ID: 1111866417

View in Genome Browser
Species Human (GRCh38)
Location 13:93774246-93774268
Sequence GAGGTTAGGTCTTCAAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111866413_1111866417 6 Left 1111866413 13:93774217-93774239 CCAGGAGAGTAGAACTGGAACAT 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG 0: 1
1: 0
2: 2
3: 15
4: 253
1111866410_1111866417 24 Left 1111866410 13:93774199-93774221 CCTAAGTAACGCAGGTGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG 0: 1
1: 0
2: 2
3: 15
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111866417 Original CRISPR GAGGTTAGGTCTTCAAGAAG AGG Intronic
902039438 1:13482220-13482242 GAGCTTAGGTCTTACAGGAGAGG + Intronic
902961354 1:19965254-19965276 GAGGTTAGGACTTCAACATACGG - Intergenic
904439887 1:30523455-30523477 AAGGCTATGTCATCAAGAAGGGG - Intergenic
905811056 1:40913528-40913550 GAGGCTAGGTGTTCAAGACCTGG - Intergenic
906703587 1:47877781-47877803 GAGGTTAGGAGTTCAAGACCAGG + Intronic
906779747 1:48562411-48562433 GAGGTTAAGCCTTCAATAAGAGG - Intronic
907131967 1:52105052-52105074 GAGGGCAAGTCTCCAAGAAGGGG + Intergenic
907629573 1:56066692-56066714 GGAGTTAGCCCTTCAAGAAGAGG - Intergenic
907895686 1:58687968-58687990 AATGTTAGGTCTTAAAGAGGAGG - Intronic
908752467 1:67437513-67437535 CAGGTTAGACCTTCAAGAATGGG - Intergenic
909800176 1:79796851-79796873 GAGGCTAGGTCTTTAGGAAATGG + Intergenic
909944553 1:81649131-81649153 GAGGTAGGGTATTCCAGAAGAGG - Intronic
912230328 1:107785519-107785541 GAGCTTGGGGGTTCAAGAAGGGG + Intronic
913442519 1:118913578-118913600 GAGGCTAAGTCATCAAGAAAGGG + Intronic
917732007 1:177883766-177883788 GAGGTTAGATCATCAGGATGTGG + Intergenic
921857370 1:220001548-220001570 GAGGTTAGGAGTTCAAGACCAGG - Intronic
922077960 1:222266595-222266617 GAGGTGAGCACTTCAGGAAGAGG - Intergenic
922667169 1:227480450-227480472 GAGGGAAAGTCTTCAAAAAGAGG + Intergenic
923131255 1:231076747-231076769 GAGGTTAGGACTTCAACATGTGG - Intergenic
923162472 1:231327627-231327649 GAGGTTAGGAGTTCAAGACCAGG - Intergenic
923315961 1:232780306-232780328 GAAGCTAGGTCTTCAGGGAGTGG - Intergenic
924251998 1:242142142-242142164 GAGATGAAGTCTTCATGAAGAGG - Intronic
924323696 1:242874464-242874486 GAGGTTGGGAGTTCAAGACGAGG + Intergenic
924497445 1:244603790-244603812 GAGGCCAGGTGTTCAAGATGAGG + Intronic
1062904742 10:1172252-1172274 GAGGGTGCGTCTTCAGGAAGAGG + Intergenic
1063602161 10:7492113-7492135 GAAGTTTGGTCTTTAAGGAGGGG - Intergenic
1063780602 10:9318302-9318324 GAGGTCAGGACTTCAAGACCTGG - Intergenic
1064509785 10:16077345-16077367 GAGGTTAGGAGTTCAAGACCAGG + Intergenic
1068669867 10:59711522-59711544 GAGGTTAGGCGTTCAAGACCAGG - Intronic
1069384504 10:67872382-67872404 GAGGTCAGGAGTTCAAGACGAGG - Intergenic
1069489406 10:68848449-68848471 CAGGTTAGATATTTAAGAAGGGG + Intronic
