ID: 1111868856

View in Genome Browser
Species Human (GRCh38)
Location 13:93804818-93804840
Sequence ATGTAATAGCTGCATGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111868850_1111868856 28 Left 1111868850 13:93804767-93804789 CCTACTATGCTGCAGGCAATATC 0: 1
1: 0
2: 1
3: 13
4: 187
Right 1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG 0: 1
1: 0
2: 0
3: 36
4: 250
1111868853_1111868856 -1 Left 1111868853 13:93804796-93804818 CCAGTCCAGTTTGGGCTTCTCCA 0: 1
1: 0
2: 1
3: 11
4: 198
Right 1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG 0: 1
1: 0
2: 0
3: 36
4: 250
1111868854_1111868856 -6 Left 1111868854 13:93804801-93804823 CCAGTTTGGGCTTCTCCATGTAA 0: 1
1: 0
2: 1
3: 11
4: 139
Right 1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG 0: 1
1: 0
2: 0
3: 36
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111868856 Original CRISPR ATGTAATAGCTGCATGACGT TGG Intronic
901108872 1:6779436-6779458 ATGTAATAGCTGGATGATGAGGG + Intergenic
902612273 1:17604156-17604178 ATGTAATGGCTTCAAGACTTTGG + Intronic
904478039 1:30777141-30777163 ACGGAATAGCTGCGTGACCTTGG - Intergenic
905137392 1:35809710-35809732 ATGTAATAGTTGTATGACCCTGG + Intronic
906820247 1:48921743-48921765 ATGTATAAGCTGCACGACATGGG - Intronic
907321839 1:53607584-53607606 ATTTCACAGCTGCATGACCTTGG - Intronic
908784284 1:67719770-67719792 ATGTAATAGCTGTATGATCTTGG - Intronic
908981468 1:69964131-69964153 ATATATTAGCTGTATGACTTTGG + Intronic
909168404 1:72258883-72258905 ACTAAATAGCTACATGACGTTGG + Intronic
909995901 1:82278926-82278948 ATGTATTAGATGGAAGACGTTGG - Intergenic
910724631 1:90325788-90325810 ATTTAATAGCTGAATGACCTTGG - Intergenic
912558133 1:110530832-110530854 AGCTACTAGCTGCATGACCTTGG + Intergenic
915611751 1:156999283-156999305 ATTTAATAGCTGTATGGCCTGGG - Intronic
917529260 1:175819409-175819431 ATGTAGTAGCTTCATTACCTTGG + Intergenic
917598026 1:176549520-176549542 ATTCAACAGCTGCCTGACGTTGG - Intronic
918437385 1:184529929-184529951 ACTTATTAGCTGCATGACCTTGG + Intronic
918946510 1:191072601-191072623 ATTTACTAGCTGCATGACTTTGG + Intergenic
919882504 1:201909822-201909844 GTGTAATAGCTGCATAATCTTGG - Intronic
920538701 1:206760600-206760622 ATGCAATGGCTTCATGACCTTGG + Intergenic
920795820 1:209135027-209135049 TTGAAATAGCTGCATGAGATAGG - Intergenic
921118326 1:212115188-212115210 ATGTAATACCTACATGAAATAGG - Intergenic
923423512 1:233844428-233844450 ATTTATTAGTTGCATGACCTTGG + Intergenic
924956939 1:248938793-248938815 CTGTAATACCTACATGTCGTGGG + Intergenic
1064692255 10:17930309-17930331 ATGCACTAGCTGCATGAACTTGG - Intergenic
1065448268 10:25825246-25825268 ATTTAATAGCTGGATGATCTTGG + Intergenic
1067284371 10:44896802-44896824 ATTTACCAGCTGCATGACCTTGG - Intergenic
1068752992 10:60618117-60618139 ATGTACTGGCTGCATGACTTTGG - Intronic
1069350943 10:67526498-67526520 ATTTAATAACTGCATCACTTTGG + Intronic
1070967862 10:80540548-80540570 ATGTAGCAGCTGGATGACCTTGG - Intronic
1072193604 10:93096179-93096201 ATTTAATTGCTGGATGACATTGG + Intergenic
