ID: 1111861918

View in Genome Browser
Species Human (GRCh38)
Location 13:93718426-93718448
Sequence ATCCTTCGCCTACTTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3619
Summary {0: 4, 1: 7, 2: 90, 3: 376, 4: 3142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111861916_1111861918 11 Left 1111861916 13:93718392-93718414 CCTAAATGTCTTCTTTTGAAAAG 0: 9
1: 86
2: 91
3: 198
4: 918
Right 1111861918 13:93718426-93718448 ATCCTTCGCCTACTTTTGATGGG 0: 4
1: 7
2: 90
3: 376
4: 3142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111861918 Original CRISPR ATCCTTCGCCTACTTTTGAT GGG Intronic
Too many off-targets to display for this crispr