1070585196 10:77760028-77760050 GAGGTTAGGAGTTCAAGACACGG + Intergenic
1073273132 10:102283905-102283927 GATGTTAAGTCTCCAAGGAGGGG + Intronic
1073615624 10:104991922-104991944 GGGGTTAGGACTTCAACATGTGG + Intronic
1073778947 10:106815870-106815892 GAGGCTACTTCTACAAGAAGAGG + Intronic
1076329455 10:129653980-129654002 GAGGTGGGGTCTCCAAGCAGGGG - Intronic
1080866480 11:36199951-36199973 GAGGTCAGGAGTTCAAGAACAGG + Intronic
1082670582 11:56032293-56032315 GAGGCTCTATCTTCAAGAAGAGG + Intergenic
1083858424 11:65405406-65405428 GAGGTCAGGAGTTCAAGAACAGG + Intronic
1084568742 11:69946520-69946542 GAGCTTAGGACTTAGAGAAGAGG + Intergenic
1086645653 11:89216735-89216757 GAAGTTAGATCTTCAAGATCTGG + Intronic
1088317494 11:108522052-108522074 TAGGATAGGTCTTGAAGTAGAGG - Intronic
1089598077 11:119594783-119594805 GGGGTTAGGGCTTCAAGTATGGG + Intergenic
1089640916 11:119846684-119846706 GAGGTTAGGGCTTCAACAGATGG + Intergenic
1089793009 11:120958010-120958032 GAGCTCAGGTCTCCAGGAAGAGG + Intronic
1090017046 11:123095481-123095503 GAGGTTAGGAGTTCAAGATCAGG - Intronic
1090831968 11:130426563-130426585 GAGGGTAAGGCTTCCAGAAGAGG - Intronic
1092788509 12:12051451-12051473 GAGTTAAGGTATTCAAGCAGAGG - Intronic
1093301871 12:17468834-17468856 GGGGTTAGGTCTTCAACATATGG + Intergenic
1093698314 12:22188753-22188775 GAGGGCAGGTCTTCTAGCAGTGG + Intronic
1093750199 12:22789687-22789709 GAGAATATGTCTTCAACAAGTGG - Intergenic
1095455720 12:42383763-42383785 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1096301434 12:50431629-50431651 GAGGTCAGGGGTTCAAGAACAGG + Intronic
1096794860 12:54070217-54070239 AGGGTTAGGACTTCAAGAAATGG + Intergenic
1097305824 12:58067942-58067964 GAGGTAAAGTCTTCAGGATGTGG + Intergenic
1098290641 12:68954420-68954442 GAGGGTAGTGCTTCAAGGAGAGG - Intronic
1098815777 12:75160055-75160077 GGGGTTAGGCCTTCAACAAATGG - Intronic
1099046862 12:77731829-77731851 GTGGTTAGGTGCTGAAGAAGCGG + Intergenic
1101080217 12:101173886-101173908 GTGGTTAGCTCTTCAAGCCGGGG + Intronic
1102193571 12:111007897-111007919 AAGGTTAGGGCTTCAACATGTGG + Intergenic
1102234069 12:111283260-111283282 CAGGTTAGGCCTTCAGGATGTGG + Intronic
1103487360 12:121292340-121292362 GAGGTTAGGAGTTCAAGATCAGG - Intronic
1106288590 13:28339999-28340021 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1106310130 13:28546936-28546958 GAGGTCAGGTGTTCAAGACTAGG - Intergenic
1107115050 13:36738033-36738055 GAGGTTGGGGCTTAAGGAAGAGG + Intergenic
1108755104 13:53490924-53490946 AAGGTTAGCTCTTCAAGGAGGGG + Intergenic
1110299612 13:73910781-73910803 GAGGTAAGGGCTTTATGAAGTGG + Intronic
1110865154 13:80385431-80385453 GAGGTTAGGGCTTCAACATGTGG + Intergenic
1110961716 13:81634653-81634675 GTGGTTAGATTTTCAAGAAGAGG + Intergenic
1111772457 13:92615686-92615708 CAGTTTAAGTCTCCAAGAAGGGG + Intronic