1072198886 10:93141013-93141035 ATTTACTAGTTGCATGACCTTGG + Intergenic
1072274421 10:93808970-93808992 ATCTACTAGCTACATGACTTTGG - Intergenic
1073550713 10:104398363-104398385 ATTTAATAGCTCCATGACCTTGG + Intronic
1073888105 10:108064932-108064954 ATGTAAAAGATTCATGAGGTGGG + Intergenic
1074233130 10:111557540-111557562 ATGTAACAGCCCCATGAAGTAGG - Intergenic
1074501368 10:114028002-114028024 ATCTGCTAGCTGCATGACCTTGG - Intergenic
1074750776 10:116584867-116584889 ATTAAATAGCTGAATGACTTTGG + Intergenic
1075224689 10:120617587-120617609 ATTTAATAATTGCATGACCTTGG + Intergenic
1076962845 10:133780636-133780658 CTGTAATACCTACATGTCGTGGG + Intergenic
1078347878 11:10567099-10567121 ATGTACTGCCTGCATGACATTGG + Intronic
1078407692 11:11085447-11085469 TTTTATTAGCTGCATGACCTTGG - Intergenic
1079415227 11:20228510-20228532 ATTTACTAGCTGCATGACTTTGG + Intergenic
1079914631 11:26353369-26353391 TTGAAATAGCTGCATAAGGTAGG - Intronic
1080425546 11:32150826-32150848 ATTTACTAGCTGTATGACTTTGG - Intergenic
1081264845 11:41007829-41007851 CTGTAATAGCTGTATTAAGTTGG - Intronic
1081763321 11:45592186-45592208 ATGCATTAGCTGCATGACCTTGG - Intergenic
1082129967 11:48476616-48476638 TTGGAAAAGCTGCATGACATTGG - Intergenic
1082185544 11:49176171-49176193 ATTTACTAGTTGCATGACTTTGG - Intronic
1082563491 11:54647536-54647558 GTGGAAAAGCTGCATGACATTGG - Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1082983634 11:59146469-59146491 ACTTACTAGCTGCATGACCTTGG - Intronic
1083478321 11:62927887-62927909 ATGTACTAGCTGTGTGACCTTGG - Intergenic
1085883295 11:80493567-80493589 ATGTAAAAGCTTCATGACATTGG - Intergenic
1086097706 11:83067377-83067399 ATTTATTAGCTGTATGATGTTGG - Intronic
1086302295 11:85440224-85440246 ATGTATTCGCTGTATGACCTTGG + Intronic
1086680783 11:89669169-89669191 ATTTACTAGTTGCATGACTTTGG + Intergenic
1086690377 11:89783747-89783769 ATGTAATAGCTACATCTCCTAGG + Intergenic
1086715421 11:90055896-90055918 ATGTAATAGCTACATCTCCTAGG - Intergenic
1087204960 11:95384654-95384676 ATTTACTAGCTGTATGACCTTGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088752032 11:112852049-112852071 ATTTATAAGCTGCATGACCTTGG - Intergenic
1090972936 11:131658439-131658461 ATGTAAGAGCTGCACCACGTGGG - Intronic
1091125507 11:133091993-133092015 ATGTGATAGCTGTAAGAGGTGGG + Intronic
1094211298 12:27895714-27895736 ATTTACTAGCTGTATGACATTGG - Intergenic
1095106119 12:38234728-38234750 ATGTAATATCTGAATGAGCTGGG + Intergenic
1095444542 12:42270957-42270979 ATGTAATAGAGTCATGACCTAGG - Intronic
1096012639 12:48233913-48233935 ATTTACTAGCTACATGACTTTGG - Intergenic
1098931449 12:76419509-76419531 ATTTACTAGCTGTATGACATTGG + Intronic
1098945867 12:76588890-76588912 ATTTACTAGCTGTATGATGTTGG + Intergenic
1099177646 12:79440282-79440304 ATGAAATAGATGCAAGACATGGG - Intronic
1099463413 12:82952293-82952315 ATGTAATAGGTGTATGAAATTGG - Intronic
1101321528 12:103677103-103677125 TTTTTATAGCTGCATGACCTTGG + Intronic
