ID: 1111866470

View in Genome Browser
Species Human (GRCh38)
Location 13:93774914-93774936
Sequence GAGAGCTCAGCCAAGGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111866470 Original CRISPR GAGAGCTCAGCCAAGGCCCC TGG Intronic
900180894 1:1310484-1310506 AGGAGATCAGCCAGGGCCCCTGG + Intronic
900467524 1:2833045-2833067 GGGGGCTCAGGCAAGGCCCCAGG + Intergenic
900935915 1:5766361-5766383 GGGAGTTCAGCCAGGGCCCTTGG + Intergenic
900983211 1:6058417-6058439 GTGACCTCAGACAAGTCCCCTGG + Intronic
901052560 1:6432590-6432612 GAGAGCTGAGCCTTGGACCCTGG + Intronic
901835667 1:11922588-11922610 GAGAGCAAGGCCAAGGCCTCGGG + Intronic
902334613 1:15747742-15747764 CAGAGCTCAGCACAGGCCCTGGG + Exonic
902481683 1:16715446-16715468 GAGAGCTGAGCCTTGGACCCTGG - Intergenic
902541869 1:17161600-17161622 GAGATCTCAGCCAAGCCCACAGG - Intergenic
902817061 1:18922537-18922559 GACAGCCCAGCCAGGGCTCCTGG + Intronic
902974903 1:20081512-20081534 GAGATCACAGCAAAGGCCCTGGG - Intronic
903033591 1:20480450-20480472 GAGCCCTCGGCCAAGGCTCCAGG - Intergenic
903178320 1:21593350-21593372 GGGTGCTCAGCCAGGGACCCTGG - Intergenic
903192396 1:21664056-21664078 GTGAGCTCAGGCAAGCCGCCCGG - Intronic
903277758 1:22232742-22232764 GTGAGGTCCCCCAAGGCCCCAGG + Intergenic
903304114 1:22400772-22400794 GAGAGTGTAGACAAGGCCCCAGG + Intergenic
903775468 1:25790610-25790632 GAGAGGTCAGGGATGGCCCCTGG + Intergenic
904267907 1:29328392-29328414 GAGAGGCCACACAAGGCCCCTGG - Intergenic
904287432 1:29461459-29461481 GGGAGCCCAGCACAGGCCCCGGG - Intergenic
904359400 1:29962160-29962182 GGGAGCTCAGCAAATGCCCTGGG + Intergenic
904944543 1:34189696-34189718 GGGAGGTCACCAAAGGCCCCAGG - Intronic
905015714 1:34777150-34777172 TAGAGCTCTGCCCAGGCCTCAGG - Intronic
905301976 1:36991745-36991767 GAGGGTTCAGCCAAGGTCCAGGG + Intronic
907471055 1:54673703-54673725 CAGAGTTCATCCAAGGCCCCAGG - Exonic
909925206 1:81430404-81430426 GAGAGCTCTGTCAATGCCCCAGG + Intronic
911450347 1:98053914-98053936 GAGAGCTCGGCCAGGGCTGCGGG - Intergenic
912194533 1:107381954-107381976 ATGATCTCAGCAAAGGCCCCAGG + Intronic
912704780 1:111903931-111903953 GGGAGCTCAGTCCAGGCCACTGG + Intronic
915531208 1:156503205-156503227 CAGGGGTCAGCCAAGCCCCCAGG + Intergenic
915942563 1:160128143-160128165 GAGAGCTGAGAAAAGGTCCCTGG - Intronic
916167432 1:161976641-161976663 GAGTTTTCAGCCAAGGCCCCAGG + Intergenic
916179434 1:162070600-162070622 GTGAGCTCAGCCTGGGCACCTGG + Intronic
921163208 1:212487441-212487463 GTGACCTCAGCCAAGGGCACTGG - Intergenic
921235101 1:213118778-213118800 GAGAACTCAGTGAAGACCCCTGG - Intronic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922212159 1:223494786-223494808 CAGGGCTCAGCCAAGGGCTCTGG - Intergenic
922320587 1:224482970-224482992 CAGAACTCAGCCAGGGCCCAAGG - Intronic
922594704 1:226804595-226804617 GAGACCCCAGCCCAGACCCCTGG - Intergenic
922603595 1:226875013-226875035 GAGAACTCTGCCTGGGCCCCAGG + Intronic
922960800 1:229644283-229644305 GAGAGTCCAGCCAAGGTCTCTGG + Intronic
924669086 1:246104946-246104968 GAGATCTCAGTCAAGACCCCAGG + Intronic
1062761717 10:27760-27782 GTGAGCTCAGCCATGGCCTTGGG + Intergenic