1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG + Intronic
1112168217 13:96942754-96942776 GAGCTTGGGCATTCAAGAAGGGG - Intergenic
1112694925 13:101937285-101937307 GGGGTTAGGTCTTCAACATATGG - Intronic
1114811893 14:25910514-25910536 GAGGTAAGGTTTTCAAAAACAGG + Intergenic
1115095570 14:29631711-29631733 GAGGTTAGGAGTTCAAGACCAGG - Intronic
1115999657 14:39229291-39229313 GAGGTTAGGTCCTCTAGAAGCGG + Intergenic
1116957454 14:50939248-50939270 GAGGTTAGGAGTTCAAGACCAGG - Intronic
1120039073 14:79731697-79731719 GAGGTCAGGTGTTCAAGACCAGG - Intronic
1120098219 14:80413750-80413772 GAGGTTAGCTCTACAAGTATTGG - Intergenic
1121231538 14:92362331-92362353 GAGGTTAGAGCAACAAGAAGGGG - Intronic
1124688115 15:31799401-31799423 GAGGTTATGTCTTCAACACAGGG - Intronic
1126293326 15:47107942-47107964 GAGATTCGGACTTCAAAAAGAGG - Intergenic
1128727692 15:69999962-69999984 GGGGTTAGGGCTTCAACATGTGG + Intergenic
1128908688 15:71492498-71492520 GAGGTTAGGGGTTCAAGACCAGG - Intronic
1129098463 15:73235015-73235037 TATGTAAGGTATTCAAGAAGTGG + Intronic
1132192030 15:99873129-99873151 AAGTTTAAGTCTCCAAGAAGGGG - Intergenic
1135612290 16:23878960-23878982 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1135732647 16:24907496-24907518 GAGGTCAGGTGTTCAAGACCAGG + Intronic
1136669147 16:31839949-31839971 GAGGCTAGGTCTTCGAGGGGTGG - Intergenic
1136674519 16:31890828-31890850 GAGGTGGGATCTTTAAGAAGTGG - Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1140032234 16:71348095-71348117 AGGGTTAGGGCTTCAACAAGTGG + Intergenic
1140102034 16:71926066-71926088 GAGGTCAGGTGTTCAAGACCAGG + Intronic
1141335640 16:83152731-83152753 GAGGTTAGGACTTCAACACATGG - Intronic
1141341706 16:83209794-83209816 GAGGTTAAGTCTGCATGGAGTGG + Intronic
1144751112 17:17648643-17648665 GGGGTTAGGACTTCAACATGGGG - Intergenic
1145235770 17:21207314-21207336 GAGGTCAGGACTTCAAGACCAGG + Intronic
1145765886 17:27457798-27457820 GAGGTTCCTTCTTCAAGACGGGG - Intronic
1146114465 17:30122615-30122637 GAGGTCAGGAGTTCAAGAACAGG - Intronic
1147973765 17:44235941-44235963 GAGGTGAGTCCTTCTAGAAGAGG - Intergenic
1149062070 17:52434349-52434371 GAGGTAAAGTCTTTAGGAAGTGG + Intergenic
1149247445 17:54727589-54727611 GAGGTCAGGGTTTCAAGAACAGG - Intergenic
1150365903 17:64584102-64584124 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1151846972 17:76663445-76663467 GAGGTTAGGAGTTCAAGATCTGG - Intergenic
1152036422 17:77875836-77875858 GAGGAGGGGGCTTCAAGAAGGGG + Intergenic
1156054703 18:32986995-32987017 GTGGTTTGGCCTTCAAGAAAAGG + Intronic
1156795533 18:41040955-41040977 GTGGCTATGTCTTCAAGGAGTGG + Intergenic
1160515633 18:79477979-79478001 GGGGTTAGGGCTTCAACATGAGG + Intronic
1163575498 19:18109048-18109070 GAGCTTAGATCTGGAAGAAGAGG + Intronic
1163922607 19:20306409-20306431 GAGGTTAGGAGTTCAAGACCAGG + Intergenic