1101545862 12:105712122-105712144 ATGTAATAGCTGCAGCATCTAGG + Intergenic
1102772923 12:115494226-115494248 ACTTACTAGCTGCATGACCTTGG - Intergenic
1103210421 12:119162081-119162103 ATATATTATCTGCAAGACGTGGG + Exonic
1104141931 12:125995940-125995962 ATTTATGAGCTGCATGACCTTGG + Intergenic
1105684133 13:22760983-22761005 AGGCAAAAGCTGCATGACATTGG + Intergenic
1106069891 13:26399802-26399824 ATTTATTAGCTGCGTGACATTGG - Intronic
1108611159 13:52084967-52084989 TTGTAATAGCTACGTGACTTTGG + Intronic
1108951643 13:56101230-56101252 AAGTAATAGCTGCATCACAAAGG + Intergenic
1109114864 13:58369302-58369324 ATTTACTAGTTGCATGACCTTGG - Intergenic
1109319441 13:60791797-60791819 ATGTATTAGCTACATGACCATGG + Intergenic
1110006181 13:70273170-70273192 ATGAGGTAGCTGCATGACCTTGG - Intergenic
1110771450 13:79352768-79352790 ACTTACTAACTGCATGACGTTGG - Intronic
1111279985 13:86009983-86010005 TTGAAATAGCTGCATGAGCTAGG + Intergenic
1111397407 13:87681345-87681367 ATGTATTAGCAGGAAGACGTTGG - Exonic
1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG + Intronic
1113158881 13:107356101-107356123 CTGTATTAGCAGCATGACATCGG - Intronic
1113241734 13:108345609-108345631 ATTTACCAGCTGCATGACTTGGG + Intergenic
1115282834 14:31684134-31684156 ATCTAATAGCTGTGTGACCTTGG + Intronic
1115448208 14:33516559-33516581 ATCTAATAGCTGCATGCCCTAGG + Intronic
1116696594 14:48185144-48185166 ATGTACTAGCTACATGGCTTGGG - Intergenic
1116743074 14:48780986-48781008 ATGTACTAGCTGTGTGACATAGG - Intergenic
1117155820 14:52939650-52939672 ATATACTAGCTGTATGACCTTGG - Intronic
1117756521 14:58979926-58979948 ATGTAGTAGATGTATGATGTGGG + Intergenic
1119568679 14:75650552-75650574 ATGAAACAACTGCATGACATGGG - Exonic
1119576271 14:75725560-75725582 ATTTATTAGCTGCATGACCTAGG - Intronic
1120051091 14:79867119-79867141 ATGTATTAGCTGTGTGACCTTGG - Intronic
1121504553 14:94466837-94466859 ATATAACAGCTACATGACCTTGG + Intronic
1126018012 15:44372060-44372082 ATTTATTAACTGCATGACTTTGG - Intronic
1126347170 15:47708435-47708457 TTGTAAAAGCTTCATGATGTGGG - Intronic
1127214972 15:56814644-56814666 ATTTATTAGCTGCGTGACCTTGG - Intronic
1129528029 15:76235062-76235084 ATCTGATAGCTGCATGACCATGG + Intronic
1130247957 15:82270851-82270873 ATTTACTAGCTGCAGGACCTTGG - Intronic
1131592787 15:93767875-93767897 ATGTACCAGCTGCATGACATTGG - Intergenic
1133406716 16:5530401-5530423 ATCTAATAGCTGCTTGACCTTGG - Intergenic
1137259716 16:46815298-46815320 ATGGAAAAGCTTCATGACATTGG + Intronic
1137309271 16:47237290-47237312 ATTTAACAGCTCCATGACTTTGG + Intronic
1137343663 16:47635253-47635275 ATGTATTAGCTGTATGATGTTGG + Intronic
1138256078 16:55562426-55562448 GTGTACTAGCTGCGTGACCTTGG + Intronic
1139928234 16:70504078-70504100 ATTTTCTAGCTGCATGACCTTGG + Intronic
1140958002 16:79885352-79885374 ATGGAATTGCTGCATGATGAAGG + Intergenic
1142330295 16:89447736-89447758 ATGTAATAAATACATGATGTTGG - Intronic
1143707644 17:8710156-8710178 ATGTAACAGCTGGAAGAAGTAGG - Intergenic
1144022677 17:11251061-11251083 ATGTACTAGCTGTGTGACCTTGG - Intronic