1063434293 10:6018135-6018157 GGGAGTTCAGCAAAGGGCCCTGG + Intronic
1063604920 10:7514729-7514751 GAGAGCGCAGACAAGGACCATGG - Intergenic
1064266206 10:13827672-13827694 ATGAGCTGAGCCAAGGGCCCTGG + Intronic
1065892692 10:30134665-30134687 GAGAGCTCAGTCGAAGTCCCTGG + Intergenic
1067681670 10:48445627-48445649 GAGGGCTGAGCCAAGGCCATGGG - Intergenic
1069749398 10:70735859-70735881 GACAGCTCAGCCTGGGCCCTGGG - Intronic
1069868153 10:71516891-71516913 GAGTGCTCAGCCCGGGTCCCAGG + Intronic
1070606989 10:77905658-77905680 GCCAGCTCAGCCAAGGCACAAGG + Intronic
1071684135 10:87736911-87736933 GAGAGCTCAGCCATGCAGCCTGG - Intronic
1072735193 10:97874428-97874450 CATAGCACAGCCCAGGCCCCAGG + Intronic
1074116346 10:110459995-110460017 CAGAGCTCAGCCATGGCTTCTGG + Intergenic
1074316644 10:112367496-112367518 GAGAGATAAGCCCAGGACCCAGG - Intergenic
1074610235 10:115014797-115014819 GAGTGCTCAGCCTAGATCCCCGG + Intergenic
1074721579 10:116270465-116270487 GAGAGGCCAGCGAAAGCCCCAGG + Intronic
1076774679 10:132688150-132688172 GAGAGCTGACCCAGGGGCCCAGG + Intronic
1077200182 11:1302859-1302881 GAGTGCTCAGCGAGGGCTCCTGG - Intronic
1077383811 11:2259726-2259748 CAGGTCTCAGCCATGGCCCCAGG - Intergenic
1077421390 11:2451735-2451757 GGGAGCAGAGCCCAGGCCCCAGG - Intronic
1078261980 11:9718058-9718080 CAGAGCCCAGCCAAGGCTCCTGG + Intronic
1079034543 11:17011018-17011040 GAGGAGTCAGCCAAGGCCCTGGG + Intronic
1079125894 11:17718714-17718736 GGCAGCTCAGCCTAGACCCCAGG + Intergenic
1081599604 11:44484104-44484126 CAGCCCTCTGCCAAGGCCCCAGG + Intergenic
1083143427 11:60739976-60739998 GAGAGCTCCCTGAAGGCCCCAGG + Intronic
1083292679 11:61698686-61698708 GAAATGTCAGACAAGGCCCCCGG - Intronic
1083756894 11:64796735-64796757 CAGAGGTCAGACATGGCCCCTGG + Intronic
1084512628 11:69615743-69615765 GAGTGCTCATCACAGGCCCCTGG - Intergenic
1084532295 11:69734666-69734688 GCCAGCCCAGCCAAGGCACCTGG - Intergenic
1084611758 11:70207691-70207713 GGGATCTTAGCCAAGGCCGCAGG + Intergenic
1084728586 11:71058813-71058835 GAGACCCCAGCCCGGGCCCCGGG + Intronic
1088655338 11:111993807-111993829 CAGAGCTGAACCAAGGCCACAGG + Intronic
1089657804 11:119964435-119964457 GAGAGCTGAACCACAGCCCCAGG + Intergenic
1092000073 12:5024544-5024566 AAGGGTTCAGCCAAGGCCCCTGG - Intergenic
1092136082 12:6148178-6148200 AAGAGCTCAGCCAGAGACCCTGG - Intergenic
1092264016 12:6967637-6967659 GAGATCTCAGCCCAGCCCCTAGG - Intronic
1095851143 12:46808216-46808238 GAGCTTTCAGCCCAGGCCCCTGG + Intronic
1100346664 12:93738306-93738328 GAGACCTCAGGCATGGGCCCTGG + Intronic
1100785500 12:98073806-98073828 GACAGCTGAGCCAAGGTCACTGG - Intergenic
1101230744 12:102738442-102738464 GAGAGCTGAACAATGGCCCCAGG + Intergenic
1101585201 12:106079635-106079657 GAGTGGTCAGGGAAGGCCCCTGG - Intronic
1101771305 12:107754065-107754087 GAGAGCTCAGGGAGGGACCCAGG + Exonic
1102043330 12:109814741-109814763 GGGAGCTCAGCCACCTCCCCGGG + Exonic
1102344381 12:112149884-112149906 CAGGACTCAGCCAAGGCCGCAGG + Intronic
1102573358 12:113840967-113840989 GGGAGATGGGCCAAGGCCCCAGG - Intronic
1103218876 12:119226307-119226329 AAGGGCTCAGCCAATGCCACGGG - Intergenic