1164477904 19:28589533-28589555 GGGGCTGGGTCTTCAGGAAGGGG - Intergenic
1164478224 19:28591593-28591615 GGGGCTGGGTCTTCAGGAAGGGG - Intergenic
1165075905 19:33279767-33279789 CAGGTGGGGTCTTCCAGAAGTGG - Intergenic
1166949546 19:46417294-46417316 GAGGTCAGGGCTGCAGGAAGCGG + Intergenic
1168375761 19:55878063-55878085 GAGGCTAGGAGTTCAAGAACAGG + Intronic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
927875190 2:26650508-26650530 AAGGTTGTGGCTTCAAGAAGGGG + Intergenic
928063693 2:28141133-28141155 GGGGTTAGGGCTTCAACATGTGG + Intronic
929014164 2:37477527-37477549 GAGGTTAGGTCTTCCAGGAAGGG + Intergenic
929113789 2:38427512-38427534 GAGGTTACTTCATAAAGAAGTGG + Intergenic
929217046 2:39425419-39425441 AGGGTTAGGTCTTCAACATGTGG - Intronic
932237760 2:70134764-70134786 GAGGTTAGGAGTTCGAGACGAGG - Intergenic
934050613 2:88207450-88207472 GAGGTTAGGAGTTCAAGACCAGG - Intergenic
934575106 2:95395264-95395286 GGGGTTAGGACTTCAACATGTGG - Intergenic
934734364 2:96681997-96682019 GAGGTTAGGAGTTCAAGACCAGG - Intergenic
935104612 2:100029148-100029170 GAGGTTAGGGCTTCAACATATGG - Intronic
939869398 2:147510170-147510192 GAGGTTAGGTCTTCAACATAAGG + Intergenic
940294447 2:152107908-152107930 AAGGTTAAGTTTTCAAGAATTGG + Intergenic
942802695 2:179893649-179893671 GAGGAGAGAGCTTCAAGAAGAGG - Intergenic
942891990 2:181001458-181001480 GAGGGTGGGACATCAAGAAGTGG + Intronic
943479954 2:188405161-188405183 GAGGATAGGTCTGCAAGCACTGG - Intronic
945949429 2:216024658-216024680 GAGGTTAGGAGTTCAAGACCAGG + Intronic
949066085 2:241991064-241991086 GGGGTTAGGGCTTCAACACGTGG + Intergenic
1169395045 20:5221640-5221662 GAGGTGGGGTCTTTAAGAGGTGG + Intergenic
1173319968 20:41978559-41978581 CAGGTTAGGTTCTCAAGATGTGG - Intergenic
1173823756 20:46034535-46034557 GGGGTCACTTCTTCAAGAAGTGG + Intronic
1176221720 20:63972452-63972474 GAGGTTGGCTCTTATAGAAGAGG + Intronic
1177213130 21:18094908-18094930 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1177233970 21:18361733-18361755 GAAGTTTAGTCTTCAAGTAGTGG + Intronic
1178546299 21:33495656-33495678 GGGGTTAGGGCTTCAACATGGGG - Intergenic
1179523840 21:41962705-41962727 GAGGTAAGGACTTCAACATGTGG + Intergenic
1179541840 21:42088034-42088056 GAGGTTAGGACTTCAACATATGG + Intronic
1180646219 22:17341220-17341242 GAGGTCAGGTGTTCAAGACCAGG - Intergenic
1181715535 22:24724648-24724670 GAGGTTAGGAGTTCAAGACCAGG - Intronic
1182340198 22:29614226-29614248 GAGGTCAGGAGTTCAAGACGAGG + Intronic
1184726524 22:46350556-46350578 GATGTTAGGTCCTGGAGAAGGGG - Intronic
1185091870 22:48780148-48780170 GAGGTTAGGGCTTCCACACGTGG + Intronic
949539501 3:5020949-5020971 CAGGTAAGGACTTCAAAAAGAGG + Intergenic
950687280 3:14627615-14627637 GAGGTTAGCACTTCATGAAAGGG - Intergenic
950799086 3:15534855-15534877 GAGATTGGGTCTTTAAGAAGTGG - Intergenic
