928 CTTTTTACAAGAAGAAATTGAGG - Intergenic
1111171790 13:84536070-84536092 ATTTTCAAATGAAGACAATATGG - Intergenic
1111194087 13:84849963-84849985 TTTTGAAAAAGAACACATTTAGG - Intergenic
1111448387 13:88380584-88380606 CTTCTCAAGAGAAGACATACAGG - Intergenic
1111509478 13:89242244-89242266 ATTTTCAAAAGAAGTCCATTTGG + Intergenic
1111574666 13:90136689-90136711 CTTTTCCTAAGGAAACATTTAGG - Intergenic
1111669744 13:91314903-91314925 CTATTCAGAAGAAAACATTTAGG + Intergenic
1111709098 13:91788806-91788828 ATATTCAAAACAATACATTTGGG + Intronic
1111768763 13:92569312-92569334 CTTTGCAAAGGAGGAAATTTAGG + Intronic
1111833496 13:93358684-93358706 TTTCTCAAAAGAAAAAATTTTGG + Intronic
1111861916 13:93718392-93718414 CTTTTCAAAAGAAGACATTTAGG - Intronic
1112077533 13:95930069-95930091 CTTCTCAAAAGAAGACACGCAGG - Intronic
1112162742 13:96885918-96885940 CAATTCAAAAGAAGACATATGGG - Intergenic
1112216525 13:97435608-97435630 CTTTTCTAAAGTATACATTTTGG + Intronic
1113136775 13:107099490-107099512 CTTTTCTAAAGAAGAATTCTAGG + Intergenic
1113468177 13:110526422-110526444 ATTTTCTAAAGATCACATTTAGG + Intronic
1113530245 13:111019294-111019316 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1113613584 13:111665212-111665234 CTTTTCTCAAGAAGTCTTTTTGG - Intronic
1113854959 13:113438353-113438375 CTTCTCCAAAGAAGATATATGGG - Intronic
1113980044 13:114267185-114267207 CTCTTCAAAAGAAGCTATCTAGG + Intronic
1114361637 14:21980281-21980303 CATTTTAAAAGAGGAGATTTAGG - Intergenic
1114709310 14:24762396-24762418 CTTATCGAAAGAAGACATTTAGG - Intergenic
1114747413 14:25164535-25164557 CTTCTCAAAAGAAGACATACAGG - Intergenic
1114773940 14:25459991-25460013 CCTTCCAAAAGGACACATTTCGG + Intergenic
1114805488 14:25830909-25830931 CTTTTCCAAAACAGAAATTTTGG + Intergenic
1114820552 14:26013491-26013513 CTTTTCAAAAAACCAAATTTTGG - Intergenic
1114916396 14:27271936-27271958 TTTTTCAAAATAAGACACTTAGG + Intergenic
1115100208 14:29689312-29689334 TTTCTCAAAAGAAGACATTCAGG + Intronic
1115128835 14:30028225-30028247 CTTCTCAGAAGAAAACATTCAGG - Intronic
1115137488 14:30128410-30128432 CTTTTCAGATGAGAACATTTAGG + Intronic
1115234841 14:31199323-31199345 TTTTTTAAAAGAAAACATTTTGG - Intronic
1115428279 14:33286482-33286504 CCTTTCAATAGAAAGCATTTGGG - Intronic
1115495996 14:34005278-34005300 CATCTAAAAAGAAGAAATTTTGG + Intronic
1115799888 14:36981041-36981063 CTTCTCAAAAGAAGACATTTAGG + Intronic
1115885287 14:37964678-37964700 CTTTTCAAAAGGAGACATACAGG - Intronic
1116108322 14:40541008-40541030 CTTCTCAAAAGAAGACAAAGAGG + Intergenic
1116153421 14:41171413-41171435 CTTTAGAAAAGAGAACATTTAGG + Intergenic
1116291194 14:43043690-43043712 ATTTTCAAAAAAAGAAATTCAGG - Intergenic
1116363722 14:44033741-44033763 CTTTTTAAAGGAAGAGATATAGG - Intergenic
1116477631 14:45359894-45359916 CTTTTCAAATGATGAAATCTGGG + Intergenic
1116600029 14:46909461-46909483 CCTTTCAAAAGGAGAAATTAAGG + Intronic
1116638229 14:47425437-47425459 CTTTCTAACAGAAGACCTTTGGG + Intronic
1116774460 14:49164368-49164390 GTTTTCAGAAGATGACAGTTTGG - Intergenic
1116951514 14:50882678-50882700 CCTTTTAAAAGCAGACATTCTGG - Intronic
1117641554 14:57804975-57804997 CTTCTCAAAAGAAGACATACAGG + Intronic
1117644372 14:57835938-57835960 ATTTTCTAAACAACACATTTGGG + Intronic
1117987870 14:61406259-61406281 GTTCTTAAAAGAATACATTTGGG - Intronic
1118145939 14:63136820-63136842 GTTTGCAAAAAACGACATTTGGG - Intergenic
1118376446 14:65181317-65181339 GTTCTCAAAAGATGACATTTAGG - Intergenic
1118456928 14:65953127-65953149 CTTCTCTAAAGAGGAGATTTGGG + Intergenic
1118878667 14:69807702-69807724 CTTTTCTAAATATGATATTTAGG - Intergenic
1118915879 14:70105003-70105025 CTTTTCAAAGGACTACATTTTGG - Intronic
1119196945 14:72724041-72724063 ATTTACAAAAGTAAACATTTTGG - Intronic
1120157510 14:81109851-81109873 CTTTTTACAAGAAGACAAGTGGG + Intronic
1120204787 14:81576094-81576116 CATTTGAAAAAAAAACATTTTGG + Intergenic
1120235993 14:81891658-81891680 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1120367177 14:83585942-83585964 CTTCTCAAGAGAAGACATAAAGG + Intergenic
1120456729 14:84740175-84740197 TTTTTCTGAAGAAGATATTTGGG - Intergenic
1120578790 14:86220391-86220413 CTTTTAAAACGATGAAATTTGGG + Intergenic
1120604182 14:86552312-86552334 CTTCTCAAAAGAAGACACTCAGG + Intergenic
1121194334 14:92056432-92056454 TTTTTAAAAAGAAGAAAATTTGG + Exonic
1121753579 14:96381299-96381321 TTTTTCAAAATATAACATTTGGG + Intronic
1122259632 14:100506699-100506721 CTTCTCAAAAGAAGACATACAGG - Intronic
1202845447 14_GL000009v2_random:168807-168829 CATTTCAAAAGAAGAAATATTGG - Intergenic
1202914846 14_GL000194v1_random:159073-159095 CATTTCAAAAGAAGAAATATTGG - Intergenic
1202875345 14_GL000225v1_random:202412-202434 CATTTCAAAAGAAGAAATATTGG + Intergenic
1202877823 14_KI270722v1_random:23636-23658 CATTTCAAAAGAAGAAATATTGG + Intergenic
1124148000 15:27148017-27148039 CTTTTCAAAAAAACAACTTTTGG - Intronic
1124468255 15:29959945-29959967 TTATTCAAAAGAGGACATATGGG + Intronic
1124556952 15:30735175-30735197 CTCCTCAAAAGAAGACATTTAGG + Intronic
1124674313 15:31670567-31670589 CTTCTCAAAAGAAGACATTTAGG - Intronic
1124704344 15:31949563-31949585 TTTCTCAAAAGAAGACATACAGG - Intergenic
1125208433 15:37182254-37182276 CTTTCTAAAGGCAGACATTTAGG + Intergenic
1125308926 15:38357351-38357373 TTTTTCTAAGGAAGAGATTTGGG + Intergenic
1125363822 15:38892353-38892375 CTTCTCAATAGAAGACATTTAGG + Intergenic
1125872619 15:43115851-43115873 CTTTTCTAACGAAGACATCACGG + Intronic
1126226357 15:46274774-46274796 CTTTTCTAAGGAACACACTTTGG + Intergenic
1126293470 15:47109539-47109561 CTTCTCAAAAGAAGATATTTAGG - Intergenic
1126303454 15:47226095-47226117 CTTTATAAAAGAAGACAATTTGG + Intronic
1126499082 15:49324539-49324561 CATTTCTAAAGTAGACATGTGGG + Intronic
1126553140 15:49954534-49954556 CTTCTCAAAAGAAGACATACAGG + Intronic
1126924649 15:53570442-53570464 CTTCTCAAAAGAAGACATACAGG + Intronic
1126985478 15:54302076-54302098 CTTCTCAAAAGAAGACCTTTAGG - Intronic
1127156172 15:56127527-56127549 CTTTTCAAAAAAACAATTTTGGG - Intronic
1127523513 15:59768972-59768994 CTTTTCTAACGAAGACATCATGG - Intergenic
1127844854 15:62860878-62860900 CTTCTCAAAAGAAGACATATAGG + Intergenic
1128174916 15:65546771-65546793 GTTTTCAAAATAAAACATTGGGG + Intronic
1128228080 15:66016585-66016607 CTTTGTAAAAGAAGGCAGTTTGG - Intronic
1128508288 15:68295460-68295482 CTTTTCAAAGGTACACAGTTGGG + Exonic
1128536767 15:68497517-68497539 ATTTTCAAAAAAACACACTTGGG - Intergenic
1128916663 15:71569058-71569080 TTTTAGAAAAGAAGGCATTTTGG - Intronic
1129494742 15:75968095-75968117 CTTTTCCAATGGAGACTTTTTGG + Intronic
1129560817 15:76565381-76565403 CTTTTGTAAAGAAGACATACAGG + Intronic
1130619474 15:85446966-85446988 CTTTTTAAAATAATAAATTTAGG + Intronic
1130624076 15:85495431-85495453 CATTTCAAGAGGAGAAATTTGGG + Intronic
1130700337 15:86173138-86173160 TTTCTCAAAAGAAGACATACAGG - Intronic
1130768457 15:86898742-86898764 CTTTTCAAAAGAAGACAAATAGG + Intronic
1131262888 15:90897715-90897737 TTTTTAAAAATAAGACATTTCGG - Intergenic
1131457709 15:92596385-92596407 AGTTGTAAAAGAAGACATTTGGG + Intergenic
1131615803 15:94016206-94016228 ATTTTGAAAAGATTACATTTTGG - Intergenic
1131888098 15:96942014-96942036 CTTTTCAAAAGGAGGGATTCAGG + Intergenic
1132723131 16:1326665-1326687 CATTACAAAATAAGACATTCTGG - Exonic
1132754835 16:1478412-1478434 CTTTTCTAAGGAAGACATCCTGG - Intergenic
1133195804 16:4169362-4169384 GTTACCAAAAGAAGACATTTCGG + Intergenic
1133374229 16:5270788-5270810 CTTTTCTAATGAAGACATCATGG - Intergenic
1133669955 16:8008800-8008822 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1133781685 16:8943878-8943900 TTTTTCACAGGAAAACATTTTGG + Intronic
1134117757 16:11561889-11561911 TTTTTAAAAAAAAGACATTGTGG - Intronic
1134810265 16:17161270-17161292 CGTCTCAAAAGATGACATCTTGG + Intronic
1135318447 16:21472147-21472169 CTTTTGAAAATAAGATATTCAGG - Intergenic
1135371340 16:21903942-21903964 CTTTTGAAAATAAGATATTCAGG - Intergenic
1135440447 16:22466773-22466795 CTTTTGAAAATAAGATATTCAGG + Intergenic
1135570556 16:23546006-23546028 CTTTTCAAAAGAGGAAACTGAGG - Intronic
1135843385 16:25896352-25896374 CTTCTCAAAAGAAGACATACAGG + Intronic
1135937315 16:26792342-26792364 CTTACTAAAATAAGACATTTAGG - Intergenic
1135960893 16:26993663-26993685 ATTTTCAGATGAAGAAATTTAGG + Intergenic
1135974103 16:27095976-27095998 CTTATAAGAAGAAGAGATTTAGG - Intergenic
1136112352 16:28072156-28072178 TCTTTCAAAAGAAAACTTTTAGG - Intergenic
1137242406 16:46667249-46667271 TTTTTCCAAAGAAGACATACAGG - Intronic
1137752526 16:50877411-50877433 CATTTCAAAAGAAAAGAATTTGG - Intergenic
1138530568 16:57632098-57632120 CTTTTCAGATGAGGACATTGAGG + Intronic
1138815249 16:60196186-60196208 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1138995012 16:62440108-62440130 ATTCTCAAAAGAAGACATACAGG + Intergenic
1139368953 16:66453047-66453069 CTTTTCAAAAAAACAACTTTTGG + Intronic
1140080020 16:71737151-71737173 CTTTGCAAATGAAGACACTGAGG + Intronic
1140639419 16:76954824-76954846 CTTTTCAATATAATGCATTTGGG + Intergenic