1103597938 12:122035464-122035486 GAGTGCTTGGCCAAGGCCCCGGG - Intronic
1103725872 12:122997120-122997142 GAAGGCTCAGCCATGGGCCCAGG + Intronic
1104390249 12:128385974-128385996 GAGAGCTGGGCTATGGCCCCTGG + Intronic
1105403848 13:20118339-20118361 TAGCGCTCAGGCCAGGCCCCTGG + Intergenic
1107425304 13:40287330-40287352 GACCACTCAGCCAGGGCCCCTGG + Intergenic
1107519076 13:41161286-41161308 GGGAGCTGAGCCAAGGCACTTGG - Intergenic
1107879038 13:44817215-44817237 GATAGATCAGACAGGGCCCCTGG - Intergenic
1108229011 13:48318516-48318538 GAGGGCGCAGCCAAGGGGCCCGG - Intronic
1108433862 13:50382368-50382390 GAGAGCTCTGACCAGGCCCATGG + Intronic
1111866470 13:93774914-93774936 GAGAGCTCAGCCAAGGCCCCTGG + Intronic
1112315409 13:98357959-98357981 CAGCACTCTGCCAAGGCCCCAGG + Intronic
1113459681 13:110473056-110473078 GGGAGCTCAGCCCGGGCCACGGG + Exonic
1114189304 14:20428938-20428960 GGGAACTCTGCCAAGGCCTCGGG - Exonic
1114264000 14:21060490-21060512 GAGAGCTCAGAACAGGACCCTGG - Intronic
1115069151 14:29300416-29300438 GAGAACTCAGTGCAGGCCCCTGG - Intergenic
1117643824 14:57829600-57829622 GAGAGCACAGCCCTGGCACCAGG + Intronic
1118431272 14:65720842-65720864 AAGAACTCAGCCAATGCCCATGG - Intronic
1118752119 14:68815155-68815177 TCAAGCTCGGCCAAGGCCCCAGG + Intergenic
1120854574 14:89201609-89201631 GAGACCACAGCCAAAGGCCCAGG + Intronic
1121463574 14:94100304-94100326 AAGAGCTCAGCCACCTCCCCAGG - Intronic
1122221041 14:100239233-100239255 GAGCCCTCAGCCATGGCCTCGGG + Exonic
1123061681 14:105597389-105597411 CTGAGCTCATCCCAGGCCCCTGG - Intergenic
1123071920 14:105646188-105646210 GAGAGCTCAGCCCCGAGCCCTGG + Intergenic
1123086418 14:105719119-105719141 CTGAGCTCATCCCAGGCCCCTGG - Intergenic
1123091583 14:105744464-105744486 GAGAGCTCAGCCCTGAGCCCTGG + Intergenic
1123097351 14:105772805-105772827 GAGAGCTCAGCCCCGAGCCCTGG + Intergenic
1123195242 14:106609994-106610016 GAGACCTTCGCCGAGGCCCCAGG + Intergenic
1126348189 15:47718179-47718201 GAGAGCTGAGCCAAGGCCGAAGG + Intronic
1127288601 15:57551332-57551354 GAGAGATCACCCAAGTCCCAGGG - Intergenic
1127579546 15:60324909-60324931 GCGAGCTCAGCAAAGGACACTGG + Intergenic
1128091781 15:64924066-64924088 GTGAGCCCAGGCAAGGCCACAGG - Intronic
1128509397 15:68304030-68304052 GACAGGCCAGCCAAGGCCTCAGG + Intronic
1128731539 15:70024824-70024846 GAGCGTTGAGCCCAGGCCCCAGG - Intergenic
1129298288 15:74611626-74611648 CAGACTTCAGCCCAGGCCCCAGG + Intronic
1132804276 16:1768512-1768534 GACAGCCCAGCCGAGGGCCCTGG + Exonic
1132851136 16:2025549-2025571 GGGAGCCCAGCCCAGGGCCCCGG + Intronic
1133463056 16:6003690-6003712 AAGAACTTGGCCAAGGCCCCAGG - Intergenic
1134018796 16:10907452-10907474 GCCAGCTCTGCCAGGGCCCCGGG - Exonic
1134093247 16:11402672-11402694 GAGAGCCCAGCCAAGGCCAGCGG + Intronic
1134275189 16:12769686-12769708 GAGCAATCAGCCAAGCCCCCTGG - Intronic
1134666398 16:16022117-16022139 GAGTGATCAGCCAAGGCCTGGGG + Intronic
1135158500 16:20073795-20073817 GAGGGCTGAGCCAAGACTCCAGG - Exonic
1136082812 16:27863778-27863800 AGGAGCTCAGCCAGGGCCACAGG - Intronic
1138530951 16:57634142-57634164 GTGAGTTCACCCTAGGCCCCTGG + Intronic