951523986 3:23635804-23635826 GAGGTCAGGAGTTCAAGACGAGG - Intergenic
955187946 3:56732932-56732954 GAGGTTAGGAGTTCAAGACTAGG + Intronic
957460225 3:80508409-80508431 AAGGTGAGCTTTTCAAGAAGTGG + Intergenic
957856936 3:85891588-85891610 GAGACGAGGTCTTTAAGAAGGGG + Intronic
959839857 3:110962443-110962465 GAGGTCAACTCTTCAAGAAAAGG + Intergenic
960490456 3:118311825-118311847 GAGGTTTGGTATTCAAGTAAGGG + Intergenic
961145614 3:124590707-124590729 GGGGTTAGGTCTGAAGGAAGGGG - Intronic
961759215 3:129153221-129153243 GAGGTTAGGAGTTCAAGACCAGG - Intronic
962098603 3:132317730-132317752 CACGTTAGGTCTTCATTAAGAGG - Intronic
962223405 3:133583773-133583795 GAGGTCAGGTGTTCAAGACCAGG - Intronic
962944402 3:140154177-140154199 CAGATGGGGTCTTCAAGAAGGGG + Intronic
963142199 3:141956019-141956041 GAGGTTAGGAGTTCAAGACCAGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
964842110 3:161005483-161005505 GTGGGAAGGTGTTCAAGAAGTGG + Intronic
964858495 3:161173348-161173370 GAGGTTAGGAGTTCAAGACCAGG + Intronic
965742849 3:171894336-171894358 GAAATTAGGTCTTCAACATGAGG - Intronic
966822492 3:183936104-183936126 GAGGGTGGGGCCTCAAGAAGAGG + Intronic
966869279 3:184279440-184279462 GAGGTTAGGAGTTCAAGACCAGG + Intronic
968192076 3:196675863-196675885 GAGGTCAGGAGTTCAAGACGAGG - Intronic
968215713 3:196888367-196888389 GAGGTCAGGAGTTCAAGACGAGG + Intronic
969125700 4:4946242-4946264 GAGGTTAGGACTTCAACATATGG - Intergenic
970888133 4:21010100-21010122 GAGGTTAGGACTTCAACAGTAGG + Intronic
971670621 4:29551475-29551497 GAGGTAAAGTCCTCATGAAGAGG + Intergenic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
972718357 4:41671745-41671767 GAGGTCAGGTGTTCAAGATCAGG + Intronic
972789702 4:42359093-42359115 GAGGAAAGGGCTTCCAGAAGGGG + Intergenic
973994117 4:56439448-56439470 GAGGTTAGGAGTTCAAGACCAGG - Intronic
975486602 4:74940551-74940573 GAGGTGGGGTCTTTAGGAAGTGG - Intronic
976775841 4:88705078-88705100 GAGGTCAGGAGTTCAAGACGAGG - Intronic
977664113 4:99625328-99625350 AAGATTAGGTCTTCAAAATGTGG + Intergenic
979311779 4:119212283-119212305 GAGGCTAGTTCTTCAGGAGGAGG - Intronic
980547342 4:134284469-134284491 GATGTTAGGTTTGCAAGAAGTGG + Intergenic
980648022 4:135670499-135670521 GAAGTTAGGGCTTCAACAAATGG + Intergenic
980782504 4:137509976-137509998 GAGGTCAGGAGTTCAAGAAAAGG - Intergenic
983499336 4:168481155-168481177 GAAGTTCTGTCTTCAAGAAAAGG + Intronic
983584062 4:169337329-169337351 GAGGTTAGGAGTTCAAGACCTGG - Intergenic
984746051 4:183219410-183219432 AAGGTAATGTCTTCAAGCAGAGG + Intronic
987914184 5:24189946-24189968 AAGTTAAGGTCTTCGAGAAGGGG - Intergenic
989637502 5:43552346-43552368 AATGTGAGGTCCTCAAGAAGTGG + Intronic
992301227 5:75382618-75382640 GAGCCTAGGTCTTCAATAAATGG + Intronic
996254042 5:121376000-121376022 GAGGTTAGGAGTTCAAGACCAGG - Intergenic
