ID: 1111872892

View in Genome Browser
Species Human (GRCh38)
Location 13:93856300-93856322
Sequence TGTCAAGTGGGTTGAGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111872892 Original CRISPR TGTCAAGTGGGTTGAGGATA AGG Intronic
901917280 1:12509539-12509561 AGTAAAGTGGGTTGAGGTGAGGG + Exonic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
907404557 1:54245935-54245957 TCTAAAGTGGGTGGAGGAAAGGG - Intronic
907950468 1:59178528-59178550 TGTCAAATGTGCTGAGGAGAGGG - Intergenic
908307487 1:62837793-62837815 TGTCTTTTGGGTGGAGGATAGGG + Intronic
909179864 1:72409659-72409681 TGTCATTTGGATTGAGGATTAGG + Intergenic
913520128 1:119637480-119637502 TGTCAAGTTGGTAGAGGATGGGG + Intronic
915939476 1:160109622-160109644 GGAAAAGTGTGTTGAGGATATGG - Intergenic
919443484 1:197670057-197670079 TGACAATTGGGTTGTCGATATGG + Intronic
919839228 1:201597247-201597269 AGTGAAGGGGGTTGAGGAGAGGG + Intergenic
919862768 1:201752685-201752707 TGTCAGGTTTGTTGAGGAGAAGG + Intronic
920277325 1:204816218-204816240 TGTCGAGTAGGTTGAGGAGGAGG + Intergenic
921616866 1:217278949-217278971 TGCCAAGAGGGTTGATGACAAGG - Intergenic
921928133 1:220730270-220730292 TGTGTAGAGGGTTGAGGAAATGG - Intergenic
922874540 1:228929765-228929787 TGACAAGTGGGTGGAGGAACTGG + Intergenic
923498987 1:234549163-234549185 TGTCAAGTAGGCTGAGGAGGAGG - Intergenic
924706048 1:246503078-246503100 TGTTAAATGGGTTGAGGGGACGG - Intronic
924907887 1:248475828-248475850 TGTCAAGTGTGTGTAGGAAATGG - Intergenic
924916222 1:248572254-248572276 TGTCAAGTGTGTGTAGGAAATGG + Intergenic
1064193976 10:13230692-13230714 TGTAATGTGGGTTGGGGGTAGGG - Intronic
1064272955 10:13881459-13881481 TGTCAAATGGGAAGAGAATAAGG - Intronic
1066309040 10:34177617-34177639 TGCCCAGTGGGTTGAGGTTTGGG - Intronic
1067542904 10:47169054-47169076 TGTTGAGTAGGTTGAGGAGAAGG - Intergenic
1070736775 10:78868367-78868389 TGCCAAGTTGGTTGAGGTGATGG - Intergenic
1071406549 10:85339792-85339814 TGCCAAATGCTTTGAGGATATGG + Intergenic
1071817115 10:89243530-89243552 TGGCAAGAGGGTTGGGGATTGGG - Intronic
1073546354 10:104352996-104353018 TGCCTATGGGGTTGAGGATAGGG + Intergenic
1073890084 10:108091111-108091133 TGTCTTGTGGGTTGGTGATATGG + Intergenic
1074328172 10:112473980-112474002 TGTAAAGTGGATTTAGGGTAAGG - Intronic
1075132686 10:119754043-119754065 TGTCAGCTGGCTTGAGGCTAAGG - Intronic
1077780353 11:5321689-5321711 TATATGGTGGGTTGAGGATATGG - Intronic
1078187465 11:9064593-9064615 TGGCAAATGGGATGAGGAAATGG + Intronic
1081253468 11:40863642-40863664 TTTCAAGTGGTTTAAAGATAAGG + Intronic
1081446653 11:43137475-43137497 TGTCTAGTGGGTAGAGGCTAGGG - Intergenic
1081514480 11:43812534-43812556 TAAAAAGTGGGCTGAGGATATGG - Intronic
1082790356 11:57342694-57342716 TGTCAAGTGCCTTGCGGAGATGG + Intronic
1083049866 11:59767434-59767456 AGTCATGTGGGCTGAAGATAAGG + Intronic
1083552499 11:63600486-63600508 TGTCACAGGGGTTGAGGAGAGGG + Intronic
1087688381 11:101290856-101290878 TTTCTAGTGGTTAGAGGATAAGG + Intergenic
1089146505 11:116333081-116333103 TGTCAAGTGGGTGGGGGTCAGGG - Intergenic