1139513486 16:67440334-67440356 AAGAGGTCAGCCCAGGCCCCAGG + Intronic
1140217631 16:73021272-73021294 GCCAGCCCAGCCAAGGCCACAGG + Intronic
1142383435 16:89747040-89747062 GACAGCACAGCCAGGGCGCCAGG - Intronic
1142499992 17:326924-326946 GAGAGCACAGAGAAGGCCCTGGG + Intronic
1142581503 17:945951-945973 GTGAGAACAGCCAAGGCCCCAGG - Intronic
1143666224 17:8362744-8362766 AAGAGCTCAGCCAGGGCCGAGGG + Intergenic
1144661872 17:17076200-17076222 AAGAGGTAAGCCAAGGCCTCTGG - Intronic
1146005125 17:29156002-29156024 GGGAGCTGAGCCTGGGCCCCAGG + Intronic
1146937132 17:36818909-36818931 GTGAGCTCAGCCCTGGCACCTGG + Intergenic
1146956366 17:36938478-36938500 GAGAGGGCAGCCAAGTCCCGCGG + Intronic
1147794616 17:43033591-43033613 CAGAGCTCAACCCAGGCCCTGGG - Intergenic
1147840675 17:43369179-43369201 GAGAGCTCAGACAAGCCACAGGG + Intergenic
1149249339 17:54749958-54749980 GAGAACTCAGCCAGTGCCCATGG - Intergenic
1149593863 17:57851800-57851822 GAGAGCACAGCTCTGGCCCCAGG + Intergenic
1150640659 17:66947477-66947499 GAGGGCTCAGCCGAGCCCCCAGG + Intergenic
1151595610 17:75076532-75076554 CAGAGCTCAGCCAGGGTCTCTGG - Intergenic
1151596128 17:75078908-75078930 CAGAGCTGAGCGAAGGCTCCAGG - Intergenic
1151698873 17:75732003-75732025 GAGAGCTGAGCCAAGCACCCAGG + Intronic
1152910418 17:83002240-83002262 GGCAGCTCAGCCATGGCCTCCGG + Intronic
1152911343 17:83006640-83006662 GAGAGCACAGCCACGGCGTCGGG - Intronic
1152954624 18:28090-28112 GTGAGCTCAGCCATGGCCTTGGG + Intergenic
1153202047 18:2656370-2656392 GAGAGGGAAGCCAAGGCCGCAGG - Intronic
1153836585 18:8969471-8969493 GACATCTAAGCCAAGGCCCAAGG + Intergenic
1153962357 18:10150318-10150340 GGGAGCTCAGCCCATGCCCATGG - Intergenic
1154251015 18:12745225-12745247 GAGAGCTCAGCAAAACCCGCCGG + Intergenic
1156343243 18:36231788-36231810 GCGATCACATCCAAGGCCCCAGG - Intronic
1156557768 18:38086784-38086806 CAAGGCTCAGCCATGGCCCCAGG - Intergenic
1157248239 18:46072020-46072042 GCGAGCTCCGCCAAGCCCCCGGG + Intronic
1158557975 18:58490834-58490856 GAGAGCTCAGAGAAGAGCCCAGG + Intronic
1160745864 19:710358-710380 GGGAGCTCAGCCAGGGGCTCAGG + Intronic
1161026229 19:2038599-2038621 TAGAGCTGAGCCCAGACCCCGGG - Exonic
1161030958 19:2057575-2057597 CAGGGCCCAGCCAAGGCCCTGGG + Intergenic
1162040711 19:7969307-7969329 GACAGGTCACCCAAGGCCCCGGG - Intronic
1162830538 19:13281853-13281875 CAGTGCTCAGACCAGGCCCCAGG - Intronic
1163266142 19:16223647-16223669 GAGAGCTCAGCAGAGCCTCCAGG - Intronic
1164590465 19:29504090-29504112 GAGAGCCATGCAAAGGCCCCGGG - Intergenic
1164854024 19:31506954-31506976 AAGAGCACAGCCATGCCCCCCGG + Intergenic
1168641774 19:58035437-58035459 CAGACCTCAGCCCAGGACCCTGG + Intronic
1202715722 1_KI270714v1_random:41358-41380 GAGAGCTGAGCCTTGGACCCTGG - Intergenic
926051809 2:9749927-9749949 GAGAGATCAGCCCTTGCCCCAGG + Intergenic
926592417 2:14753593-14753615 TGGAGATCAGCAAAGGCCCCTGG - Intergenic
927207178 2:20618085-20618107 GGGAGCCCTGCCCAGGCCCCAGG + Exonic
929948176 2:46386085-46386107 GAGACCTCAGCCAGGGCCTGTGG - Exonic
931230705 2:60372182-60372204 GAGAGCCCAGGAGAGGCCCCAGG - Intergenic
932598102 2:73106786-73106808 GAGAGCTCAGACAAGGAAACTGG - Intronic