1140660137 16:77181896-77181918 CTTTTCAAAATATAACCTTTTGG - Intergenic
1140846876 16:78898114-78898136 CTTTTCAAAAGACACCATTAAGG - Intronic
1141451141 16:84103560-84103582 TTTTTAAAAAGAAAACATTAAGG + Intronic
1141777821 16:86135971-86135993 TTTTTCAGAGGAAGACGTTTTGG - Intergenic
1141851877 16:86651922-86651944 TTTTTCAAATGAAGACACTGAGG - Intergenic
1141851978 16:86652388-86652410 TCTTTAAAATGAAGACATTTGGG + Intergenic
1142977039 17:3651389-3651411 ATTTTAAAAAGAGGACACTTTGG - Intronic
1143342262 17:6221269-6221291 ATTTACAAATGAAGTCATTTGGG - Intergenic
1143468451 17:7155021-7155043 CTTTTCCAAAGCAGCAATTTGGG - Intergenic
1144012972 17:11167803-11167825 TTTTTCAAAAGAAGACATTTAGG + Intergenic
1144132920 17:12265587-12265609 CTTATAAAAAGAAGAAATTGGGG - Intergenic
1144525927 17:15989906-15989928 CTTTTCAAAAAATTAAATTTTGG - Intronic
1147010959 17:37447454-37447476 CTTTTTAAAAGCATTCATTTAGG - Intronic
1147809287 17:43155822-43155844 CATTTCAAAAGTTCACATTTAGG - Intergenic
1148718357 17:49732084-49732106 CTTTTTAAAAAATGAGATTTAGG - Intronic
1148915120 17:50970194-50970216 CCTTTCAAACAAATACATTTTGG + Intronic
1149551816 17:57546132-57546154 GTTTCCAAAAGCAGTCATTTTGG - Intronic
1150048324 17:61934832-61934854 CTTTTCAAAAGAAGACATACAGG + Intergenic
1150051887 17:61972318-61972340 CTTTTTAAATGAAGACCTTAGGG + Intronic
1150489994 17:65567785-65567807 CTTTTCTAAAAATGACCTTTCGG - Intronic
1150520027 17:65856569-65856591 ATTTTCAAAAAAAGACATTATGG - Intronic
1151205921 17:72506720-72506742 CTTTTCACACGAAGCCATTTGGG - Intergenic
1151220727 17:72610647-72610669 TCTTTAAAAAGGAGACATTTGGG - Intergenic
1151750825 17:76036630-76036652 GTTTTCACAAAAAGACACTTCGG - Intergenic
1152909202 17:82988707-82988729 CTTCTCAAAAGAAGACATTTAGG + Intronic
1153831214 18:8924520-8924542 CTGTTTAAAAATAGACATTTGGG - Intergenic
1154149733 18:11896857-11896879 CCTCTCAAAGGAGGACATTTAGG - Intronic
1154805664 18:19182835-19182857 ATTTTCAAAATAAGAGATTCTGG + Intergenic
1155622972 18:27802245-27802267 TTTATCAAAAGAAGACATACAGG + Intergenic
1155659021 18:28225880-28225902 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1155670546 18:28365822-28365844 CTTTTTAGAACAAGAGATTTGGG + Intergenic
1155744770 18:29340808-29340830 CTTTTTAAAATAATATATTTGGG - Intergenic
1156230106 18:35145370-35145392 CTCTAGAAAAGAAAACATTTAGG - Intergenic
1156572403 18:38272131-38272153 CTTTTCAAAAAAACAACTTTTGG + Intergenic
1156766013 18:40656417-40656439 CTTCTCAAAAGAAGACATACAGG + Intergenic
1156825132 18:41421740-41421762 GTTTTCTAAAGAATAAATTTAGG - Intergenic
1156897499 18:42262911-42262933 CTTTTCAACAAAAGAAATTTGGG + Intergenic
1156916669 18:42470117-42470139 CTTTTTAAAAGAGAAAATTTAGG + Intergenic
1156991363 18:43412063-43412085 ACTTTCCAAAGAAGACATATAGG - Intergenic
1157118354 18:44883737-44883759 TTTTACAAAAGAAGACACTGAGG + Intronic
1157199532 18:45647442-45647464 CTTTTTCAAAGAAGCGATTTTGG + Intronic
1157397726 18:47356632-47356654 AATGTCAAACGAAGACATTTGGG + Intergenic
1157778188 18:50413526-50413548 CTTCTCAAAGGAAGACATACAGG + Intergenic
1158022971 18:52865638-52865660 CTTCTCAAAAGAAAACATTTAGG - Intronic
1158706330 18:59795668-59795690 CTTTTAAAAAGTAAACATTACGG + Intergenic
1158909743 18:62047759-62047781 CTTTTGAAACCTAGACATTTTGG - Intronic
1158997175 18:62933933-62933955 CTTCTCAAAAGAAAAAATTCAGG + Intronic
1159068960 18:63601271-63601293 CTTCTCAAAAGAAGACATACAGG - Intronic
1159281489 18:66291660-66291682 ATCTCCTAAAGAAGACATTTAGG - Intergenic
1159812288 18:73030202-73030224 TTTTTCCAAAGAAGACTTTGAGG + Intergenic
1159851212 18:73528936-73528958 TTTTTCACAAGAAGTAATTTAGG + Intergenic
1160275189 18:77425918-77425940 CTTTACAAAAGAAGACCTACAGG - Intergenic
1161306061 19:3568966-3568988 CTTATCAAAAGAGGAAATTTGGG + Intronic
1161867547 19:6844603-6844625 CTTTTCAGAAGAGGAAATTGAGG + Intronic
1162214309 19:9120045-9120067 TTTTTCAAAAGAAGACATATAGG - Intergenic
1162838865 19:13340904-13340926 CTTATAAAAAGAGGACATCTGGG + Intronic
1163574131 19:18100642-18100664 CTTTTCAAAGGAAGAAACTGAGG + Intronic
1163593610 19:18208086-18208108 CTTTTAAAAAGAAGATATTTAGG - Exonic
1163699356 19:18779578-18779600 GTTTTCAAAAGAAGGCATTGAGG + Exonic
1163891083 19:20014469-20014491 CTTTTAAAAAGCAGAAAATTGGG + Intronic
1163956702 19:20649288-20649310 CTTTACAACAGAAGACATTCAGG + Intronic
1164103200 19:22077659-22077681 GTTTCCAAATTAAGACATTTGGG + Intronic
1164448602 19:28338957-28338979 CTCCTCAAAAGAAGACATGAAGG - Intergenic
1164922989 19:32103473-32103495 CTTTGCAAAAAAAGACTTGTTGG - Intergenic
1165491325 19:36124841-36124863 CTTCTCAAAAGATGACATACTGG - Intronic
1165972919 19:39648394-39648416 CTTTTCAAAAGTAGACATACAGG + Intergenic
1166345680 19:42163733-42163755 GTTTACAAATGAAGACATTGAGG - Intronic
1166697487 19:44861005-44861027 TTTTTCTAAAGAAGACATACAGG + Intronic
1167026596 19:46923976-46923998 TTTTTCAGAAAAAGACATTTTGG + Intronic
1167219732 19:48190844-48190866 GTTTTCACATGAAGCCATTTTGG + Intronic
1167978289 19:53251118-53251140 CTTTGAAAAAGAAGACTGTTGGG - Intronic
1168591380 19:57638220-57638242 CTTTTCAAAGAAACACCTTTTGG + Intronic
1202672855 1_KI270710v1_random:9307-9329 CATTTCAAAAGAAGAAATATTGG - Intergenic
925488043 2:4358089-4358111 CTTTTCATAGGAAAACATATGGG + Intergenic
925814846 2:7737425-7737447 CTTTGCAAATGAAAACATATGGG + Intergenic
925823880 2:7827834-7827856 ATTTTAACAAGAAGACACTTAGG - Intergenic
925861709 2:8183906-8183928 CTTCTCAAAAGAAGGCATTTAGG + Intergenic
925916734 2:8612320-8612342 CTTTTAAAAAGAGGAAATTAAGG + Intergenic
925955326 2:8958455-8958477 CTTTTAAAATGAAGACTATTTGG - Intronic
926472190 2:13274418-13274440 TTTTTCACATGAAGACATTTTGG - Intergenic
926506698 2:13724837-13724859 CTTTCATAAAGAAGACATTTAGG - Intergenic
926763480 2:16301815-16301837 CTTCACAAAACAAGACTTTTTGG - Intergenic
926856234 2:17259257-17259279 CTTTCCTAAAGAAGAAATTAAGG + Intergenic
926887060 2:17607499-17607521 CTTTACAAAGGAAGACATTGAGG - Intronic
926898775 2:17726338-17726360 CATTTAAAAAGAATACCTTTAGG - Intronic
927052450 2:19344303-19344325 ATTTTCAAATTAAAACATTTGGG + Intergenic
927815407 2:26211975-26211997 CCTTTCAAAACAAGTCACTTGGG - Intronic
928027354 2:27751302-27751324 CATTTCAAAGTAAAACATTTAGG + Intergenic
928173362 2:29017719-29017741 ATTTTCAAAGGAGGACATTGAGG + Intronic
928441345 2:31294865-31294887 CATTTCAACAGAAGATTTTTTGG - Intergenic
928479112 2:31663659-31663681 CTTCTCAAAAGACGACATTTAGG + Intergenic
928667566 2:33565776-33565798 TTTTTCAAATGAAGAAATTGAGG - Intergenic
929204080 2:39270234-39270256 CTTTTCAAAATAAGAGTTGTGGG + Intronic
929357537 2:41044014-41044036 CTTTTCAAAAGAAGACATACAGG + Intergenic
929491982 2:42405306-42405328 CTTTTCAAAAGAATTGCTTTTGG + Intronic
929837600 2:45420979-45421001 GTTATTAACAGAAGACATTTTGG + Intronic
930027156 2:47035991-47036013 CTTCCCAAAAGAAGACGCTTAGG - Intronic
930154009 2:48087153-48087175 CTTTTCATAAGTAGTTATTTGGG + Intergenic
930457501 2:51624394-51624416 ATTTTGAAAAGAAAAGATTTTGG - Intergenic
930648869 2:53943935-53943957 CTTTTAAAAAGTATACTTTTAGG + Intronic
930679452 2:54240901-54240923 ATTTTAGAAAGAAGACATTTAGG + Intronic
930836995 2:55804761-55804783 CATTTTAAATGAAGCCATTTTGG - Intergenic
930925612 2:56815398-56815420 CTTTTAAAAAAGAGATATTTTGG + Intergenic
931270836 2:60701177-60701199 CTTTACAAATGAAGAAATTGAGG + Intergenic
931723392 2:65084077-65084099 CTTTTCATAAAAGGAAATTTGGG + Exonic
932056679 2:68452546-68452568 ACTTTCAAAATAAAACATTTAGG + Intergenic
932300165 2:70661358-70661380 CTTTTTAAAAGAAGGCATCAAGG + Exonic
932869769 2:75387039-75387061 CTTCTCAAAAGAAGACATTTAGG - Intergenic
933122441 2:78557004-78557026 CTTTTCAAAAACTAACATTTAGG - Intergenic
933529090 2:83483420-83483442 CTTTAAAAAAAAAGAAATTTAGG - Intergenic
933642063 2:84773871-84773893 CTTCTCAAAAGAAGACATACAGG - Intronic
935237992 2:101153766-101153788 CTTATAAAAAGAGGAAATTTGGG + Intronic
935602951 2:104941324-104941346 CTTTTTAAAATAATAAATTTGGG + Intergenic
935680234 2:105629548-105629570 CTTTTCAAATAAAAATATTTGGG + Intergenic
935680654 2:105633968-105633990 ATTTTTAAAAGAAGACATAGTGG + Intergenic
935753718 2:106261199-106261221 CATTTCAAAAAAAGAAATTCAGG - Intergenic
936005796 2:108886370-108886392 TTGTTCAAAAGAAGACATACAGG - Intergenic
936293219 2:111244171-111244193 TTTTTAAAAATAATACATTTTGG - Intergenic
936454147 2:112658404-112658426 CTTTTGAAAAGAATAGAATTGGG + Intronic
936514189 2:113171507-113171529 CTTTCCAACAGAAGCCATGTAGG + Intronic
936892174 2:117384287-117384309 TTTCTCAAAAGAAGACATGCAGG - Intergenic
936897809 2:117447603-117447625 CTTCTCAAAACAAGACTTTTAGG + Intergenic
936934731 2:117828111-117828133 CTTCTCAAAAGAAGACATTTAGG - Intronic
937584252 2:123526566-123526588 ATTTTTAAAATCAGACATTTAGG + Intergenic
938147022 2:128843385-128843407 TTTTTCAAAAGAAGATATACAGG - Intergenic
938158198 2:128959196-128959218 CCTTACAGATGAAGACATTTGGG + Intergenic
939186693 2:138869500-138869522 ATTTTTAAAAAAAGAAATTTGGG - Intergenic
939486087 2:142812545-142812567 CTTCTCAAAAGAAGACATGTAGG - Intergenic