998480730 5:142460509-142460531 GGGGTTAGGACTTCAACATGTGG + Intergenic
999625157 5:153512828-153512850 GAGGTTAGGGCTTTAACAAACGG - Intronic
1000933719 5:167283260-167283282 GAGGTTAGGAGTTCAAGACCAGG - Intergenic
1003130275 6:3389648-3389670 GAGTTTAGGGCTTCATGGAGTGG - Intronic
1004324165 6:14658822-14658844 GAGGTTAGGACTTCAACATATGG + Intergenic
1006194648 6:32231329-32231351 CAGGTTGGGTCTCCAGGAAGTGG + Intergenic
1008068267 6:47073730-47073752 AAGGTCAGGTCTACAAGATGTGG + Intergenic
1008258948 6:49341538-49341560 ATAGTTAGCTCTTCAAGAAGTGG - Intergenic
1008615422 6:53221490-53221512 GAGGTCAGGAGTTCAAGACGAGG - Intergenic
1009673334 6:66785884-66785906 GAGGTAAAGTCTTCATGAAGTGG - Intergenic
1010786798 6:80012407-80012429 GAGTCTAGTGCTTCAAGAAGTGG + Intronic
1013027859 6:106296602-106296624 GAGGTTAGGAATTCAAGACCAGG + Intronic
1013134324 6:107265726-107265748 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1013339781 6:109202317-109202339 AAGGTGAAGTCTTCAAGAATAGG - Intergenic
1014787727 6:125637616-125637638 GAGGTTAGGTCTTTATGAGAAGG - Intergenic
1015137794 6:129893118-129893140 GAGGTTAGGAGTTCAAAAAGGGG - Intergenic
1016466318 6:144328996-144329018 GAGGTCAGGACTTCAAGATCAGG - Intronic
1016472271 6:144387350-144387372 AAGGTCAGGAGTTCAAGAAGTGG - Intronic
1016688164 6:146904723-146904745 CATGTCAGATCTTCAAGAAGTGG + Intergenic
1018000170 6:159571900-159571922 GAGGTATGGTTTTCAAGAGGTGG - Intergenic
1018206546 6:161441918-161441940 GAGGAATGGTCTTCAGGAAGTGG + Intronic
1018347607 6:162918566-162918588 GAGCATAGGTATTCAAGAAAGGG + Intronic
1018607609 6:165614487-165614509 GAGGGTAGATGTTCTAGAAGAGG - Intronic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1020639194 7:10734489-10734511 GAGGTTAGGGCTTCAATATATGG + Intergenic
1022617951 7:31951797-31951819 GAGGTTCTGTGTTCAGGAAGTGG - Intronic
1023459053 7:40374856-40374878 GAGCCTAGGTTTTCATGAAGGGG + Intronic
1026108637 7:67440620-67440642 GAGGTGAAGTCTTCATGAATGGG + Intergenic
1026764147 7:73149193-73149215 GAGGTCAGGACTTCAAGACCAGG - Intergenic
1027040615 7:74958963-74958985 GAGGTCAGGACTTCAAGACCAGG - Intergenic
1027083021 7:75243394-75243416 GAGGTCAGGACTTCAAGACCAGG + Intergenic
1028313343 7:89367527-89367549 GAGGTGAGTCCTTTAAGAAGGGG - Intergenic
1029158744 7:98535951-98535973 GGGGTTAGGGCTTCAACATGTGG - Intergenic
1031042339 7:116851377-116851399 GAGGTTAGGAGTTCAAGACCAGG + Intronic
1031118394 7:117692913-117692935 GAGGTCAGGTCTTGCAGCAGAGG - Intronic
1032409882 7:131687122-131687144 AAGGAGAGGTCTTGAAGAAGGGG + Intergenic
1034552861 7:151832475-151832497 GAGGTTAGGTCCACGAGAAAGGG + Intronic
1035033027 7:155875054-155875076 TATGCTAGGTATTCAAGAAGTGG + Intergenic
1035843616 8:2839621-2839643 CAGGTTAGGTCTGCAACATGAGG - Intergenic
1036685738 8:10908758-10908780 GAGGTGGGGCCTTCAAGAGGTGG + Intronic