932736848 2:74260353-74260375 GAGAGCAAAGACAAGGCCCTGGG - Intronic
934989903 2:98913833-98913855 GAGAGCCCTGGCAAGGCACCTGG + Intronic
935200746 2:100854392-100854414 GAGACCTCAACCAGGGCCTCAGG + Intronic
935271057 2:101434925-101434947 GTGTGTGCAGCCAAGGCCCCTGG - Intronic
935589885 2:104836472-104836494 GAGAGCTCCACACAGGCCCCTGG - Intergenic
937241328 2:120464475-120464497 CACAGCTCAGTCAGGGCCCCAGG + Intergenic
937321709 2:120964819-120964841 GAGAGGTCAGCAGAGGCCCAGGG - Intronic
939726132 2:145723675-145723697 GAGATATGTGCCAAGGCCCCAGG + Intergenic
941686167 2:168451276-168451298 CTGAGCTCAGCTGAGGCCCCAGG - Intergenic
942279067 2:174342722-174342744 GAGAGCCCGGCCAAGGCGCCTGG + Intergenic
947535626 2:230939128-230939150 CTGTGCTCAGCCTAGGCCCCAGG - Intronic
948793977 2:240392816-240392838 GAGAGCACAGGAAATGCCCCGGG + Intergenic
948827141 2:240578265-240578287 GACAGCACAGCCTGGGCCCCCGG - Exonic
1168893008 20:1306649-1306671 AGGAGCTCAGTCAAGGCCACAGG + Exonic
1170980303 20:21206359-21206381 GAGAGCCAAGCCAAGACTCCTGG + Intronic
1171371233 20:24663542-24663564 CAGAGCCCAGCCCAGGCCCCAGG + Intronic
1172106988 20:32522827-32522849 GAGAGCTCAGTGGAGGGCCCGGG + Intronic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1173028556 20:39332775-39332797 GAGAGCTCAGTCAAGGCTGAGGG - Intergenic
1173591516 20:44228698-44228720 CAGAGCTGAGCCAAGCCCCCTGG + Intergenic
1173852883 20:46229897-46229919 GAGAGCTCAGCCATGTCTCTGGG - Intronic
1174186510 20:48709984-48710006 AAGAGCTCAGCAAAGTCCCAGGG - Intronic
1175191145 20:57212861-57212883 GAGGACTCAGCCCGGGCCCCAGG + Intronic
1178466348 21:32852104-32852126 GAGAGCTCAGCCAAATCACCCGG + Intergenic
1178525340 21:33324308-33324330 GAGAGAACAGCCACGGGCCCTGG - Intergenic
1179531069 21:42020011-42020033 AAGAGCCCACACAAGGCCCCTGG - Intergenic
1179540939 21:42082956-42082978 CAGACCTCAGCCAAGGCTGCAGG - Intronic
1179578294 21:42321374-42321396 AAGAGCTCATCCAGGGCCCCAGG - Intergenic
1179657287 21:42853196-42853218 GAGGACTCAGCCAGTGCCCCAGG + Intronic
1179998836 21:44986098-44986120 GGCAGCTCAGCCAGGGGCCCAGG + Intergenic
1181046631 22:20217706-20217728 CAGGGCTCAGCCAATGCCCAGGG + Intergenic
1181508784 22:23379612-23379634 CAGAGCTCTGCCCAGGGCCCAGG - Intergenic
1182075575 22:27493240-27493262 CAGGGCTCAGCCAAAGCCCTGGG - Intergenic
1183264394 22:36816606-36816628 GAGAGCTCGTACAAGGACCCTGG + Intronic
1183395245 22:37567745-37567767 GTGACCTCAGCCATGGCCACCGG - Intronic
1183952634 22:41360198-41360220 GACAGAGCAGCTAAGGCCCCTGG - Intergenic
1184243467 22:43223485-43223507 GAGAGCTCAGCCCTGCCCTCAGG - Intronic
1184253531 22:43274490-43274512 GAGAGCTCAGGCAGGTGCCCAGG + Intronic
1184458363 22:44624039-44624061 GGGGGCTCACCCAGGGCCCCAGG - Intergenic
1184792060 22:46706248-46706270 CAGACATCAGCCAAGGCCCAGGG + Intronic
1184809783 22:46823480-46823502 GAGAACTCACCCAGGGCCCTGGG - Intronic
1184858695 22:47160950-47160972 CAGGGAGCAGCCAAGGCCCCCGG - Intronic
1184873884 22:47260246-47260268 GAGAGCTCAGCTTCTGCCCCAGG + Intergenic
1185155194 22:49189410-49189432 GAGAGCTCCGCCATAGCACCAGG - Intergenic