939552939 2:143637855-143637877 CTTCTCAAAAGAAGACATTTAGG + Intronic
939556696 2:143683429-143683451 CTTTTGAAAAAAAAACATATTGG + Intronic
939574746 2:143882737-143882759 CTTTTTAAAGCTAGACATTTTGG - Intergenic
939837377 2:147147449-147147471 CTTCTCAAAAGAAGACATTTAGG - Intergenic
939863678 2:147448664-147448686 CTTTAAATAAGAATACATTTTGG - Intergenic
940037506 2:149326527-149326549 CTTTACCAAAGAAGATATATGGG - Intergenic
940082823 2:149823811-149823833 CTGTTGAACAGCAGACATTTAGG - Intergenic
940113765 2:150184630-150184652 ATTTTTAAAAGAAAAAATTTTGG - Intergenic
940354781 2:152728601-152728623 TTTTTCAAAATAAGCCATTCTGG - Intronic
940603085 2:155885558-155885580 CTTCTCAAAAGAAGACATTTGGG + Intergenic
941289210 2:163654268-163654290 GTATTTGAAAGAAGACATTTTGG + Intronic
941303861 2:163836234-163836256 GTTTTCAAAAGAACACACATGGG - Intergenic
941540566 2:166778378-166778400 TTTTTGAAATGAAGATATTTTGG + Intergenic
941979345 2:171437801-171437823 CTTTTCAAAAAAACAGCTTTTGG + Intronic
942152812 2:173094592-173094614 CTTTTAAGACGTAGACATTTTGG + Intronic
942224765 2:173805360-173805382 CTGTTCAAATGCAGACATCTGGG + Intergenic
942358580 2:175147162-175147184 CTTTTTAAAATATGACATGTAGG + Intronic
942529907 2:176898432-176898454 CTTTTTAAAAATAGCCATTTTGG + Intergenic
943039038 2:182781750-182781772 CTTCTCAAAAGAAGACATTTAGG - Exonic
943055441 2:182972287-182972309 TTTCTCAAAAGAAGACATACAGG + Intronic
943071574 2:183147018-183147040 CTTCTCAAAAGAAGACATGCAGG - Intronic
943395942 2:187334441-187334463 TTTTTCAAAAGAAGTCATACAGG + Intergenic
943498422 2:188653999-188654021 CTTCTCCAAAGAAGACATACAGG - Intergenic
943602136 2:189933531-189933553 TTTTTCCACAGAAGACAATTTGG - Intronic
943911340 2:193571907-193571929 CTTATGAAAAGAAGCCATGTGGG - Intergenic
944091782 2:195919643-195919665 CTTTAAAAAAGTAGACTTTTTGG - Intronic
944681473 2:202081174-202081196 CTTTGCAAAAGAAGGAAATTCGG - Intronic
945073910 2:206018061-206018083 CTTTTCCAAATAACACAATTTGG - Intronic
945167706 2:206963664-206963686 CTTTACAAAGGAAGAAAATTTGG - Intronic
945372747 2:209040162-209040184 TTTTTTAAAAGAAGATATATTGG - Intergenic
945586547 2:211671745-211671767 CTTTAAAAAAGAACATATTTAGG - Intronic
945865992 2:215176436-215176458 TTTCTCAAAAGAAGACATACAGG - Intergenic
945909361 2:215630374-215630396 CTTTTCAAAAGAAAACATACAGG - Intergenic
948134555 2:235627032-235627054 CTTTTCAACTTAAGACAGTTGGG - Intronic
948531047 2:238605820-238605842 CTTTTCTAATGAATGCATTTAGG - Intergenic
1169078799 20:2781443-2781465 TTTTTCCAAAGAGGAGATTTAGG + Intergenic
1169172823 20:3479190-3479212 CATTTCAAAAGAAGATAATAGGG - Intronic
1169242683 20:3997928-3997950 CTTTTCAGAGGAAGAGATTGAGG + Intronic
1169755831 20:9042312-9042334 CTTTTTAAAAGGAGTCACTTTGG + Intergenic
1169787072 20:9370557-9370579 TTTTTCATAAGAAGGCAATTTGG + Intronic
1170213221 20:13866214-13866236 CTTTCCAAAAGAATGCTTTTAGG - Intronic
1170649795 20:18228821-18228843 CTTTTAAAAAGAACAGTTTTAGG - Intergenic
1170739206 20:19039414-19039436 CTTTTCAAAAAATGACAATTTGG - Intergenic
1171152972 20:22844109-22844131 CTTTTAAAAAGGGGAAATTTGGG + Intergenic
1171315327 20:24186179-24186201 CTTCTCAAAAGAAGACATACAGG - Intergenic
1171535901 20:25889083-25889105 CTTCTCAAAAGAAGACATTGAGG + Intergenic
1171571959 20:26260821-26260843 CTTCTCAAAAGAAGACATTGAGG - Intergenic
1171805191 20:29672097-29672119 CTTCTCAAAAGAAGACATTGAGG - Intergenic
1171838868 20:30184336-30184358 CTTCTCAAAAGAAGACATTGAGG + Intergenic
1171897973 20:30828099-30828121 CTTCTCAAAAGAAGACAAGCCGG - Intergenic
1171988497 20:31677483-31677505 CTTTTGAAATAAGGACATTTTGG - Intronic
1172074564 20:32284345-32284367 GTTTACAAATGAAGACATTGTGG + Intronic
1172822933 20:37754527-37754549 CTTTTCAAGAGAATAAATATGGG + Intronic
1173482275 20:43411984-43412006 CTTTTTAAAAGAAGACATACAGG + Intergenic
1173931604 20:46825227-46825249 TTTCTCAAAAGAAGACATACAGG + Intergenic
1174232061 20:49053735-49053757 CTTTTCAATAGAACACACTTTGG - Intronic
1174970971 20:55275144-55275166 CTTCTCAAAAGAATACATTTAGG - Intergenic
1175342083 20:58238964-58238986 CTTTGCAAAAGAAGAAATCAAGG - Intergenic
1176634197 21:9173718-9173740 CATTTCAAAAGAAGAAATATTGG - Intergenic
1176639111 21:9281071-9281093 CATTTCAAAAGAAGAAATATTGG + Intergenic
1177205753 21:18009622-18009644 CTTTTCAAAAGAATAACATTTGG + Intronic
1177490758 21:21823083-21823105 TTTCTCAAAAGAAGATATATAGG - Intergenic
1177542173 21:22508475-22508497 CTTCTCAAGAGAAGACATACAGG - Intergenic
1178004342 21:28199708-28199730 TTTCTCAAAAGAAGACATACAGG + Intergenic
1178559336 21:33623662-33623684 CTTTATCAAAGAAGACTTTTAGG + Intronic
1179273634 21:39870626-39870648 CTTTTCAAAAGAACTCATTTAGG + Intronic
1180034164 21:45234660-45234682 CTTTACAAAAAAAAACCTTTTGG - Intergenic
1180372417 22:12053914-12053936 CATTTCAAAAGAAGAAATATTGG + Intergenic
1180390050 22:12221738-12221760 CATTTCAAAAGAAGAAATATTGG - Intergenic
1180415886 22:12712731-12712753 CATTTCAAAAGAAGAAATATTGG + Intergenic
1180423157 22:12888578-12888600 CATTTCAAAAGAAGAAATATTGG + Intergenic
1180542949 22:16469089-16469111 CTTCTCAAAAGAAGACAAACAGG + Intergenic
1182749690 22:32631755-32631777 CTTTACAGATGAAGACATTGAGG + Intronic
1182962254 22:34486449-34486471 CTTGGCAATAGAATACATTTTGG + Intergenic
1182977314 22:34635645-34635667 CTTTTCAAAAGAATAGAATTGGG + Intergenic
1183138388 22:35912704-35912726 CTTTTTAAAAGAAGATATATGGG + Intronic
1184597352 22:45522284-45522306 CACTTCAAAAGAAGAGAATTTGG - Intronic
1184657189 22:45947785-45947807 CGTTTCAGAAGCAAACATTTTGG - Intronic
1184910478 22:47529455-47529477 CTTTGAAAAAGAAGCAATTTTGG + Intergenic
1185164218 22:49249730-49249752 CTTCTCAAAAAAATAAATTTTGG + Intergenic
949103154 3:170488-170510 CTTTTCAGAAGAAGAAACTGAGG - Intergenic
949150890 3:765843-765865 CTTTTATTTAGAAGACATTTTGG + Intergenic
949247038 3:1937425-1937447 CTTTTCAAAAGAAGATATTTAGG + Intergenic
949393367 3:3587900-3587922 AGTTCCAAACGAAGACATTTTGG - Intergenic
949807265 3:7969380-7969402 TTTTTCAAAAGCAGACATCAAGG + Intergenic
950173645 3:10856496-10856518 CTTTACAAATGAAGATATTGAGG + Intronic
950393729 3:12717673-12717695 TTTTTAAAAAGGAGACATTCAGG + Intergenic
950607871 3:14099644-14099666 CTTTACAAAACAAGACAAATAGG - Intergenic
950684922 3:14609740-14609762 ATTTTTAAAAGTGGACATTTAGG - Intergenic
950752569 3:15141994-15142016 CTTTTCTAATGAAGACATCATGG - Intergenic
950954941 3:17042438-17042460 AATTTCAGATGAAGACATTTTGG + Intronic
951171816 3:19550998-19551020 CTTTTCAAAAAAACAGTTTTTGG + Intergenic
951265755 3:20563975-20563997 CTTATCAAAAGAATAAAGTTTGG + Intergenic
951380731 3:21981356-21981378 CTTCTCAAAAGAAGACATGCAGG - Intronic
951455148 3:22883429-22883451 CTTTTCAAAAGACGAGCTTTTGG - Intergenic
952039429 3:29243794-29243816 CCCTTCAAAACAAGATATTTGGG - Intergenic
952350106 3:32526968-32526990 CTTTTTAAATGAAGAGATATTGG - Intronic
952442362 3:33344767-33344789 CTTTTCAAAAGACCACTTTTGGG - Intronic
952519034 3:34136588-34136610 TTTTTTAAAAGAAGACATACAGG + Intergenic
952550638 3:34472404-34472426 CTCCTCAAAAGAAGACATTTAGG - Intergenic
952698023 3:36293147-36293169 CTTTCCAAAAGAATATATTTAGG + Intergenic
953015353 3:39070182-39070204 CATTTCAAAGAAAAACATTTTGG + Intronic
953128966 3:40119358-40119380 CTTTTCATAAGAACACATCCTGG - Intronic
954572418 3:51653134-51653156 CTTTTCAAAAGAAGACATTTAGG + Intronic
955724303 3:61916754-61916776 TTTTTCAAATGAAGACACTGAGG + Intronic
956355605 3:68389525-68389547 CTTTTTAAAAGAATATAATTTGG - Intronic
956608534 3:71098180-71098202 CCTTTCAAAATGAGAGATTTAGG + Intronic
956629552 3:71302564-71302586 TTTTTTAAAAGAAGACAAGTGGG - Intronic
956754246 3:72369596-72369618 CTTTACAAATGAGGACACTTGGG - Intergenic
956996972 3:74837568-74837590 CTTTTAAAAAGGAGACATTGTGG + Intergenic
957068044 3:75542293-75542315 CTTTTCTAATGAAGACATCATGG + Intergenic
957101094 3:75829746-75829768 CATTTCAAAAGAAGAAATATTGG - Intergenic
957400116 3:79700660-79700682 CTTTTCAAAAGAAGACATACAGG - Intronic
957417561 3:79926254-79926276 CTATCCAACAGAAGACATTGAGG - Intergenic
957633415 3:82748301-82748323 CTTTTCAAAAGAAGGCATACAGG + Intergenic
957705361 3:83773737-83773759 CTTCTCAAACGACGACATTTAGG + Intergenic
957717765 3:83953074-83953096 TTTTTCAAAAAAATACATCTAGG - Intergenic
957793858 3:84976259-84976281 CTTTTTGAAAGTTGACATTTTGG + Intronic
958179688 3:90044150-90044172 CTCTTGAATAGAAGAGATTTTGG + Intergenic
958211478 3:90484713-90484735 CATTTCCAAAGAAAACATCTAGG + Intergenic
958740831 3:98069074-98069096 CTTTTTAAAAGAACAGTTTTAGG + Intergenic
958758703 3:98281026-98281048 CTTCTCCAAAGAAGACATACAGG + Intergenic
958925442 3:100152029-100152051 CTATTCAAAAGAAGGCAAATAGG + Intronic
959179473 3:102960121-102960143 TTTATCAAAAGAAGACATACAGG - Intergenic
959341141 3:105133350-105133372 ATATTCAAAAGAAGAAACTTGGG + Intergenic
959435758 3:106313039-106313061 TTTCTCAAAAGAAGACATACAGG - Intergenic
959748002 3:109800087-109800109 CTTTTCAAAAGAAGACATTTAGG + Intergenic
960186692 3:114650135-114650157 CTTTTAAAAAGCAGACAATAGGG - Intronic