1144750947 17:17647603-17647625 ATTTACAAGCTGCATGATGTTGG + Intergenic
1146172007 17:30641655-30641677 ATGTAATAGCTGTGTGACCTTGG + Intergenic
1146345465 17:32057691-32057713 ATGTAATAGCTGTGTGACCTTGG + Intergenic
1152951990 17:83242865-83242887 CTGTAATACCTACATGTCGTGGG + Intergenic
1153388056 18:4522091-4522113 ATGTACTAGCTGTGTGACATTGG - Intergenic
1156215010 18:34989175-34989197 TTGTAATAGTTGCATGAGGGTGG - Intronic
1156830468 18:41485246-41485268 ATTTACCAGCTGCATGACCTTGG - Intergenic
1157332068 18:46711394-46711416 ATTTACTAGCTGAATGACCTTGG - Intronic
1158210977 18:55049734-55049756 ATGTACTAGCTGTGTGACCTTGG - Intergenic
1162990420 19:14298380-14298402 ATGTAATAGCTGTGTGACCTTGG - Intergenic
1165708324 19:37991901-37991923 CTGCACTAGCTGCATGACCTGGG + Intronic
1168471039 19:56641105-56641127 ATGTACTAGCTGTATAACTTTGG - Intergenic
1168727974 19:58601083-58601105 CTGTAATACCTACATGTCGTGGG + Intergenic
927337839 2:21946099-21946121 ATGTAATATCTGCATTATGCTGG - Intergenic
928113756 2:28530302-28530324 ATCTATTAGCTGTATGATGTTGG + Intronic
929477020 2:42261006-42261028 TTGTATTAGCTGTATGACTTAGG + Intronic
929868226 2:45736328-45736350 ATGTAATAGCTCTCTGACCTGGG - Intronic
930045870 2:47172333-47172355 ATTTAATAGCTGTGTGACCTTGG + Intronic
931286135 2:60833480-60833502 ACGTACTAGCTGGATGACCTTGG + Intergenic
933835421 2:86241683-86241705 AACTAACAGCTGCATGACCTTGG + Intronic
933900343 2:86845216-86845238 ACTTACTAGCTGCATGACTTTGG - Intronic
934602722 2:95670443-95670465 ACTTAAAAGCTGCATGACCTAGG + Intergenic
935780205 2:106504009-106504031 ACTTACTAGCTGCATGACTTTGG + Intergenic
936536102 2:113312635-113312657 ACTTAAAAGCTGCATGACCTAGG + Intergenic
936570574 2:113609922-113609944 CTGTAATACCTACATGTCGTGGG - Intergenic
937094993 2:119229560-119229582 ATGTGCTAGCTGTGTGACGTTGG - Intronic
937736165 2:125293391-125293413 ATGTATTAGCTCTATGACTTTGG - Intergenic
939473144 2:142650982-142651004 ATGAAATAGCTTGAGGACGTTGG - Intergenic
940025614 2:149204263-149204285 ATTTATTAGCTGCCTGACCTTGG - Intronic
941513298 2:166440451-166440473 ATGTAATATTGGCATCACGTGGG - Intronic
942385656 2:175439801-175439823 TTGGAATAGCTGCATGGCCTTGG + Intergenic
942773463 2:179551385-179551407 TTGAAATAGCTGCATAAGGTAGG + Intronic
943083187 2:183281372-183281394 ATTTAATAGCTGTATGGCCTCGG + Intergenic
943277763 2:185889867-185889889 ATGTAATAGCTGCATATCCAAGG + Intergenic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
949088239 2:242176728-242176750 CTGTAATACCTACATGTCGTGGG + Intergenic
1172004797 20:31811733-31811755 ATTTATTAGCAGCATGACTTTGG - Intergenic
1173106693 20:40143852-40143874 ATGTACTAGCTGGGTGACCTTGG - Intergenic
1173335376 20:42108329-42108351 ACTTATTAGCTGCATGACCTCGG + Intronic
1173701645 20:45077118-45077140 ATTTACTAGCTGCATGACCTTGG - Exonic
1174400795 20:50274871-50274893 ATGTACCAGCTGCATGACTCTGG - Intergenic
1177471705 21:21568077-21568099 TTGTAATAGTTGCATCACTTAGG + Intergenic