1185236646 22:49717567-49717589 CAGGGCACAGCCAAGTCCCCGGG - Intergenic
950433334 3:12964338-12964360 GAGATCTCTCCCAAGGCCTCCGG + Intronic
950518949 3:13484979-13485001 GTGAGCTCAGCCAGGGAGCCTGG - Intronic
950739978 3:15042761-15042783 CACAGCTCAGCAAAGGCTCCTGG - Intronic
951904004 3:27685735-27685757 GAGAGCTTAGCCAGGGCCAAGGG - Intergenic
952831655 3:37570154-37570176 GAGAAGTCAGCCAAGGCCAGGGG - Intronic
953236375 3:41111108-41111130 CAGAGCTCTGCCCAGACCCCAGG + Intergenic
953376333 3:42431461-42431483 GAGAGCTCAGCCAACCCTTCAGG - Intergenic
954125326 3:48524875-48524897 CACAGTTCAGCCCAGGCCCCAGG - Intronic
954461726 3:50630625-50630647 GAGAGCTTGGCCCACGCCCCTGG - Intronic
954553823 3:51503241-51503263 AAGAGCCCAGCCCTGGCCCCAGG + Intergenic
954800564 3:53184819-53184841 CAGAGCTCAGCCAAGGGCAGGGG - Intronic
955941504 3:64150609-64150631 TAGAGCTCACCAAAGGACCCAGG - Intronic
955958886 3:64318830-64318852 GAGAGTCCAGCCAAGCCCCTTGG - Intronic
956779162 3:72590869-72590891 AAGAGCACAGCGGAGGCCCCGGG + Intergenic
956924613 3:73970575-73970597 GAGGGGTCAGAGAAGGCCCCTGG - Intergenic
960961201 3:123071703-123071725 GAGTGATCAGAGAAGGCCCCAGG + Intronic
961818876 3:129565155-129565177 GAGAGGGGAGCCATGGCCCCGGG - Intronic
962389968 3:134962950-134962972 CAGAGCTGAGCCAACACCCCTGG - Intronic
962924260 3:139977165-139977187 GAGAGATCATCTAAGGACCCAGG - Intronic
963202900 3:142602555-142602577 GATACCTCAGGAAAGGCCCCAGG + Intronic
964786495 3:160400944-160400966 GAGAGCCCAGCCACCGCCGCAGG + Exonic
966785571 3:183619902-183619924 CAGGGCTAAGCCAAGACCCCAGG - Intergenic
966905984 3:184526027-184526049 GAGCGCGCAGCCCAGGCCTCTGG + Intronic
966918797 3:184599282-184599304 GTGACCTCAGGCAAGGCTCCTGG - Intronic
967851207 3:194083927-194083949 GAGCCCTCAGCCAAGACCTCAGG + Intergenic
968234390 3:197023156-197023178 CAGAGCCAAGCCAAGCCCCCAGG + Intronic
968696793 4:2034406-2034428 GACAGGACAGCCAAGGCCACAGG - Intronic
968708632 4:2096094-2096116 GTCAGCTCAGCAAGGGCCCCAGG + Intronic
977331364 4:95641459-95641481 GACAGATCAGACAAGGTCCCTGG - Intergenic
984943774 4:184955403-184955425 GGGAACTCAGCCTTGGCCCCGGG + Intergenic
987015096 5:13810137-13810159 GAGAGCGCAGCCAGAGCTCCAGG + Exonic
992371199 5:76145879-76145901 GAGAGTTCAAACAAGGCCACAGG - Intronic
993022273 5:82605776-82605798 GAGCACTCTGCCAAGGCCCTGGG + Intergenic
997736555 5:136216593-136216615 CAGAGCCAGGCCAAGGCCCCTGG - Intronic
999096660 5:148984474-148984496 ATGAGCCCAGACAAGGCCCCAGG - Intronic
999368603 5:151039060-151039082 GGGAGCCCAGCCAAGGGACCCGG + Intronic
999774932 5:154804448-154804470 GAAAGCTCAGCCCAGGACCTGGG + Intronic
1000295442 5:159909337-159909359 GAGAGGACAGACCAGGCCCCAGG - Intergenic
1001053360 5:168430015-168430037 TAGAGCTCACCATAGGCCCCAGG + Intronic
1001140210 5:169137904-169137926 GAGAGGTGAGACAAGGGCCCAGG - Intronic
1001565982 5:172699794-172699816 AAGAGCACAGCGAAGGCCCAGGG + Intergenic
1002040299 5:176508597-176508619 GACAGCTATGCCAAGGCCACTGG - Exonic
1002075794 5:176707738-176707760 CAGGGTTCTGCCAAGGCCCCAGG + Intergenic
1003075677 6:2981870-2981892 CTGAGCTCAGCTGAGGCCCCAGG - Intergenic