960341183 3:116477095-116477117 GTTTTCAAAAGCCAACATTTGGG + Intronic
960354971 3:116640387-116640409 GGTTTCATAAGATGACATTTTGG - Intronic
960402291 3:117216152-117216174 CTGTTGAAAACAAAACATTTTGG + Intergenic
960647249 3:119900293-119900315 CTTTTGAATAGAAGAGTTTTAGG - Intronic
960778490 3:121290108-121290130 CTTTTCAAAGAACCACATTTTGG - Intronic
961285114 3:125795720-125795742 CTTTTCTAATGAAGACATCATGG - Intergenic
961416157 3:126758816-126758838 CTTTCTAAAAGAACACATTCTGG - Intronic
961669102 3:128515235-128515257 CTTTCCACAAGAAAACATTAAGG - Intergenic
962109752 3:132431972-132431994 CTTTTAAAAAGTATACAATTTGG - Intronic
962239473 3:133739687-133739709 TGTCACAAAAGAAGACATTTAGG + Intergenic
962335168 3:134523188-134523210 CATTTCAAAAGAAGGCATACAGG - Intronic
962480110 3:135790671-135790693 CTTCTCAAAAGAAGACATTTAGG - Intergenic
962509999 3:136088876-136088898 CTTCTCAAAAGAAGACATACAGG - Intronic
962857587 3:139362873-139362895 CATTTCAAAAGAAGAAAACTAGG + Intronic
962947072 3:140181784-140181806 TTTTGCAAATGAAGACATTGAGG + Intronic
963273393 3:143307461-143307483 TTTTTCAAATGAGTACATTTAGG + Intronic
963535912 3:146528259-146528281 TTTTTCAAAAGAAGAAACTGAGG - Intronic
963775380 3:149433902-149433924 CTTTTAAAAATAAGACAAATAGG + Intergenic
963854121 3:150236793-150236815 CTCTTGCAAAGAAGACCTTTGGG + Intergenic
963858891 3:150286309-150286331 GCTGGCAAAAGAAGACATTTTGG + Intergenic
964022709 3:152033377-152033399 CTTCTCAGAAGAAGACATACAGG + Intergenic
964050912 3:152392519-152392541 CTTTTAAAAAGTAGAAATTCTGG - Intronic
964431834 3:156615548-156615570 CATTTTAAAAGGAGACATTTTGG - Intergenic
964440377 3:156702307-156702329 CTTTTCAAATGAAGAAACTGAGG - Intronic
964468960 3:157031229-157031251 GTTTTTAAAAGAAGCCACTTAGG + Intronic
964598152 3:158461464-158461486 CTTTTTAAAAAACAACATTTAGG + Intronic
964670047 3:159214960-159214982 CATTTCAAAAGAAGATATTGGGG + Intronic
964690589 3:159445231-159445253 CTTCTCAAAAGAAGACATTTAGG + Intronic
964730316 3:159857846-159857868 TTTTTCAAAAGAAGAAACTGAGG + Intronic
964731273 3:159867882-159867904 GCTTCTAAAAGAAGACATTTTGG - Intronic
965092080 3:164177425-164177447 CTCTTCAAAAGAATATATCTGGG - Intergenic
965527404 3:169735692-169735714 CTTTTCAAAAGAAGACATTTAGG + Intergenic
966089607 3:176117069-176117091 CTTCTCAAGAGAAGACATACAGG + Intergenic
966955065 3:184868127-184868149 CTTTTCAGAAGAAGATTATTTGG + Intronic
967122405 3:186394563-186394585 CTTCTCAAAAGAAGACATATAGG + Intergenic
967291712 3:187927148-187927170 GTCTTCAAAAGATGACATCTAGG + Intergenic
967420132 3:189263252-189263274 CTTTTCTAAAGAAGAAATTTTGG + Intronic
967674504 3:192280101-192280123 CTCTTTAAAAAAACACATTTAGG - Intronic
967694852 3:192518350-192518372 TTTTTAAAAAGAAAAAATTTAGG - Intronic
967764244 3:193260551-193260573 CTTCTGAAAAGAAGACATTCAGG + Intronic
968143408 3:196277316-196277338 ATTTTCTAAAGATGACTTTTGGG + Intronic
1202747784 3_GL000221v1_random:123948-123970 CATTTCAAAAGAAGAAATATTGG - Intergenic
968388360 4:166636-166658 CTTCTCAAAAGAAGACATTTAGG - Intergenic
968401364 4:301071-301093 CTTCTCAAAAGAAGACATTTAGG + Intronic
968408291 4:362164-362186 CTTCTCAAAAGAAGACATTTAGG - Intronic
969090467 4:4690277-4690299 ATTGTCCAAAGAAGACATTTAGG - Intergenic
969557394 4:7921823-7921845 TTTTTAAAAAGAAGACACATAGG + Intronic
969741462 4:9030900-9030922 CTTTTCTAATGAAGACATCATGG - Intergenic
969800825 4:9563784-9563806 CTTTTCTAATGAAGACATCATGG - Intergenic
969931902 4:10638890-10638912 CTTATGAAAAGAAGAAATTTGGG - Intronic
970128116 4:12837188-12837210 CTTTACAAATGAAGCAATTTGGG + Intergenic
970762374 4:19506581-19506603 CTTTTTAAAAGAAGAATTTTAGG + Intergenic
971443065 4:26710815-26710837 CTTCTCAAAAGAAGACATTTAGG - Intronic
971450903 4:26800793-26800815 CTTCTCAAAAGAAGATATTTAGG - Intergenic
971532567 4:27707556-27707578 TTTTAAAAAAGAAGATATTTAGG + Intergenic
971747020 4:30595152-30595174 CAATTAAAAATAAGACATTTAGG - Intergenic
971856139 4:32045918-32045940 CTTCTGGAAAGAAGACATTTAGG + Intergenic
972060063 4:34858665-34858687 CTTTTGAAAAAAAGAAATTTCGG - Intergenic
972118911 4:35676271-35676293 GTTTTGAAAACAAGCCATTTTGG - Intergenic
972148712 4:36062706-36062728 CTTCTCAGATGAGGACATTTGGG + Intronic
972419608 4:38874454-38874476 CTTCTCAAAAGAAAACATATAGG - Intronic
972642787 4:40940766-40940788 CTTTTCAAATGAAGGTGTTTTGG - Intronic
972681861 4:41314124-41314146 CTTCTCAAAAGAAGGCATTTAGG + Intergenic
972723535 4:41724949-41724971 TGTTTCTAACGAAGACATTTAGG - Intergenic
972902744 4:43704147-43704169 TTATTTAAAAGAAGACATATTGG - Intergenic
973089272 4:46112192-46112214 TTTTTCAAAAGAAGACATAGAGG + Intronic
973093126 4:46163325-46163347 CTTCTCAAAAGAAGACATACAGG + Intergenic
973125448 4:46577751-46577773 CTCTTCCAAACAAGACCTTTAGG - Intergenic
973908522 4:55554775-55554797 CTTTTTAAAAGACTACATTTGGG + Intergenic
974114156 4:57560069-57560091 CTTCTCAAATGAAGACATCTAGG - Intergenic
974126417 4:57701802-57701824 CTTCTCAAAGGAAGACATACAGG - Intergenic
974387870 4:61226286-61226308 CTTTTTAAAAGAAAACACTGTGG + Intronic
974497241 4:62647790-62647812 TTTTTCAGAAGAAGACATAGAGG - Intergenic
974517811 4:62939607-62939629 CTTCTCAAAACAAGACATACAGG - Intergenic
974680672 4:65157586-65157608 CTATTAAATACAAGACATTTTGG - Intergenic
974897763 4:67959551-67959573 CTTCTTAAAAGAAGACATACAGG + Intronic
974947694 4:68547780-68547802 CTTCTCAAAAGAAGACATTTAGG + Intronic
975011802 4:69364631-69364653 CTTCCCAAAAGATGACATTTAGG - Intronic
975060390 4:69989905-69989927 CTTTTCCAAAGATTACATTTTGG - Intergenic
975253290 4:72204652-72204674 CTTCTCAAAAGAAGACATATAGG + Intergenic
975299810 4:72776046-72776068 CTTTTCAAAAGAAGACATACAGG + Intergenic
975416851 4:74114459-74114481 CATTTCAAAAGAAGAGCTTAAGG - Intronic
975461277 4:74656228-74656250 CTTTTCAACACAAATCATTTTGG + Intergenic
975463280 4:74679841-74679863 CTTTTCAAAAAACAACCTTTTGG + Intergenic
975514172 4:75226694-75226716 CTTCTCAAAAGAAGACATTTAGG + Intergenic
975853375 4:78596727-78596749 ATTTTTAAAAAAAGAAATTTTGG - Intronic
976050038 4:81000819-81000841 ATTTTCCAAAGAAGTGATTTAGG + Intergenic
976270729 4:83227934-83227956 CTTATAATAAGAAGAAATTTGGG + Intergenic
976913568 4:90340495-90340517 CATTTAAAAATCAGACATTTTGG + Intronic
977013942 4:91669297-91669319 TTTTTCAAAAGAAGAAACTGAGG - Intergenic
977345750 4:95814107-95814129 ATTTTCAACAGATGATATTTAGG + Intergenic
977415434 4:96726842-96726864 CTACTGAAAAGCAGACATTTTGG - Intergenic
977447501 4:97149233-97149255 CATATAAAAAGAAGACATTGAGG + Intergenic
977653660 4:99497464-99497486 CTTCTCAAAAGAAGACATTTAGG + Intergenic
977829886 4:101577833-101577855 CTTCTCAAAAGAAGACATTTAGG + Intronic
977868444 4:102059649-102059671 CTTTTCAAAAGAGTTTATTTTGG - Intronic
977985557 4:103378805-103378827 CTTCTCAAAAGAAGACATATAGG + Intergenic
978338465 4:107695927-107695949 CTTCTCAAAAGAAGACACTTAGG + Intronic
978403635 4:108356962-108356984 CCTTTAAAAAGAAGAAATTGTGG - Intergenic
978456045 4:108893025-108893047 TTTATGAAAAGAAGACAGTTTGG + Intronic
978808900 4:112829536-112829558 CTTCTCAAAAGAAGACACACAGG + Intronic
978811318 4:112852886-112852908 GATTTTAAAAGAAAACATTTGGG + Intronic
979073110 4:116236831-116236853 TATTTCAATAGAAGATATTTGGG - Intergenic
979090382 4:116476759-116476781 CTTCTCAAAAGAAGACATACAGG + Intergenic
979145458 4:117240650-117240672 CTTTTTAAAATGAGACTTTTTGG + Intergenic
979185534 4:117786932-117786954 TTTCTCAAAAGAAGACATACAGG - Intergenic
979394201 4:120166293-120166315 TTTTTCAAAAGAATACATACAGG + Intergenic
979491027 4:121328096-121328118 CTAATCAAAAGAAGAAAGTTTGG - Intergenic
979609736 4:122676731-122676753 TTTCTCAAAAAAAGACATTCAGG + Intergenic
979695255 4:123605931-123605953 CTTCTCAAAAGGAGACATACAGG + Intergenic
979796256 4:124850356-124850378 CTTATAAGAGGAAGACATTTGGG - Intergenic
979801962 4:124921242-124921264 ATTGTAAAAAGAAGAAATTTTGG + Intergenic
980198152 4:129618492-129618514 CTTTTCAAAATAAAAAATATAGG - Intergenic
980378587 4:131978905-131978927 CTTTTCATAAGAAGACATTCAGG + Intergenic
980493127 4:133555426-133555448 TTCTTCAGAAGCAGACATTTTGG - Intergenic
980553926 4:134377841-134377863 CTTTGCAAAAGAAGATATCTTGG + Intergenic
980568055 4:134571641-134571663 CTTTTTAAAAGAAGACATTTAGG - Intergenic
980703718 4:136464466-136464488 CTTCTCAAAAGAAGATATTTAGG + Intergenic
980843132 4:138290943-138290965 CTTCTCAAAAGAAGGCATACAGG - Intergenic
981282438 4:142973941-142973963 CTTTTTAAAATAAGCCCTTTTGG + Intergenic
981439487 4:144767154-144767176 CTTTTCAAAAGAAGACACACAGG + Intergenic
981497560 4:145411215-145411237 CTTTTAAAGAGAAGACATGGTGG - Intergenic
981894986 4:149788029-149788051 TTTTTCAAAAGAACACATACAGG + Intergenic
982010780 4:151104234-151104256 CTTTTCTAACGAAGACATCATGG - Exonic
982305569 4:153927132-153927154 CTTTACAAATGAGGATATTTAGG - Intergenic
982676049 4:158376882-158376904 CTTTTCAACACATGAAATTTGGG + Intronic
982752982 4:159184528-159184550 CTTCTCAAAAGAAGACATTTAGG - Intronic
983384976 4:167049861-167049883 CTTTTCATGAGAAGACATGGTGG - Intronic
983411994 4:167411880-167411902 CTTTTCAAAATACACCATTTAGG - Intergenic