1179990761 21:44947200-44947222 ATGCAGTATCTGCATGACATGGG - Intronic
1180263403 21:46692689-46692711 CTGTAATACCTACATGTCGTGGG + Intergenic
1182662817 22:31936947-31936969 ATCTAATAGCAGCATGACTTTGG + Intronic
1183035775 22:35140032-35140054 ATGTACTAGCTGTCTGACCTTGG - Intergenic
1185429631 22:50801050-50801072 CTGTAATACCTACATGTCGTGGG + Intergenic
949361304 3:3234851-3234873 ATGCAATACCTGCATGAACTGGG - Intergenic
950017253 3:9762936-9762958 GTGAAATACCTGCATGACCTGGG - Exonic
950298348 3:11851389-11851411 ATTTAATAGCTGTGTGACCTTGG + Intergenic
950796879 3:15517313-15517335 ACATAACAGCTGCATGACCTTGG + Intronic
951678506 3:25269445-25269467 ACTTACTAGCTGCATGACCTTGG + Intronic
955061553 3:55496637-55496659 ATGACATAGCTGCATGACTAAGG - Intergenic
957724039 3:84041792-84041814 ATTTAAAAGCTGCATGATCTTGG - Intergenic
959691950 3:109207242-109207264 ACTTTATAGCTGCATGACTTTGG + Intergenic
960535762 3:118812992-118813014 ATTTATTAGCTGCATGACCTTGG - Intergenic
961263413 3:125620773-125620795 ATCTAATAGTTGCATGACCTTGG + Intergenic
962158635 3:132976024-132976046 ATTTACTAGCTGCATGACCCTGG - Intergenic
963231562 3:142913613-142913635 ATTCACTAGCTGCATGACCTTGG + Intergenic
963402550 3:144819270-144819292 ATTTATTAGCTTCATGACATAGG + Intergenic
964491400 3:157240168-157240190 ATGTAATAGTGTCATGAGGTGGG - Intergenic
964529695 3:157654089-157654111 ATTTATTAGCTACATGACTTGGG + Intronic
964551711 3:157891863-157891885 ACTTACTAGCTGCATGACTTTGG + Intergenic
965045997 3:163577288-163577310 ATTTAATAACTGGATGACGAGGG - Intergenic
966037076 3:175431998-175432020 AAGTAATAGCTGCATGAATTAGG - Intronic
966571086 3:181444260-181444282 ATGTAATATATGCATCACATGGG + Intergenic
967490398 3:190084094-190084116 TTTTAATAGCTGCTTGACCTTGG - Intronic
967655155 3:192039230-192039252 ATTAAATAGCTGTATGACCTTGG - Intergenic
967838347 3:193982964-193982986 ATTTAATAGCGGTATGACCTTGG + Intergenic
967931576 3:194694122-194694144 ATGTACTAGATGCATGACGCTGG + Intergenic
968268909 3:197385053-197385075 ATTTAATATCTGCACCACGTTGG + Intergenic
972500052 4:39669570-39669592 ATTTACTAGCTGCATGACCTTGG + Intergenic
972617905 4:40717919-40717941 ACTTAATAGCTGTATGATGTTGG - Intergenic
972631243 4:40843841-40843863 ATGTAGTAGCTGTGTGACCTTGG - Intronic
973745028 4:53955822-53955844 ATTTAATAGCTGCCTGACTTTGG + Intronic
973869712 4:55153823-55153845 ATTTAATAGCTGTGTGACTTTGG + Intergenic
974091405 4:57315273-57315295 TTAAAATAGCTTCATGACGTAGG + Intergenic
975128677 4:70810407-70810429 ATGGAAAAGCTTCATGACATTGG + Intergenic
975145234 4:70959743-70959765 ATTTAATAGCTATATGACCTAGG - Intronic
976540301 4:86266312-86266334 ACTTAATAGCTGTATGACCTCGG + Intronic
977921550 4:102649817-102649839 ATGGAATAGCTTCATGATTTTGG - Intronic
979814295 4:125080417-125080439 ATTTACTAGCTGCATAACCTTGG + Intergenic
984765053 4:183394053-183394075 ATGTAAGACCTGCATGACCTTGG + Intergenic
985466065 4:190197931-190197953 CTGTAATACCTACATGTCGTGGG + Intergenic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