1004681582 6:17900781-17900803 GAGAGCTCAGTCCAGGGGCCAGG + Intronic
1005582462 6:27247926-27247948 GAGAGCTCTGCCCAGGGCCTGGG + Exonic
1006012880 6:31057038-31057060 GAGAGCTCTGCAAAGACTCCTGG + Intergenic
1006296585 6:33172583-33172605 GAGAGGTCACCCAGGCCCCCCGG - Exonic
1006436948 6:34030632-34030654 GAGAGCTAGGCACAGGCCCCTGG - Intronic
1006572207 6:35015031-35015053 TATAGCTTAACCAAGGCCCCAGG - Intronic
1006946999 6:37791327-37791349 AAGAGGTCAGCCAGGGCACCTGG + Intergenic
1007359191 6:41342966-41342988 CCCAGCTCAGCCCAGGCCCCAGG + Intronic
1007476181 6:42121581-42121603 CAGAGCTCAGCCAAGTCTCAAGG + Intronic
1007635569 6:43297953-43297975 GAGAGCTGGCCCCAGGCCCCAGG + Intronic
1011684660 6:89814784-89814806 GAGATCTCCGCCAGGGCCCTGGG + Intronic
1012849297 6:104427747-104427769 GAGAACAAAGCCAAGGACCCTGG - Intergenic
1016597199 6:145815324-145815346 GAGAGCTCAGCCCTGGATCCCGG + Intergenic
1016820045 6:148338725-148338747 CAGAGATGAGCCAAGGCTCCTGG - Intronic
1019119650 6:169792794-169792816 GAGAGTTCAGCCTGAGCCCCCGG - Intergenic
1019274196 7:167270-167292 GAGGGCTTAGCCGAGGCCCCTGG + Intergenic
1019454907 7:1121967-1121989 GAGGGCTCAGACAAGGCCTCGGG - Intronic
1019609111 7:1928033-1928055 GTGACGTCAGCCAAGGCCTCGGG - Intronic
1019716046 7:2539827-2539849 CTGAGCTCACCCAAGACCCCCGG - Exonic
1022338547 7:29446551-29446573 GAGAACTCAGGCAGGGCCCAGGG + Intronic
1022490784 7:30816005-30816027 CAGAGCTTTCCCAAGGCCCCTGG - Intronic
1022516239 7:30976620-30976642 ATGAACTCAGCCAAGGCCCGTGG - Intronic
1022702237 7:32772219-32772241 GAGGGTTCAGAGAAGGCCCCAGG - Intergenic
1023157508 7:37265752-37265774 GAGGGCTCAGCACAGACCCCTGG - Intronic
1024096285 7:45985328-45985350 AGGACCTCAGCCAAGACCCCTGG - Intergenic
1024539903 7:50467802-50467824 CCTAGCTCAGCCAAGGCCTCCGG - Intronic
1026789024 7:73319744-73319766 GGGAGATCAGCCAGGGCCCAGGG + Intronic
1027428137 7:78082446-78082468 AAGAGGTCAGCCCAGGCTCCTGG - Intronic
1028794622 7:94889220-94889242 GAGATCTCAGCCAGAGCCTCAGG + Intergenic
1031952409 7:127905900-127905922 TAGAGCTCAGCCTAGGCTGCAGG + Intronic
1032012811 7:128357871-128357893 GAAACCTCAGCCTTGGCCCCAGG - Intronic
1032078388 7:128846756-128846778 GATGGCTAGGCCAAGGCCCCCGG - Exonic
1032321172 7:130887901-130887923 GAGAGCCCAGCTCAGGCCCCTGG - Intergenic
1033346050 7:140526412-140526434 CAGACCCCAGCCAAGGCCACTGG + Intronic
1034990958 7:155548047-155548069 CGGAGCTCAGCTCAGGCCCCAGG + Intergenic
1035569062 8:660134-660156 GGGAGCTCAGCCATGACCCCGGG - Intronic
1036398064 8:8385801-8385823 GAGGGCTCAGCCAGGGCTCGGGG + Intronic
1037786909 8:21908768-21908790 TGGGGCTCAGCCTAGGCCCCAGG + Intergenic
1037835917 8:22214609-22214631 GGGACCTCAGCTAAGCCCCCAGG - Intergenic
1038041563 8:23727831-23727853 GAATGTTCAGTCAAGGCCCCTGG - Intergenic
1039063691 8:33591979-33592001 GAGAGGTCAGGCCAGGCCCGTGG - Exonic
1039584881 8:38698379-38698401 GGGAGCTCAGCCAAGGCTGTTGG - Intergenic
1040744520 8:50625086-50625108 AAGAGCTTAGACAAGGCCCTTGG - Intronic
1042189197 8:66168314-66168336 GAGAGTACAGCCAAGAACCCAGG - Intronic
1044250086 8:89996154-89996176 CACAGCTCTTCCAAGGCCCCAGG + Intronic