983500477 4:168493780-168493802 CTTTAAAAAAAAAGACATTGTGG + Intronic
983808088 4:172019276-172019298 TTTTTCAAAAGAGGACATACAGG - Intronic
983818122 4:172157734-172157756 CTTTTTAAAAGATGAAATGTAGG - Intronic
984001028 4:174245245-174245267 CTTTTCATAAGCATTCATTTAGG - Intronic
984024987 4:174532137-174532159 CTTTTAAAGAAAAGACACTTTGG + Intergenic
984113939 4:175654712-175654734 CTTCTTAAAAGAACACCTTTGGG + Intronic
984326583 4:178262060-178262082 CTTCTCAAAAGAAGAAACTGTGG + Intergenic
984711810 4:182892015-182892037 CAATTAAAAAGAAGACATTTGGG + Intronic
984881915 4:184417371-184417393 CTTTGCAGATGAAGAAATTTAGG - Intronic
985076070 4:186216194-186216216 CTTTTAAAAACAAGAGATTGAGG - Intronic
1202754008 4_GL000008v2_random:39484-39506 CATTTCAAAAGAAGAAATATTGG + Intergenic
986723618 5:10578047-10578069 CTCTTCAACAGAGGACATATAGG - Intronic
986883069 5:12199315-12199337 GTTTTCAAATGAAAACATTTAGG - Intergenic
987117252 5:14735732-14735754 CTTTTTAGAGGAAGAAATTTGGG - Intronic
987300695 5:16595559-16595581 CTTTTCATAGGAAGAATTTTTGG - Intronic
987633484 5:20507498-20507520 ATTTTCATGAGAACACATTTAGG + Intronic
987665112 5:20927040-20927062 TTTATCAAAAGAAGGCATATAGG - Intergenic
987820884 5:22964987-22965009 CTTCTCAAAAGAAGACAGATAGG - Intergenic
987909679 5:24125083-24125105 CTCCTCAGAATAAGACATTTAGG - Intronic
987952181 5:24689307-24689329 TTTCTCAAAAGAAGACATACAGG + Intergenic
987955255 5:24730304-24730326 GTTTTAAAAAGAAGACATTATGG + Intergenic
988211015 5:28203445-28203467 ATTTTCAATAAAAGACATTCAGG - Intergenic
988288628 5:29255557-29255579 CTATGCAAAAGTAGTCATTTAGG - Intergenic
988415816 5:30946111-30946133 CATTTCAAAATAGGTCATTTTGG - Intergenic
988656147 5:33213967-33213989 CTTTTCAAATATAAACATTTGGG - Intergenic
988757575 5:34275140-34275162 TTTATCAAAAGAAGGCATATAGG + Intergenic
989075207 5:37558286-37558308 GTGTTCAAAACAAAACATTTAGG - Intronic
989128340 5:38078810-38078832 CTTATCAAATGAAGACATTCTGG + Intergenic
989401053 5:41008102-41008124 CTTATCAAAAGAACTCTTTTAGG - Intronic
989407124 5:41074062-41074084 CTTTTCAAAAGAAGACATTTAGG - Intergenic
989460301 5:41690184-41690206 TTTTTCAAAAGATGACATACAGG - Intergenic
989700699 5:44261262-44261284 CTGGTGGAAAGAAGACATTTGGG - Intergenic
989845026 5:46130880-46130902 CTTCTCAAAAGATGACATTTAGG + Intergenic
989951776 5:50307884-50307906 CTTCTCAAAAGAAGAAATTTAGG - Intergenic
990027785 5:51216382-51216404 ATTTACAAAAGAAGACACTGAGG + Intergenic
990248957 5:53893304-53893326 CTTTTTAAAGGGACACATTTAGG + Intronic
990588886 5:57241800-57241822 CTTTTAAAATGTAAACATTTGGG + Intronic
990667632 5:58091813-58091835 CCTTTCTAGAGAAGACTTTTGGG - Intergenic
990670853 5:58128610-58128632 ATTCTAAAAAGAAAACATTTAGG - Intergenic
990868556 5:60406235-60406257 GTTTTAAAAAGAAGATATGTAGG - Intronic
991066508 5:62430326-62430348 CTTTTTAAAAGAAGATAATGAGG - Intronic
991112044 5:62911456-62911478 CTTCTCAAAAGAAGACCTAAAGG - Intergenic
991762636 5:69935605-69935627 TTTATCAAAAGAAGACATGCAGG + Intergenic
991784690 5:70182516-70182538 TTTATCAAAAGAAGACATGCAGG - Intergenic
991841864 5:70810645-70810667 TTTATCAAAAGAAGACATGCAGG + Intergenic
991877136 5:71182896-71182918 TTTATCAAAAGAAGACATGCAGG - Intergenic
992032399 5:72735076-72735098 CTTCTCAAAAGAAGACATACAGG - Intergenic
992038032 5:72800973-72800995 CATTACAAAAGAAGCAATTTAGG + Intergenic
992347334 5:75893210-75893232 CTTCTCAAAAGAGGACATACAGG - Intergenic
992399597 5:76400284-76400306 CTTGTCAAAAGAAAACAGATGGG + Intergenic
992695669 5:79284284-79284306 CTTTTCTAACGAAGACATCATGG + Intronic
992704363 5:79373912-79373934 CAATTCAAATGGAGACATTTTGG + Exonic
992712049 5:79468451-79468473 CTTTTAAAAAGATAGCATTTTGG + Intronic
992844366 5:80730527-80730549 CTTTTTAAAATAAAACATTTTGG - Intronic
993931808 5:93950390-93950412 CTTTTAAATAAAAGTCATTTTGG + Intronic
994111474 5:96009583-96009605 CTTCTCAAAAGAAGACATATAGG - Intergenic
994263901 5:97692009-97692031 CTTTTCAGAACATGACCTTTTGG + Intergenic
994344285 5:98666054-98666076 CTTCTCAAAAGAAGACATTTAGG + Intergenic
994541405 5:101102808-101102830 CTTCTTCAAAGAAGACATCTTGG + Intergenic
994558411 5:101334004-101334026 TTTTTCAAAACAAGACATACAGG + Intergenic
994563203 5:101404235-101404257 ATTTTCAAATGAAGAGATTGTGG + Intergenic
994579335 5:101618598-101618620 CTCTTAAAAGGAAAACATTTAGG - Intergenic
994672398 5:102778169-102778191 CTCTTCAAAAAAATACATGTGGG - Intronic
994770753 5:103978629-103978651 TTTCTCAAAAGAAGACATAGAGG + Intergenic
994805694 5:104445036-104445058 CTTTTGAAAAGAACAAATATAGG + Intergenic
994873893 5:105390518-105390540 CTTTTCAAACAATGACCTTTTGG - Intergenic
994880625 5:105489554-105489576 CTTTTATCAAGAAGATATTTTGG - Intergenic
994920655 5:106038975-106038997 TTTTTCAAAAAAAGAAATTTAGG + Intergenic
994998625 5:107098684-107098706 CTCTTCAAAAGAAAAGATCTGGG - Intergenic
995244422 5:109920508-109920530 CTTTACAAAAGAAGACATAGAGG - Intergenic
995295141 5:110511670-110511692 CTTTCCATATGAAGACATTTAGG + Intronic
995352238 5:111192378-111192400 CTTTTCTAACGAAGACATCATGG + Intergenic
995460874 5:112401564-112401586 CTTCTTAAATTAAGACATTTGGG - Intronic
995541348 5:113189195-113189217 CTCTTCCAAAGAGGACATGTAGG - Intronic
995665896 5:114541793-114541815 CTTATCAAAAGAAGACATACAGG - Intergenic
995731869 5:115253449-115253471 TTTTTCAAAAGGGGACATTTGGG + Intronic
995809395 5:116087290-116087312 CTTTTCAGCAGAAGTAATTTTGG + Intronic
996074282 5:119171589-119171611 TATTTAAAAATAAGACATTTAGG - Intronic
996142399 5:119928432-119928454 CTTTCCAAAAGAAGACATACAGG - Intergenic
996239641 5:121179987-121180009 ATCTTTAAAAGAAGACTTTTTGG - Intergenic
996286671 5:121802388-121802410 CTTTTAAAAATAAGCCTTTTGGG + Intergenic
996413319 5:123182339-123182361 CTTTTCAAAAGCAGAGATACAGG + Intronic
996496432 5:124162311-124162333 CTTTTAAAAATAAAGCATTTGGG + Intergenic
996525327 5:124473185-124473207 CTTCTCAAAAAGAGAAATTTGGG - Intergenic
996635411 5:125683282-125683304 ATTTTCAAAAGCAGCCATCTTGG + Intergenic
996689274 5:126320769-126320791 CTTCTCCAAAGAAGACATACAGG - Intergenic
996725514 5:126670534-126670556 CTTCTCAACAGAAGACATTTAGG + Intergenic
996758534 5:126962327-126962349 TTTTCCAAATGAAGAAATTTAGG - Intronic
996893318 5:128448622-128448644 CTTTACAATACAAGACAATTAGG - Intronic
997608877 5:135196683-135196705 TTTCTCAAAAGAAGACATACAGG - Intronic
997816819 5:137027384-137027406 CTCTACAAAAGAAGCCACTTTGG - Intronic
998057917 5:139095158-139095180 CATTTCTAAAGAACACATTTTGG - Intronic
998484365 5:142488662-142488684 TTTTTCAAAATAAAACATTTGGG - Intergenic
998575043 5:143306099-143306121 TTTTTTAAAAAAAAACATTTAGG + Intronic
998704101 5:144739000-144739022 CTTCTCAAAAGAAGATATTTAGG + Intergenic
998911162 5:146961973-146961995 GTTTTCAACAGAAAACACTTTGG + Intronic
999576330 5:152982107-152982129 ATTTTAAACTGAAGACATTTAGG + Intergenic
999605631 5:153311940-153311962 CTTTTAAAAAGATGCCATTTGGG - Intergenic
999615991 5:153424993-153425015 CTTTTCAAAAGAAGACATACAGG + Intergenic
999825220 5:155267177-155267199 TTTTTTAAAAAAAGACATCTTGG - Intergenic
1000107741 5:158076316-158076338 CTTTTCAAAGGAGGGCATTTAGG + Intergenic
1000488464 5:161878758-161878780 GTTTCCAAAAGAAGAGATTTGGG + Intronic
1000657137 5:163893130-163893152 GTTATCAATAGAAGAAATTTTGG - Intergenic
1000701353 5:164454896-164454918 CTTTTCATTGGAAAACATTTTGG - Intergenic
1000783800 5:165517579-165517601 CTTTTTAAATAAACACATTTTGG + Intergenic
1000949040 5:167457943-167457965 ATTTTCAAATGCAGTCATTTGGG + Intronic
1001241391 5:170073871-170073893 CTTTTCAAAGAAACAAATTTTGG + Intronic
1001357165 5:171039365-171039387 CTTTTCAGAAGAAGACATACAGG - Intronic
1001992687 5:176131340-176131362 CAGCTCAAAAGTAGACATTTTGG - Intronic
1002002407 5:176204806-176204828 CGGCTCAAAAGTAGACATTTTGG - Intergenic
1002224191 5:177706805-177706827 CAGCTCAAAAGTAGACATTTTGG + Intergenic
1002365227 5:178704634-178704656 GTTGTCAACAGAAGAGATTTGGG + Intergenic
1002653231 5:180719620-180719642 CATTTCAAATGAAAACATTCAGG - Intergenic
1002797491 6:486493-486515 CATTTCAAATGAGGTCATTTTGG + Exonic
1002851240 6:998227-998249 CTTTTCCAGAGAACACAATTCGG + Intergenic
1002949949 6:1799957-1799979 TTTTTTAAAAAAAGACATTAAGG - Intronic
1003079696 6:3011736-3011758 CTTCTCAACAGAAAACATATAGG + Intronic
1003254654 6:4464326-4464348 CTTTATAAAAGAGGAAATTTAGG + Intergenic
1003432289 6:6050691-6050713 CTTTTAAAAACCATACATTTTGG - Intergenic
1003658588 6:8038782-8038804 CTTTTTAATAAAAGCCATTTTGG - Intronic
1003998826 6:11573306-11573328 CATTTCAAAAAAATAAATTTAGG - Intronic
1004299820 6:14447065-14447087 CTTATCAAAAGAAAAAATTTGGG - Intergenic
1004771723 6:18790811-18790833 CTTTTCAAAAGAAGACATACAGG - Intergenic
1004823962 6:19400413-19400435 TTTTTCAAAATAAGAGAATTAGG - Intergenic
1004872257 6:19918629-19918651 CTTTTCAAAAGAACACCTAGAGG + Intergenic
1005110423 6:22275377-22275399 CTTTTCAATAGTAGCCATTCTGG + Intergenic
1005555641 6:26979670-26979692 TTCTTCAAAAGAAAATATTTTGG - Intergenic
1005584344 6:27261118-27261140 TCTTTCAAAAGAAGAAATGTGGG + Intergenic