1092935077 12:13353512-13353534 TGTCTAGTGGGTAGAGGTGAGGG + Intergenic
1093075142 12:14750300-14750322 TGTCAAGTGAGTCCAGGAGAGGG + Intergenic
1093445277 12:19250024-19250046 TGTCTAGTGGGTAGAGGCCAGGG - Intronic
1095263144 12:40121604-40121626 TATCAAGTGTTTTGAGGATGTGG + Intergenic
1095471723 12:42544042-42544064 TGTCAAGTAGGTTGAGAAGAAGG + Intronic
1096285746 12:50298543-50298565 TGTCAGGTGTGTTGGGGAGATGG - Intergenic
1099946994 12:89256089-89256111 AGTCAAGTGGGTAGAGGCCAGGG - Intergenic
1100017276 12:90025777-90025799 TTTAAAGTGGGCTGAGGAAATGG + Intergenic
1100054139 12:90488880-90488902 TGTGAAGAAGGTTGAGGAAATGG + Intergenic
1100973138 12:100092996-100093018 TTTTAAGTAAGTTGAGGATAAGG - Intronic
1101938941 12:109084515-109084537 TGTCTAGTGGGTAGAGGCCAGGG + Intronic
1102624301 12:114222261-114222283 TATCTAGTGGGTAGAGGTTAGGG + Intergenic
1103042266 12:117705439-117705461 TGCCTAGTGGGGTGAGGAAAGGG - Intronic
1107377107 13:39815873-39815895 CGTCAAGTGGGTAGAGGCCAGGG - Intergenic
1107981778 13:45740906-45740928 TGACAAGTGGATGGGGGATAAGG - Intergenic
1108284591 13:48893979-48894001 TGACAAGTTGGTGGAGGTTATGG + Intergenic
1109821916 13:67668288-67668310 TGTCAAATAGGTGAAGGATAAGG - Intergenic
1110454944 13:75680716-75680738 TGTCAAGGGGTTGGGGGATAGGG - Intronic
1111872892 13:93856300-93856322 TGTCAAGTGGGTTGAGGATAAGG + Intronic
1119181818 14:72610560-72610582 TGCCAAGTGGGTTCAGGGTGAGG - Intergenic
1119983911 14:79114204-79114226 TGTCTAGTGGGTAGAGGCCAGGG + Intronic
1120027088 14:79598694-79598716 TGTCCAGTGGGTTGTGGGTTTGG + Intronic
1120597344 14:86457363-86457385 TATCTAGTGGGTAGAGGCTAGGG + Intergenic
1121711627 14:96042941-96042963 TGTCCAGTGGGCTGGGGACAAGG + Intronic
1128908527 15:71491178-71491200 TGTCAAGGGTGTGGAGGAAAAGG - Intronic
1129647772 15:77453424-77453446 TACCAAGTGTGCTGAGGATATGG + Intronic
1130854311 15:87827464-87827486 TGTCAGCTGGGTTAAGGAAAAGG - Intergenic
1130940968 15:88508717-88508739 TTTGGAGTGGGTTGAGGAAATGG + Intergenic
1133632153 16:7631413-7631435 TGGGAATTGGGGTGAGGATAGGG - Intronic
1134127199 16:11624253-11624275 TGTTTAGTTGGTTGGGGATAAGG - Intronic
1134367177 16:13590308-13590330 TGTCTAGTGGCTTGAGAATGAGG - Intergenic
1137412279 16:48239095-48239117 TGTCAAGTTTGTTGAAGATCAGG - Intronic
1137654973 16:50152510-50152532 TGTAAAGTGGGTTGAGTGTGCGG + Intergenic
1138570952 16:57872776-57872798 TGAAAAGTGGGTAGAGGAGAGGG - Intergenic
1138705878 16:58914523-58914545 TGTCAGCAGGGTTGGGGATAGGG - Intergenic
1141022493 16:80510648-80510670 TGTCTAGTGGGTCGAGGCCAAGG - Intergenic
1144593723 17:16547337-16547359 TGCCAAGTGGGTTAAGTAGAGGG - Intergenic
1145989610 17:29071047-29071069 AGGCAAGTGGGTGGAGGATGGGG + Intergenic
1146683150 17:34822990-34823012 TGTCTAGTGGGTAGAGGCCAGGG - Intergenic
1147722512 17:42547714-42547736 AGTTAAGAGGGTTGAGGAGACGG - Intergenic
1149021289 17:51968059-51968081 TCCCAAGTGTGGTGAGGATACGG + Intronic
1149913259 17:60585423-60585445 TGTCTAGTGGGTAGAGGCCAAGG - Intronic