1044386237 8:91591941-91591963 AAGAGCTCAGGAAAGGACCCAGG + Intergenic
1044663815 8:94616126-94616148 GAGAGCCCAGCCAGGGCTCCAGG + Intergenic
1046355470 8:113078878-113078900 GAGAACGCAGCCAGGGCTCCTGG + Intronic
1048582427 8:135740850-135740872 CAGAGGTCCGCCCAGGCCCCAGG - Intergenic
1049310950 8:141933604-141933626 GAGAGCTCACCCCAGGCTCTGGG - Intergenic
1049361352 8:142213833-142213855 CGGAGCTGAGCCAAGGCACCTGG + Intronic
1049612451 8:143561850-143561872 GAGAGCCCACCAAAGGTCCCCGG - Intronic
1049665200 8:143839906-143839928 GTGAGCACGGGCAAGGCCCCGGG - Intronic
1049744923 8:144259235-144259257 GCGTGCTCAGCCATGGCCCTGGG - Exonic
1049818074 8:144617543-144617565 GAGAGCCCAGCCTTGGCCCCAGG + Intergenic
1049882488 8:145075791-145075813 GTGAGCTCAGCCATGGCCTTGGG - Intergenic
1053427007 9:38016846-38016868 GGGAGCTCAGGCAGGGCCCTGGG - Intronic
1053486295 9:38459228-38459250 GAGGTCTCAGCCAAGGGCTCTGG + Intergenic
1056565883 9:87771806-87771828 GGGAGCTCAGCCAGGAGCCCTGG + Intergenic
1058336544 9:103836490-103836512 GAAAGCTCAGTCAAAGCCCTTGG + Intergenic
1058522912 9:105829367-105829389 CAGAGCTCAGCCAGTGCCCAAGG - Intergenic
1058711311 9:107681826-107681848 GAGAGCTCAGCGTTGGTCCCTGG + Intergenic
1059191561 9:112332906-112332928 GAGACCTCGGCCAAGTCCCGCGG + Exonic
1059374353 9:113870743-113870765 CAGATCTTAGCCAAGCCCCCAGG + Intergenic
1060208215 9:121694881-121694903 CTGAGGTCAACCAAGGCCCCAGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060553652 9:124497533-124497555 GAGAGCTCAGCTGAGACTCCAGG + Intronic
1060989959 9:127842986-127843008 GAGGACTCAGCCACTGCCCCAGG + Intronic
1061019107 9:128002472-128002494 GAGTGCTCTGCCAAGTCACCGGG - Intergenic
1061137179 9:128741669-128741691 CAGGGCTCAGCCAAGGCTCCTGG + Intronic
1061658235 9:132109307-132109329 GAGAGCTAAGCTAAGCCCCAGGG - Intergenic
1062151778 9:135023073-135023095 GAGATCACATCCAAGCCCCCTGG - Intergenic
1062221455 9:135418262-135418284 AAGATCTCAGCCAAGGCTCATGG - Intergenic
1062393997 9:136345365-136345387 GGCAGCTCAGCCAAGGGCGCTGG + Intronic
1062399737 9:136367152-136367174 GGCAGCTCAGCCAGGACCCCAGG + Intronic
1062554907 9:137109577-137109599 GGGAACCCAGCCAAGGCCCAGGG - Intergenic
1062743726 9:138197184-138197206 GTGAGCTCAGCCATGGCCTTGGG - Intergenic
1187740070 X:22345970-22345992 CAGAGCTCAGACATGACCCCAGG - Intergenic
1189615102 X:42775009-42775031 GAGAGCTCAGCCATGTCACCAGG - Intergenic
1191174510 X:57484935-57484957 GAGAGTTCAGCCAGTGACCCAGG - Intronic
1192141617 X:68651447-68651469 GGGAGCTCAGTCAAGGGCACGGG + Intronic
1192558416 X:72108688-72108710 GAAAGCCCATCCAAGGCCTCGGG - Intergenic
1195823212 X:108969827-108969849 GAGAACTCAGCCAATGCCCATGG + Intergenic
1199728480 X:150607485-150607507 AAGAACTCAACCAAGGCCACTGG - Intronic
1199973467 X:152877431-152877453 GAGAGGCAAGGCAAGGCCCCAGG + Intergenic
1200002101 X:153067432-153067454 GAGGGCTCAGGCAGGGTCCCGGG - Intergenic
1200005632 X:153082593-153082615 GAGGGCTCAGGCAGGGTCCCGGG + Intergenic
1200145262 X:153923085-153923107 GGGAGCTCTGCCCAGACCCCGGG - Intronic
1200401513 X:156022874-156022896 AAGAGCTCTGGCAAGGCCCTGGG - Intergenic