1005647729 6:27857149-27857171 CTTTTAAGAAGAGGAAATTTGGG + Intronic
1005777993 6:29159262-29159284 CTTCTCAAAAGAAGACATAAAGG + Intergenic
1005863611 6:29921410-29921432 CTTCTCAAAAGAAGACATACAGG + Intergenic
1005907743 6:30279350-30279372 TTTCTCAAAAGAAGACATACAGG - Intergenic
1007160245 6:39785709-39785731 ATTTTCAAAAGGAAATATTTGGG - Intergenic
1007311101 6:40946597-40946619 CTTTTGAAAAGGGGACGTTTTGG - Intergenic
1007998379 6:46333095-46333117 CTTCTCAAAAGAAGACATTTAGG - Intronic
1008256558 6:49308686-49308708 CTTCTCAAAAGAACACACATAGG + Intergenic
1008265568 6:49421531-49421553 CTTTACTATAGAAGGCATTTGGG - Intergenic
1008341552 6:50370384-50370406 TTTCTCTAAAGAAGATATTTAGG - Intergenic
1008451985 6:51663139-51663161 CTTTTCCAAATAAGATAGTTAGG + Intronic
1008608547 6:53164850-53164872 CTTCTCAAAAGAAGACATACAGG + Intergenic
1008696504 6:54044664-54044686 TATTTCAAAAGAAGACCTTAAGG + Intronic
1008707218 6:54177399-54177421 ATTGTCAAAAGAAGACATTTAGG + Intronic
1008886364 6:56435197-56435219 AATTCCAAAAGAACACATTTTGG - Intergenic
1008939639 6:57032384-57032406 ATTTCCAAAAGAAGAAATATTGG + Intergenic
1009196298 6:60689985-60690007 CTTTTAAAATTTAGACATTTTGG + Intergenic
1009239247 6:61163753-61163775 GTTCTCAAAAGAAGACATTTAGG - Intergenic
1009272438 6:61630801-61630823 CTGTCCCAAAGATGACATTTTGG + Intergenic
1009300449 6:62010843-62010865 TTTTTAAAAAGTAAACATTTTGG - Intronic
1009460934 6:63912603-63912625 CATTTCAACATAAGAGATTTTGG - Intronic
1009597366 6:65752935-65752957 CTTCTCAAAAGAAGATATTTAGG + Intergenic
1009771414 6:68146888-68146910 CTTTTCAAAAGAAAACATACAGG - Intergenic
1010261001 6:73816744-73816766 CTTTTCAAAATTAGAATTTTAGG - Intronic
1010267986 6:73889150-73889172 CATTTAGAAAGAATACATTTGGG - Intergenic
1010484706 6:76396145-76396167 TTTCTCAAAAGAAGACAAGTGGG + Intergenic
1010499411 6:76578455-76578477 CTTTTCAAAAGATGCCATTCTGG + Intergenic
1010787084 6:80016450-80016472 ATGTTCAAAAGTAGACATTAAGG - Intronic
1011231007 6:85162075-85162097 CATTTGAAAGGAACACATTTTGG + Intergenic
1011257564 6:85438682-85438704 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1011595717 6:89014017-89014039 CTTTTCAAAAGAAGAAATAATGG - Intergenic
1011612377 6:89166273-89166295 CTTTTAAAAAGAACAGATTTGGG - Intergenic
1012332280 6:98007804-98007826 CTTTTCAAAAAAACAGCTTTTGG + Intergenic
1012390696 6:98736289-98736311 CTTTTCAAAGGTAGAAATTGAGG - Intergenic
1012503405 6:99916116-99916138 CTTCTCAAAAGAAGACATTCAGG - Intergenic
1012592797 6:101003671-101003693 CTTCTCAAAAGAAGGCATACAGG - Intergenic
1012644624 6:101663596-101663618 CTTTTTAAAAGAAGACACAGAGG - Intronic
1012771381 6:103439181-103439203 CTTTTCAAAAGACCCCATTATGG + Intergenic
1012832204 6:104218399-104218421 GTTCTCAAAAGAAGACATAAAGG - Intergenic
1012883688 6:104820542-104820564 CTTCTCAAAAGAAGACATATAGG + Intronic
1013047701 6:106503813-106503835 CTTTTTAAAAGAAGCTTTTTGGG + Intergenic
1013109745 6:107055386-107055408 TTTTTTTAAAGTAGACATTTGGG - Intergenic
1013278458 6:108609956-108609978 TTTTTGAAAAGAAAACAGTTGGG + Intronic
1014108072 6:117589618-117589640 CTTTTAAAAAAAAAACATTAGGG - Intronic
1014108239 6:117591151-117591173 CTTTTTAAAATTGGACATTTGGG - Intronic
1014183950 6:118414156-118414178 CTTCTCAAAAGAAGACATACAGG + Intergenic
1014290883 6:119557007-119557029 CTTTTCAGAAGAAGAGATTGAGG - Intergenic
1014381029 6:120742732-120742754 CTTTTCAAAGGAACACACATTGG + Intergenic
1014839978 6:126207523-126207545 CTTTACAAAAAGGGACATTTTGG - Intergenic
1014934493 6:127371337-127371359 CTTTTCAAAAAGCTACATTTGGG + Intergenic
1015000164 6:128204619-128204641 TTTCTCAAAAGAAGACATATAGG + Intronic
1015292542 6:131553877-131553899 CTTCTAAAAAGAAGACATTTAGG - Intergenic
1015493934 6:133860214-133860236 CTTCTCAAAAGATGACATATGGG - Intergenic
1015730123 6:136338847-136338869 TTTTTGGAAAGAAAACATTTTGG + Intergenic
1016270478 6:142282846-142282868 CTTCTCAATAGAAGACATTTAGG + Intergenic
1016542626 6:145182792-145182814 CCTTTCAAAGGAGTACATTTTGG + Intergenic
1017017203 6:150111080-150111102 TTTTTCAAATGAAGACACTGGGG + Intergenic
1017323696 6:153122291-153122313 CTTTTCAAAATATTACATTTTGG + Intronic
1017766519 6:157611298-157611320 CTTTTTAAAAGTACACATATTGG - Intronic
1018265693 6:162022464-162022486 CTTCTCAAAAGAAGACATATAGG - Intronic
1019425895 7:976482-976504 CTTATAAAAAGAGGAAATTTAGG - Intergenic
1019657746 7:2205814-2205836 CTTTACAAGAGAAGATATATAGG - Intronic
1019862790 7:3675818-3675840 CTTCTCAAAAGAAGACATACGGG - Intronic
1020108228 7:5432637-5432659 CTTATAAAAAGAGGACATTTGGG + Intronic
1020189282 7:5982671-5982693 CTTTAAAAAAGAAGAGATCTAGG - Intronic
1020193025 7:6015019-6015041 CCCTTTAAAAGAAGACATTATGG - Intronic
1020293637 7:6741983-6742005 CTTTAAAAAAGAAGAGATCTAGG + Intergenic
1020354120 7:7258239-7258261 CTTTTCAAAATACCAAATTTCGG + Intergenic
1020419824 7:7989577-7989599 CTTTACCAAAGCAGACTTTTGGG - Intronic
1020647451 7:10832150-10832172 CTTCTGAAAAGAAGACATTCAGG + Intergenic
1021061234 7:16115603-16115625 ATTTTTAAAAAAAGAAATTTAGG + Intronic
1021282221 7:18735023-18735045 CTTCTCAAAAGAAGACATTTAGG - Intronic
1021511217 7:21434611-21434633 CTTTTAAAAAAAATAGATTTAGG + Intronic
1021698289 7:23294225-23294247 CTTTTCAAGAGAAGACAAACAGG - Intergenic
1021824576 7:24536198-24536220 TTTTTCAATAGCAAACATTTAGG - Intergenic
1022017058 7:26359150-26359172 TATTTTAAAAGAAGACTTTTTGG + Intronic
1022068022 7:26881526-26881548 ATTTTCAAAATAGGAAATTTTGG + Intronic
1022137708 7:27465256-27465278 ATTTTGAAAAAAAGACACTTTGG + Intergenic
1022198619 7:28094560-28094582 CTTTTCAGCAGATGACAGTTTGG - Intronic
1022255754 7:28655792-28655814 CTTTGCAAATGAACACATTTTGG + Intronic
1022293692 7:29029009-29029031 TTTCTCAAAAGAAGACATACAGG + Intronic
1022459578 7:30592948-30592970 GTTTTCAAAAGAAAACTGTTTGG + Intergenic
1022614602 7:31916421-31916443 CTGTTCTTAAGAAGACAGTTTGG - Intronic
1022686312 7:32600626-32600648 CTCCTCTAAAGAAGACATCTAGG + Intergenic
1022810519 7:33863546-33863568 TTGTTCAAAAGCAGACATTGTGG + Intergenic
1023058816 7:36310653-36310675 CTTTTAAAAAGTATACATTTTGG - Intergenic
1023333341 7:39142157-39142179 CCTTACATTAGAAGACATTTTGG - Intronic
1023641125 7:42259756-42259778 CCCACCAAAAGAAGACATTTAGG + Intergenic
1024144871 7:46504033-46504055 CCTTTCAATAAAAGACATTTTGG - Intergenic
1024288782 7:47784772-47784794 CTTTTAAAAAGAAGCTATTGTGG - Intronic
1024493557 7:50015754-50015776 CTTCTCAAAAGAAGACATATAGG + Intronic
1024633860 7:51270737-51270759 ATTTTGAAAAAAAGACCTTTGGG - Intronic
1024917604 7:54520461-54520483 CTTTAAAAAATAAGACATTTGGG + Intergenic
1025287366 7:57675779-57675801 CTTCTCAGAAGAAGACATTGAGG + Intergenic
1025887222 7:65607807-65607829 CTTCTCAAAAGAAGACATACAGG - Intergenic
1026390092 7:69892090-69892112 CTTTGCTAAAGAAGATATCTGGG - Intronic
1026779023 7:73251312-73251334 CTTTTAAAAAGAAGTATTTTAGG + Intergenic
1026855862 7:73754326-73754348 CTATTTAAAAAAAGAAATTTAGG + Intergenic
1027019883 7:74804716-74804738 CTTTTAAAAAGAAGTATTTTAGG + Intronic
1027057945 7:75063225-75063247 CTTTTGAAAAGTTGAGATTTGGG - Intronic
1027068143 7:75141225-75141247 CTTTTAAAAAGAAGTATTTTAGG - Intronic
1027513439 7:79111310-79111332 CTTGTCAAGAGAACACAATTTGG - Intronic
1027790120 7:82629410-82629432 TATTTCAGAGGAAGACATTTTGG + Intergenic
1027814792 7:82954526-82954548 TTTTTCAACAGAAGAAATTGAGG - Exonic
1027848616 7:83419715-83419737 CTTCTAAAAAGAAGACATACAGG - Intronic
1027898621 7:84079557-84079579 CTTCTCAAAAGAAGACATTTAGG + Intronic
1028040460 7:86046027-86046049 CTTCTTAATAGAAGACATATTGG + Intergenic
1028306321 7:89269850-89269872 CTTCTCAAAAGAAGACATTTAGG - Intronic
1028416982 7:90590925-90590947 CTTTATAAAAGGAAACATTTTGG + Intronic
1028560496 7:92169644-92169666 CGTCTCAAAAAAAGAAATTTTGG + Intronic
1028777470 7:94695177-94695199 CTTTTCTAACGAAGACATCATGG + Intergenic
1028969592 7:96842997-96843019 CTTCCCAAAAAAAGACATTTAGG - Intergenic
1029071048 7:97898484-97898506 CTTTTCTAATGAAGACATCATGG + Intergenic
1029137692 7:98385946-98385968 CTTTTCTAACGAAGACATCATGG + Intronic
1029725530 7:102401332-102401354 ATTTTCAAAATAAAACATTAGGG + Intronic
1030562928 7:111113662-111113684 CATTTCAGATGAAAACATTTGGG - Intronic
1030566599 7:111165246-111165268 CTTTAAAAAAGAAGAAAGTTCGG - Intronic
1030573174 7:111252106-111252128 CTTCTCAAAATAGGTCATTTGGG + Intronic
1030922094 7:115403840-115403862 CTTCTCAAAAGAAGACATACAGG + Intergenic
1030966862 7:116004183-116004205 CTTTTCAAAAAATCATATTTAGG - Intronic
1030972021 7:116070371-116070393 ATTTTCAAATGAATACATTTTGG - Intronic
1031006618 7:116480274-116480296 CTTCTCAAAAGAAGACATTTAGG - Intronic
1031032560 7:116750775-116750797 CTTCTCAAAAGAAGACATTTAGG + Intronic
1031245404 7:119305110-119305132 CTTCTCAAAAGACGACATAATGG - Intergenic
1031247322 7:119331259-119331281 CTTCTCAAAAGAAGATATACAGG - Intergenic
1031714869 7:125096473-125096495 CTTTTCAAAACTAGTTATTTTGG - Intergenic
1031726165 7:125242245-125242267 CTTTTAGAAATATGACATTTGGG + Intergenic
1031750101 7:125561585-125561607 CTGTTGAAAAGAAGGCATTGAGG - Intergenic