1038001942 8:23399389-23399411 GAGGTGGGGCCTTTAAGAAGTGG + Intronic
1042430103 8:68696093-68696115 GAGGTCAGGACTTCAATGAGCGG + Intronic
1042856845 8:73276389-73276411 GAGGTCAGGCGTTCAAGAATAGG - Intergenic
1043649816 8:82577366-82577388 GAGGTTAGGGCTTCAACAGATGG + Intergenic
1043973915 8:86564053-86564075 GAGGCTGGGTTTTCAAGAAGGGG - Intronic
1046365511 8:113225872-113225894 GAGGTCCGTTCTTCAACAAGTGG - Intronic
1048230303 8:132633564-132633586 GAGGTGAGGTATTTAGGAAGGGG + Intronic
1049434690 8:142581099-142581121 GGGGTCAGGTCTTCCAGGAGAGG + Intergenic
1049570909 8:143369882-143369904 GGGGTTAGGTCTCCTAGAGGAGG + Intronic
1049626533 8:143625362-143625384 GAGGTTAGGGGTTCAAGACCAGG - Intergenic
1050741221 9:8823102-8823124 GAGAAGAGGGCTTCAAGAAGAGG - Intronic
1052816208 9:33104240-33104262 TAGGTTATGTCTTGAAGGAGAGG - Intronic
1056506994 9:87267020-87267042 GAGGTTAGATCTACAAGAGGTGG + Intergenic
1058137428 9:101322340-101322362 GACTTTAGGTTTGCAAGAAGTGG + Intronic
1058732019 9:107859508-107859530 GAGGCTAGGTCATCAAGATCAGG + Intergenic
1058817281 9:108696005-108696027 GAGATTAGCACTTCAAAAAGGGG - Intergenic
1059405242 9:114095167-114095189 AAGGTTGGGTCTTGAGGAAGGGG - Intronic
1059532483 9:115048502-115048524 ATGGTTAGGTTTTCCAGAAGGGG + Exonic
1060020806 9:120129468-120129490 GAGGTTAGGACTTCAACATATGG + Intergenic
1060999772 9:127896605-127896627 GAGGTCAGGTCCTCCAGCAGGGG - Intronic
1061615450 9:131775992-131776014 GAGGTTAGGTCTTGGGAAAGTGG - Intergenic
1061955578 9:133959683-133959705 GAGGTAAGGACCTCAAGAAGAGG + Intronic
1185856534 X:3541443-3541465 GAGGTTAGGATTTCAACATGTGG + Intergenic
1186294492 X:8133997-8134019 GAGGTTAGGGCTTCAACATATGG - Intergenic
1186986071 X:15015167-15015189 GAGGTTAAGGCTTCATGAATTGG + Intergenic
1187436232 X:19272433-19272455 GAGGTTAGGCCTTCAACATATGG + Intergenic
1187673489 X:21691994-21692016 GAGGTTAGGGTTTCAATACGTGG + Intergenic
1188057695 X:25560792-25560814 GAGGTTAGGTCATGAAGGTGAGG - Intergenic
1189295683 X:39915863-39915885 GAGGGTAGGAGTTCAAGACGTGG + Intergenic
1189846567 X:45144145-45144167 GAGGTTAGGAGTTCAAGACCAGG - Intergenic
1190737645 X:53266441-53266463 GGGGTGAGGCCTTCAAGCAGTGG + Intronic
1191037377 X:56041335-56041357 GAGGTCAGGAGTTCAAGACGAGG - Intergenic
1194001772 X:88438360-88438382 GAGATTATGTCTTCCAGAACTGG - Intergenic
1195116822 X:101707530-101707552 GAGATGAGGCCTTTAAGAAGTGG - Intergenic
1196106975 X:111906920-111906942 GAGGTTCTGTCTTCAAGGATAGG - Intronic
1197258477 X:124290149-124290171 GAGGTGAGGTGTTCAAGACCAGG + Intronic
1198302279 X:135344275-135344297 AAGCTTAGGTCTTGAAGATGGGG + Intergenic
1198832735 X:140767939-140767961 GAGGTGAGATCTTTAAGAGGTGG - Intergenic
1200419647 Y:2951077-2951099 GAGGTGAGGTCTTGAAAAAGTGG - Intronic
1200962757 Y:9010186-9010208 GAGGTTAGTTCTTTGAGAACTGG - Intergenic