989213961 5:38884632-38884654 CAGTAATAGCTGCATGCAGTAGG + Intronic
990036706 5:51330438-51330460 ATTTATTAACTGCATAACGTTGG - Intergenic
990344302 5:54856171-54856193 CTGTATTAGCTACATGACCTTGG - Intergenic
991466424 5:66917491-66917513 AGGGAATATCTGCATGACCTTGG - Intronic
991468102 5:66936260-66936282 ATGTAATAGTTGCATGATCTTGG + Intronic
991630758 5:68654474-68654496 AGGTATTAGCTGAATGACCTTGG - Intergenic
992030476 5:72716385-72716407 TCGTAATAGCTCCATGAAGTAGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992491018 5:77244759-77244781 ACTTAATAGCTGCGTGACCTTGG - Intronic
993553154 5:89300843-89300865 ATGTAATAGGTGCCTCATGTGGG + Intergenic
994671909 5:102772039-102772061 CTATAATAGCTGCGTGACCTTGG + Intronic
995679217 5:114698335-114698357 ATGAACTAGCTGCATGGCCTTGG + Intergenic
996021623 5:118596988-118597010 ATTTATTAGCTGTATGACCTTGG - Intergenic
996197498 5:120627202-120627224 ATTTAATAGCTACATGATTTAGG - Intronic
998978178 5:147671361-147671383 ACTTAATAGTTGCATGACCTTGG - Intronic
999684573 5:154090837-154090859 ACATACTTGCTGCATGACGTGGG - Intronic
1000019736 5:157308892-157308914 ACTTAATAGCTGGATGACGTTGG + Intronic
1001591458 5:172868259-172868281 ATGCATTAGCTGCATGACTTTGG - Intronic
1002746018 5:181474266-181474288 CTGTAATACCTACATGTCGTGGG + Intergenic
1002901758 6:1415899-1415921 AGGTAATAGCTGTGTGACCTTGG - Intergenic
1003333775 6:5151689-5151711 ATTTACTAGCTGCATGACTAGGG + Intronic
1005173498 6:23015657-23015679 ATGTAATGGCTGGATGAAATTGG + Intergenic
1005489072 6:26329918-26329940 ATTTACTAGCTGCATGACTTTGG + Intergenic
1007262868 6:40575832-40575854 CTGTAATAGCTGTGTGACTTTGG + Intronic
1008015173 6:46510525-46510547 ATGTGATAGATGCATGAAGAAGG - Intergenic
1008015747 6:46517553-46517575 ATGTAATAGCTGTATTAGATAGG - Intergenic
1010088968 6:71956622-71956644 AAGAAATAGCTGTATGAAGTCGG - Intronic
1010558498 6:77316377-77316399 ATTTACTAGCTCCATGACCTTGG - Intergenic
1016617546 6:146069931-146069953 ATCTTATAGCTGAATGACCTTGG - Intronic
1016792896 6:148084749-148084771 TTGTAATAGCCCCATGAAGTAGG + Intergenic
1016821274 6:148348647-148348669 ATCTACTATCTGCATGACTTAGG - Intronic
1022144918 7:27527656-27527678 ATGTGACAGCTGCATGAACTGGG - Intronic
1022291702 7:29010931-29010953 ATGTACCAGCTGTATGACCTTGG - Intronic
1023012884 7:35939237-35939259 ACTTACTAGCTGCATGACCTTGG + Intergenic
1024078248 7:45834615-45834637 ACTTACTAGCTGCATGACCTTGG - Intergenic
1028028923 7:85884183-85884205 ATTTAGTAGCTGCGTGACTTTGG - Intergenic
1029957452 7:104654489-104654511 CTCAAATAGCTGCATGACCTTGG + Intronic
1030020509 7:105270720-105270742 TTTTAATAGCTGTATGACCTTGG + Intronic
1030389134 7:108903793-108903815 ATGTATTTGCTGCATGATCTTGG + Intergenic
1031961404 7:127993483-127993505 AGGTAAGAGCTGCATGAGGTGGG - Intronic
1032872394 7:136000349-136000371 ATGTAATAGCTGCCTGGGGTAGG + Intergenic
1032872403 7:136000427-136000449 ATGTAATAGCTGCCTGGGGTAGG + Intergenic
1034816235 7:154174181-154174203 ACGCACTAGCTGCATGACTTTGG + Intronic