1031855190 7:126914126-126914148 CTTCTCAAAAGAAGACATACAGG + Intronic
1031922949 7:127614733-127614755 CTTTTCAAAAGAAAAACTTATGG + Intronic
1032005291 7:128297350-128297372 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1033393802 7:140954640-140954662 CTTTTCAAAACTAGCTATTTTGG - Intergenic
1033592493 7:142822961-142822983 CTTTTCCAAAGAAGATAATCAGG - Intergenic
1033794781 7:144834551-144834573 CTTTTGAAAATAAGACATTCAGG - Intronic
1033954034 7:146821676-146821698 CTTCTCAAAAGAAGACATTTAGG + Intronic
1034012809 7:147548392-147548414 CTTTTCAAAAGAAGACATTTAGG - Intronic
1034542324 7:151766350-151766372 CTTGTCAAAAGGAGACATTTTGG + Intronic
1035116277 7:156527019-156527041 ATGTTGCAAAGAAGACATTTGGG + Intergenic
1035349347 7:158235061-158235083 CTTTTCAATAAGAGCCATTTTGG - Intronic
1035371900 7:158385168-158385190 GGTTTACAAAGAAGACATTTAGG - Intronic
1035435385 7:158855868-158855890 TTTATCAAAAGACGACATATGGG + Intergenic
1035754462 8:2021417-2021439 CTTTTCAAAAGAACACAGAAAGG - Intergenic
1035758761 8:2054184-2054206 CTTTGCAAAAGATGAAATTGTGG + Intronic
1035935645 8:3834922-3834944 CTTCTCAAAAGAAGACATTTAGG + Intronic
1035978350 8:4338844-4338866 CTTTTTGAAAGAAGAAATTATGG + Intronic
1036026368 8:4913499-4913521 CTGTTTAAAATAAGACATATGGG - Intronic
1036128581 8:6086560-6086582 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1036254141 8:7190927-7190949 CTTTTCTAATGAAGACATCATGG + Intergenic
1036363351 8:8096560-8096582 CTTTTCTAATGAAGACATCATGG - Intergenic
1036716477 8:11128946-11128968 CTTTTGAAAAAAAGACTTTCTGG - Intronic
1036887606 8:12570494-12570516 CTTTTCTAATGAAGACATCATGG + Intergenic
1036895204 8:12628620-12628642 CTTTTCTAATGAAGACATCATGG + Intergenic
1037125649 8:15345537-15345559 CTTCTCAAAAGAATACATTTAGG - Intergenic
1037176225 8:15949609-15949631 CTTTGCAAAAGAAGGCCATTTGG + Intergenic
1037179607 8:15989641-15989663 CTTTTCAAAAAATAAAATTTTGG + Intergenic
1037241250 8:16780783-16780805 TTTTTCAGAAAAAGACATTTAGG - Intergenic
1037501748 8:19493040-19493062 TTTTTCAAAAAAAGAATTTTAGG - Intronic
1037716242 8:21403320-21403342 ATGTTCAAAAGAAAACAATTTGG + Intergenic
1038298495 8:26319589-26319611 CTTTTCAAAACATGAGAGTTAGG - Intronic
1038323779 8:26554310-26554332 CTTTTCAAAAGAAGACATACAGG - Intronic
1039204686 8:35139098-35139120 CATTCCAAAACAAGACCTTTTGG + Intergenic
1039577504 8:38635322-38635344 CTTCTCAAAAGAAGATATACAGG - Intergenic
1039707168 8:40019331-40019353 CTTTTCAAAAAAACACCTTCTGG + Intergenic
1040557166 8:48490878-48490900 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1040762365 8:50864467-50864489 CTTCTCAAAAAAAGACATAGAGG + Intergenic
1040875218 8:52143591-52143613 CCTTTCAAAAGTTCACATTTTGG + Intronic
1040992290 8:53365561-53365583 CTTTTAAAACCTAGACATTTCGG - Intergenic
1041216484 8:55606674-55606696 CATTTCATAAAAAGTCATTTGGG + Intergenic
1041218604 8:55626574-55626596 CTTTACACCAGAACACATTTTGG + Intergenic
1041262264 8:56032070-56032092 TTTTTCAAAAGAAGACATACAGG + Intergenic
1041514257 8:58682744-58682766 CTTTAAAAAAGAAGAAAATTCGG + Intergenic
1041575195 8:59386182-59386204 TTTCTCAAAAGAAGACATTTAGG + Intergenic
1041620981 8:59969075-59969097 GGTTTCAAAAGAAGAAATTGGGG - Intergenic
1041850639 8:62388088-62388110 CTATTTAAAATAAAACATTTTGG - Intronic
1042400460 8:68339982-68340004 CTTTTCATAAGAAGATGTATAGG + Intronic
1042495276 8:69448748-69448770 GTTTTCCAAAGATGCCATTTTGG + Intergenic
1042596666 8:70456023-70456045 CTTTATAGATGAAGACATTTGGG + Intergenic
1042687372 8:71457115-71457137 CTTCTCAAAAGAAGACCTTTAGG + Intronic
1042780590 8:72486840-72486862 CTTCTCAAAAGAAGACATACAGG + Intergenic
1042811384 8:72829102-72829124 CTTTTCAAAAGATATAATTTTGG - Intronic
1043233796 8:77835062-77835084 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1043315188 8:78911875-78911897 ATATTCAAAAGCACACATTTTGG - Intergenic
1043569490 8:81586629-81586651 CTTCTCAAAAGAAGACATACAGG - Intergenic
1043618473 8:82158213-82158235 ATTTTCAAGAGGAGAAATTTAGG + Intergenic
1043627268 8:82277151-82277173 CTTTTCAAAAAAACATCTTTTGG - Intergenic
1043644956 8:82506049-82506071 ATTTTCAAAAAAAAAAATTTTGG - Intergenic
1043817847 8:84825199-84825221 TTTCTCAAAAGAAGACATACAGG + Intronic
1043947848 8:86274491-86274513 CTTTTCAAGAGTACAAATTTTGG + Intronic
1044055104 8:87559021-87559043 CTTCTCAAAAGAAGACATGCAGG - Intronic
1044159899 8:88900121-88900143 CTTTTCAAAAAAACAGCTTTTGG - Intergenic
1044242860 8:89907054-89907076 CTTCTCAAAAGAAGACATACAGG - Intronic
1044273053 8:90269445-90269467 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1045014461 8:97987884-97987906 CTTCTAAAAAAAACACATTTTGG - Intronic
1045807962 8:106187698-106187720 CTTTTAAAAAGATGACATGTTGG + Intergenic
1045866952 8:106878213-106878235 CATTACTAAAGAAGCCATTTGGG - Intergenic
1045956562 8:107915121-107915143 CTTTTCCATAGAACACATCTGGG + Intronic
1045975488 8:108126735-108126757 CTTCTCAAAAGAAGACATTGAGG + Intergenic
1046157013 8:110305342-110305364 CTTCTCAAAAGAAGATATGCAGG + Intergenic
1046186489 8:110727979-110728001 CTTTGAAAAAGAAGAAAATTTGG + Intergenic
1046315442 8:112495326-112495348 CTTTTCAAAAGATGAATATTAGG - Intronic
1046333382 8:112751606-112751628 TTTTTCAAAATAAGAAGTTTAGG + Intronic
1046392823 8:113599318-113599340 TTTTTAACAAGAAAACATTTTGG + Intergenic
1046922978 8:119753750-119753772 ATTTTCTAAAGAAGATGTTTTGG - Intronic
1047055579 8:121160948-121160970 TTTTTCAAATGAAGAAATTGAGG + Intergenic
1047326487 8:123842539-123842561 CTATTCTCAAGAAGAAATTTTGG - Intergenic
1047652561 8:126938911-126938933 ATTTTCAAAAGTAGATATCTAGG - Intergenic
1047667153 8:127104617-127104639 CAATTCAAATGAAGACTTTTGGG + Intergenic
1048132012 8:131708215-131708237 TTTCTCAAAAGAAGACATACAGG + Intergenic
1048464384 8:134653255-134653277 TTTTTTTAAAAAAGACATTTGGG - Intronic
1050033260 9:1408429-1408451 AATTCTAAAAGAAGACATTTAGG - Intergenic
1050319810 9:4439981-4440003 CTTCTCAAAAGAAGACATGTAGG - Intergenic
1050656698 9:7836506-7836528 CTTCTCAAAATAAGACATTTAGG - Intronic
1050724799 9:8636523-8636545 CTTTTTAAAAAAGGAAATTTGGG - Intronic
1050737230 9:8777909-8777931 CTATACAACAGAAGAAATTTTGG + Intronic
1050862974 9:10459691-10459713 CTTCTCAAAAGAAGACATTTAGG - Intronic
1050971295 9:11879061-11879083 CATTACAAAACAGGACATTTTGG - Intergenic
1050993955 9:12189978-12190000 CTTTCAGAAAGAAGAGATTTAGG - Intergenic
1050997494 9:12238740-12238762 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1051524249 9:18025053-18025075 CTTCTTAAAAGAAGACATACAGG - Intergenic
1051566280 9:18502637-18502659 CCTTTCAAAAGTACAGATTTTGG + Intronic
1051743990 9:20277441-20277463 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1052421364 9:28246961-28246983 CTTCTTTAAAGAAGAAATTTAGG + Intronic
1052467965 9:28853916-28853938 CTTTTCAAAAGAGGAAATTGTGG - Intergenic
1052501260 9:29293302-29293324 CTCCTCAAAAGAAGACATGCAGG - Intergenic
1052511574 9:29428375-29428397 CTCCTCAAAAGAAGACATTTAGG + Intergenic
1052604466 9:30681430-30681452 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1052617347 9:30857660-30857682 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1052882441 9:33611647-33611669 ATTTACAAAAGAAGATATATGGG - Intergenic
1053027880 9:34745763-34745785 CATTTCAAAAGTAAACAATTAGG + Intergenic
1053033062 9:34798990-34799012 CTTCTCAAAAGAAGATATACAGG - Intergenic
1053205302 9:36181308-36181330 TTTCTCAAAAGAAGACATGCAGG + Intergenic
1053555238 9:39131006-39131028 CTTTTCAAAAGAGGAGAAATAGG + Intronic
1053578265 9:39375342-39375364 TTTTTCAAAAGAAGACATACAGG - Intergenic
1053819359 9:41951257-41951279 CTTTTCAAAAGAGGAGAAATAGG + Intronic
1053842795 9:42203390-42203412 TTTTTCAAAAGAAGACATACAGG - Intergenic
1054099848 9:60934153-60934175 TTTTTCAAAAGAAGACATACAGG - Intergenic
1054109624 9:61094910-61094932 CTTTTCAAAAGAGGAGAAATAGG + Intergenic
1054121247 9:61209776-61209798 TTTTTCAAAAGAAGACATACAGG - Intergenic
1054586493 9:66972732-66972754 TTTTTCAAAAGAAGACATACAGG + Intergenic
1054611233 9:67236215-67236237 CTTTTCAAAAGAGGAGAAATAGG - Intergenic
1055053543 9:72002949-72002971 CTTTCAAAAAAAAGGCATTTGGG - Intergenic
1055219813 9:73915223-73915245 CTTTTTAAAAGATACCATTTTGG - Intergenic
1055283765 9:74705818-74705840 TTTGTCAAAAGAAGACATACAGG + Intergenic
1055294776 9:74823095-74823117 TTTTCCAAAAGAAGAAAATTTGG + Intronic
1055533707 9:77214270-77214292 CATCTCAAAAAAAGACATATTGG + Intronic
1055745163 9:79436136-79436158 CTTCTCAAAAGAAGACATACTGG + Intergenic
1055871850 9:80889922-80889944 GTTTTCATAAGAAGCAATTTTGG + Intergenic
1056330304 9:85515699-85515721 CTTTTTAAGAAAAGGCATTTAGG + Intergenic
1056515651 9:87346734-87346756 CTTTTAAAAGGAAGACACATTGG + Intergenic
1056626555 9:88258359-88258381 CATCTCACAAGAAAACATTTTGG + Intergenic
1057410080 9:94810225-94810247 CTTTTCCAGAGAAGAAAATTAGG - Intronic
1057591089 9:96374083-96374105 CTTTTCAAAATAAAAAGTTTGGG + Intronic
1057881893 9:98798297-98798319 CTTCTCAAAAGAAGACATACAGG - Intergenic