1036507313 8:9367218-9367240 ATATAATAGCTGCATGGAGCTGG - Intergenic
1040878861 8:52182117-52182139 CTTTAATATCTGAATGACGTAGG - Intronic
1041432646 8:57800617-57800639 ATTTACTAGCTGTATGACCTTGG - Intergenic
1041576611 8:59404323-59404345 AGGTAAAAGCTTCATGACCTTGG + Intergenic
1043488217 8:80720025-80720047 ATTTAATAGCTGTGTGACCTTGG - Intronic
1043863467 8:85349655-85349677 ATGTGATAGCTTCATGAGCTGGG - Intronic
1044887957 8:96799793-96799815 ATGTATTAGCTGTGTGACCTTGG - Intronic
1045271089 8:100662223-100662245 ATTTAACAGCTGCATAACCTTGG - Intronic
1046727153 8:117688318-117688340 ATTTAATAGTTGCATGACCTTGG + Intergenic
1047696112 8:127405326-127405348 ATGTAAAAGCTGCATGGTTTGGG + Intergenic
1049993705 9:1014755-1014777 ATGTAATACCTTCATAACCTTGG - Intergenic
1050164113 9:2746553-2746575 ATTTACTAGCAGCATGACTTTGG + Intronic
1051090041 9:13395923-13395945 ATGAAATAGCTGCATGTGGCTGG + Intergenic
1052080227 9:24196649-24196671 AGGTAAAAGCTTCCTGACGTTGG - Intergenic
1052461640 9:28771950-28771972 ATGGAATAACTGAATGCCGTAGG + Intergenic
1052581465 9:30360563-30360585 ATGCTATAGCTGCATAACTTGGG + Intergenic
1052705057 9:31984622-31984644 ATTAATTAGCTGCATGACCTTGG - Intergenic
1055668955 9:78581252-78581274 ATTTAATAGCTCCAAGACTTTGG - Intergenic
1058457750 9:105153785-105153807 ATTTACTAGCTGCATGAACTTGG - Intergenic
1058553902 9:106145671-106145693 ATGTATTAGCTTTATGACCTGGG - Intergenic
1059314589 9:113413200-113413222 ATTTAATAGCTGAGTGACCTGGG - Intronic
1060012348 9:120054975-120054997 ATGTAATTGCTGCCAGATGTGGG + Intergenic
1060166787 9:121423966-121423988 ATGTTTTAGCTGCAAGAAGTGGG - Intergenic
1061129083 9:128697740-128697762 ATTTAATAACTGCATGAATTAGG + Intergenic
1203580489 Un_KI270745v1:40320-40342 CTGTAATACCTACATGTCGTGGG + Intergenic
1186384696 X:9097815-9097837 ATCTAATAGCTTTATGACTTGGG + Intronic
1186391962 X:9169718-9169740 ATTTAACGGCTGTATGACGTTGG + Intergenic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1187300024 X:18039346-18039368 ACTTAATAGCTGTATGACATTGG - Intergenic
1187717997 X:22122906-22122928 ATGTAATATCTGCATTTTGTTGG + Intronic
1188323979 X:28776685-28776707 ATTTTCTAGCTGCATGACCTTGG + Intronic
1188353207 X:29157671-29157693 ATTTATTAGCTGTATGACTTTGG + Intronic
1188370202 X:29360249-29360271 ATTTATTAGCTGCCTGACTTTGG - Intronic
1188691361 X:33132768-33132790 ATGTACTAGCTGCATAATCTTGG + Intronic
1192201980 X:69072152-69072174 ATTTACTAGATGCATGACCTTGG - Intergenic
1192373595 X:70536421-70536443 ATTTATTAGCTGTATGACTTTGG - Intronic
1193041645 X:77010068-77010090 ACTTACTAGCTGCATGACCTTGG + Intergenic
1193588203 X:83353801-83353823 ATGTAATAGCTTCAAGATTTTGG + Intergenic
1193951151 X:87800397-87800419 GTGGAATAGCTCCATGACATTGG - Intergenic
1197619028 X:128726230-128726252 ATTTACTAGCTACATGACTTAGG - Intergenic
1197984779 X:132255955-132255977 ATGCATTAGCTGGATGACCTTGG - Intergenic
1198599965 X:138271801-138271823 ATTTCCTAGCTGCATGACCTTGG + Intergenic
1198919755 X:141712413-141712435 ATTTACTAGCTGCATGGCATGGG - Intergenic