1058112833 9:101050272-101050294 TTTTCCAAAAAAAGACATTGAGG - Intronic
1058217965 9:102258383-102258405 TTTCTCAAAAGAAGACATACAGG - Intergenic
1058601649 9:106676890-106676912 CTTCTTAAAAGAAGAAAGTTAGG - Intergenic
1058614793 9:106814524-106814546 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1058615603 9:106824063-106824085 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1058756183 9:108084908-108084930 CTTTCCAGAAAAAGACATTATGG + Intergenic
1058767517 9:108196291-108196313 CTTTTCAAATGAAGCAATTGAGG - Intergenic
1059198335 9:112391938-112391960 CTTTGCAAAAGAAGGTATTGGGG + Intronic
1059410919 9:114131817-114131839 TTTTTCAAAAGAAGAAAAATAGG - Intergenic
1059650448 9:116311352-116311374 CTTATCGAAAGAAGCTATTTTGG - Intronic
1059994809 9:119898409-119898431 CATCTCAAAAGAATACACTTTGG + Intergenic
1060171874 9:121468640-121468662 CTTTCTAAAAGGATACATTTAGG + Intergenic
1060324606 9:122601484-122601506 CTTTTCAAAAGATCAAATTTTGG - Intergenic
1060704075 9:125781629-125781651 CTTTTCAAAGAAACAAATTTTGG + Intronic
1062127910 9:134874651-134874673 CTTTTAAAAAAAACAAATTTGGG - Intergenic
1062296705 9:135834013-135834035 TTTTTCCAAAGAAGACATACAGG + Intronic
1062434176 9:136539210-136539232 CTTTTCAATGGAAAACATGTTGG + Intronic
1203753591 Un_GL000218v1:103099-103121 TTTCTCAAAAGAAGGCATTCAGG + Intergenic
1203757036 Un_GL000218v1:141354-141376 CATTTCAAAAGAAGAAATATTGG - Intergenic
1203716419 Un_KI270742v1:154029-154051 CATTTCAAAAGAAGAAATATTGG - Intergenic
1203534795 Un_KI270743v1:24210-24232 CATTTCAAAAGAAGAAATATTGG + Intergenic
1203650647 Un_KI270751v1:117584-117606 CATTTCAAAAGAAGAAATATTGG - Intergenic
1185933877 X:4233808-4233830 CTTTTTAAAAGAGGAGATTCTGG - Intergenic
1186304713 X:8243481-8243503 CTGTTCAAAAGAAGAACTATAGG - Intergenic
1186552864 X:10525167-10525189 CTTTTCTAAATAAAAAATTTAGG - Intronic
1186709334 X:12176222-12176244 ATTTTCAAAAGAAGTCCCTTAGG + Intronic
1186774055 X:12846506-12846528 CTCTTCAGAAGAAGATCTTTCGG + Intergenic
1187029335 X:15469607-15469629 GTCTTAAAAAGAAGAAATTTGGG + Intronic
1187685973 X:21815817-21815839 CTTTACACAAGAAGAAATTCAGG + Intergenic
1188043528 X:25398744-25398766 CTTCTTAAAAGAAGACATACAGG + Intergenic
1188161378 X:26808112-26808134 GTTTTCCAAAGAAGACATACGGG - Intergenic
1188177779 X:27014463-27014485 CTTCTCAAAATAAGACATGCAGG - Intergenic
1188227960 X:27625200-27625222 GTTTTCAAAAGAAGGCATTCAGG + Intronic
1188327269 X:28821111-28821133 ATTTTTAAAAGAACAAATTTAGG + Intronic
1188429128 X:30085615-30085637 CTTCTCAAAAGAAGACATACAGG + Intergenic
1188476719 X:30600294-30600316 ATCTTCAAAAGACGATATTTGGG + Intergenic
1188513630 X:30962295-30962317 CTTTTCAAATGAAGAATTGTTGG + Intronic
1188591618 X:31843500-31843522 CTTCTCAAAAGAAGACAAACGGG - Intronic
1188666944 X:32835844-32835866 CTTTTCAAAATGATACTTTTTGG - Intronic
1188743596 X:33815296-33815318 CTTTTCAAAAGAAGACATATAGG - Intergenic
1188848965 X:35109105-35109127 CTTCTCAAAGGAAGACATACAGG + Intergenic
1188851682 X:35140182-35140204 CTTCTCGAAGGAAGACATTTAGG + Intergenic
1189176087 X:38958887-38958909 ATTTACAAAAGAAGAAACTTAGG - Intergenic
1189196061 X:39153931-39153953 CTTATTAACAGAAGACACTTTGG + Intergenic
1190684540 X:52859793-52859815 CTTCTCAAAAGAAGACACTTAGG + Intergenic
1190686955 X:52883341-52883363 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1190699027 X:52972451-52972473 CTTCTCAAAAGAAGACATTTAGG + Intronic
1190905694 X:54725206-54725228 CTTCTCAAAAGAAGGCATACAGG - Intergenic
1191579170 X:62741163-62741185 TTTTTCAAACTAAGACTTTTGGG - Intergenic
1191828919 X:65393986-65394008 CTTCTCAAAAGAAGACATTTAGG - Intronic
1192091841 X:68167211-68167233 TTTCTCAAAAGAAGACAAATGGG + Intronic
1192596951 X:72420534-72420556 CTTTTCAAAGAAACAAATTTTGG + Intronic
1192716278 X:73645697-73645719 CTTCTCAAAAGAAGACATACAGG - Intronic
1192791453 X:74385799-74385821 TTTTTGAAAACAGGACATTTTGG - Intergenic
1192916786 X:75660131-75660153 CTTCTCAAAAGAAGACATACAGG - Intergenic
1193381667 X:80823009-80823031 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1193456755 X:81740909-81740931 CTTCTCAAAGGAAGACATACAGG - Intergenic
1193547739 X:82850417-82850439 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1193633428 X:83918389-83918411 TTTTTAAAAAGCAGAAATTTGGG + Intergenic
1193754393 X:85389380-85389402 CTTTTCAAAAGAAGACTTACAGG + Intergenic
1193814953 X:86093500-86093522 CTCTTCCAAATAAGTCATTTAGG - Intergenic
1193863843 X:86704649-86704671 CTTATCAAAAGAAGATATACAGG + Intronic
1193866017 X:86730720-86730742 GTTTTCAAAAGAATAAATATGGG - Intronic
1193894357 X:87093863-87093885 CTTTTAAAAAGCAGACATACAGG - Intergenic
1194013473 X:88589971-88589993 CTTTTCAAAAGAAGACATACAGG + Intergenic
1194094003 X:89614095-89614117 CTTCTCAAAAGAAGACATACAGG - Intergenic
1194175444 X:90641098-90641120 CTTCTCAAAAGAAGACATTTGGG - Intergenic
1194178168 X:90678058-90678080 GATTTTAAAAGAAGATATTTTGG + Intergenic
1194231032 X:91323910-91323932 GTTCTCAAAAGAAGACTTTTAGG + Intergenic
1194258013 X:91658034-91658056 GTTTTCAAAAGATGACATACTGG - Intergenic
1194568995 X:95529893-95529915 TTTTTTAAAAAAAGACTTTTCGG + Intergenic
1194689716 X:96968517-96968539 CTTCTCAAAAGAAGACATATGGG - Intronic
1194703734 X:97148735-97148757 TATTTCAAAATAAGACATTGTGG + Intronic
1194801970 X:98285211-98285233 CTTCTCAAAAAAAGAAATATGGG - Intergenic
1194836043 X:98684200-98684222 TTTATCAAAAGAAGACATAAAGG - Intergenic
1195088233 X:101433913-101433935 TTTTTAAAAAGAAGATATCTTGG + Intronic
1195155651 X:102121098-102121120 ACTTTCAAAAGAAGACATACAGG + Intergenic
1195548865 X:106143944-106143966 CTTTTCAAAAGAAAGCATACAGG + Intergenic
1195769342 X:108332635-108332657 TTTTTCAAAAGAAGAAATGCAGG - Intronic
1196059484 X:111391923-111391945 TTTTTCAAAATAAGAAACTTTGG + Intronic
1196422359 X:115536262-115536284 ATTTTAATATGAAGACATTTGGG - Intergenic
1196730830 X:118939829-118939851 ATTTTCATAAAAAGAAATTTAGG + Intergenic
1196932390 X:120695218-120695240 CCTTTCAAAAGAAGGAAATTTGG - Intergenic
1197051690 X:122066733-122066755 CTTCTAAAAAGAAGACATTTAGG + Intergenic
1197120919 X:122891291-122891313 TTTTTAAAATGAAGACACTTGGG - Intergenic
1197317813 X:124990281-124990303 CATTTCATAATAATACATTTTGG + Intergenic
1197371247 X:125628375-125628397 TTTCTCAGAAGAAGAAATTTGGG - Intergenic
1197399115 X:125966804-125966826 TTTCTCAAAAGAAGACATACAGG - Intergenic
1197562607 X:128042437-128042459 CTTCTCAGAAGAAGACATACAGG - Intergenic
1197573008 X:128172837-128172859 TTTCTCAAAAGAAGACATGGAGG + Intergenic
1197875570 X:131101112-131101134 CCTTTTAAAAAAACACATTTTGG + Intergenic
1197995864 X:132372348-132372370 CTTTAAAAAAGAATATATTTAGG + Intronic
1198013735 X:132587587-132587609 TTTGTGAAAAGAATACATTTTGG + Intergenic
1198089769 X:133316403-133316425 TTACTCAAAAGAAGCCATTTAGG - Intronic
1198277266 X:135107033-135107055 CTTCTCAAAAGAAGACATACAGG - Intergenic
1198958956 X:142163500-142163522 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1198991338 X:142518032-142518054 CTTCTCAAAAGGAGACATTTAGG - Intergenic
1199070917 X:143474552-143474574 TTTTTCAAAAGAAGCCTTTGAGG - Intergenic
1199215337 X:145255027-145255049 CTCTTCAAAACCTGACATTTTGG - Intronic
1199481240 X:148300537-148300559 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1199483751 X:148326287-148326309 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1199563667 X:149191228-149191250 CTTCTCAAAAGAAAACATACAGG - Intergenic
1199564102 X:149196260-149196282 CTTCTCAAAAGAAGACATTTAGG + Intergenic
1199925680 X:152461187-152461209 CTTTTCAAAGAAAGACATACAGG + Intergenic
1200296218 X:154923534-154923556 GTTTTAAAAAGAAGAGTTTTTGG + Intronic
1200298434 X:154946923-154946945 TTTCTCAAAAGAAGACATTCAGG + Intronic
1200373438 X:155753065-155753087 GTTTTTTAAAGAATACATTTGGG - Intergenic
1200446624 Y:3270239-3270261 CTTCTCAAAAGAAGACATACAGG - Intergenic
1200524828 Y:4260205-4260227 GATTTTAAAAGAAGATATTTTGG + Intergenic
1200557967 Y:4661878-4661900 CTTTTCAAAAAAGGAAAATTTGG - Intergenic
1200576777 Y:4897534-4897556 GTTTTCAAAAGATGACATACTGG - Intergenic
1200628908 Y:5556419-5556441 CTTCTCATAAGAAGACATACAGG - Intronic
1200670769 Y:6087014-6087036 CTTTTTAATAGAAAACATTGAGG - Intergenic
1200835940 Y:7731261-7731283 CATTTCAGATGAAGACATTGAGG + Intergenic
1200874131 Y:8135103-8135125 CTTTTCAAAATAAGACATTTAGG - Intergenic
1200878701 Y:8188546-8188568 CTCCTCAAAAGAAGACACTTAGG - Intergenic
1200879044 Y:8193250-8193272 TTTTTCAGATGAACACATTTGGG + Intergenic
1201170616 Y:11258978-11259000 CATTTCAAAAGAAGAAATAATGG - Intergenic
1201621871 Y:15968049-15968071 CTTCTCAAAAGAAGACGTTTAGG - Intergenic
1201703343 Y:16908207-16908229 ATTTTAAAAAGAAAACATTATGG - Intergenic
1201778260 Y:17690139-17690161 GTTCTCAAAAGAAGACATTTAGG - Intergenic
1201823296 Y:18215853-18215875 GTTCTCAAAAGAAGACATTTAGG + Intergenic
1201946032 Y:19511154-19511176 TTTTTGAAAAGAAGACCTATAGG + Intergenic
1202064200 Y:20920696-20920718 CTTCTCAAAAGAAGACATTTAGG - Intergenic
1202602384 Y:26607101-26607123 CTTCTCAAAAGAAGAAATTTAGG + Intergenic