1150570568 17:66382782-66382804 CGTCTAGTGGGTAGAGGTTAGGG + Intronic
1150647338 17:66987345-66987367 TCTCACATGGGTAGAGGATAAGG - Intronic
1151524707 17:74656742-74656764 AGTGAAGTGGGATGAGTATATGG + Intergenic
1152779197 17:82218942-82218964 GGACATGGGGGTTGAGGATAAGG + Intergenic
1153428623 18:4991842-4991864 TGTCAAGTGGGATCAGAAAAAGG - Intergenic
1153995734 18:10440053-10440075 TTTCAAGTGGGTTGAGTCAAAGG + Intergenic
1159997150 18:74976816-74976838 TGTCATGTGGGTTTCCGATATGG + Intronic
1160977967 19:1803076-1803098 TGTCAAGAGGGAAGAGGAGAAGG + Intronic
1162974728 19:14202207-14202229 TGTCATGTGAGTTGGGGAGAAGG - Intronic
1163129378 19:15263101-15263123 TCTCAAGTGGGTTGGGGGTGGGG - Intronic
1164703147 19:30300510-30300532 TGCCCAGTGGGTTGAGGGAATGG + Intronic
1165692840 19:37876993-37877015 TTTCAAGTGGCTTGAGTAAATGG + Intergenic
1167726773 19:51219767-51219789 TGTCTAGTGGGATGATTATATGG + Intergenic
925489268 2:4374061-4374083 TGTCAAGTTGGCTGAGGCAAGGG + Intergenic
925716700 2:6790836-6790858 TGTTAAGTGGGTTGAGAAGCCGG + Intergenic
927884168 2:26708262-26708284 TGCCAGGTGGGTTGAGGAACAGG + Intronic
929424878 2:41834148-41834170 GTTCAAGTGGGTTGATGACATGG - Intergenic
929910887 2:46088649-46088671 TGTAAATTGCTTTGAGGATAGGG - Intronic
930423921 2:51189520-51189542 TGTCAAGTTTGTTGAAGATCAGG + Intergenic
931808769 2:65834002-65834024 TGTCAAGTTTTTTGAGGACAGGG - Intergenic
932770661 2:74499199-74499221 TGGCACGTGGGCTGAGGACAGGG + Intronic
932851040 2:75187128-75187150 AGTCCAGTGGGTTGGGGTTAAGG - Intronic
933920849 2:87043247-87043269 TGTAAAGTAGGTGAAGGATAAGG - Intergenic
933930776 2:87150539-87150561 TGTAAAGTAGGTGAAGGATAAGG + Intergenic
934002149 2:87726652-87726674 TGTAAAGTAGGTGAAGGATAAGG + Intergenic
936558592 2:113517118-113517140 TGTCTAGTGGGTAAAGGCTAGGG + Intergenic
939956390 2:148530882-148530904 TGTTAAGTGGGATGAGGAAGTGG - Intergenic
940735809 2:157450679-157450701 TGTCAAGTTTGTTGATTATACGG + Intronic
941128553 2:161617651-161617673 AGTAAATTGGGGTGAGGATAAGG - Intronic
942467516 2:176224269-176224291 TGTCATTTGGTTTGAGGATTGGG + Intergenic
942748528 2:179263960-179263982 TGTCGGGTGGGTGGAGGACACGG - Intronic
943473120 2:188320018-188320040 TGTCTAGTGGGTAGAGGCCAGGG - Intronic
944804553 2:203268136-203268158 TCTCAAATGGTTTGAGGAAAGGG - Intronic
945045417 2:205777247-205777269 GGTCAGGTGGGTTGGGGATAGGG - Intronic
945726439 2:213476347-213476369 TGTCATGTGGGATCAGAATAAGG - Intronic
945735198 2:213590065-213590087 TGCCAAGTTGGTTGAGAATTAGG - Intronic
946628876 2:221644884-221644906 TGTCTAGTGGGGAGAGGCTAAGG - Intergenic
1169843712 20:9966809-9966831 AGTCATGAGGGTTGAGGAAAGGG + Intergenic
1170112392 20:12819840-12819862 TGTCAAGTGAGTAGAGAAAAGGG + Intergenic
1173029045 20:39337668-39337690 TGTCAAGTGGGTAGGGGACAGGG - Intergenic
1174563967 20:51451444-51451466 TGTCACGTGGGTGGAGGTCAGGG + Intronic
1177459583 21:21393226-21393248 TGTCAAGTTTGTTGAAGATCAGG + Intronic
1178761602 21:35408213-35408235 TGTCTAGTGGGTGGAGGCTGGGG - Intronic
1178978738 21:37243432-37243454 TGTCAAGTGGGAGGAGGAAGAGG + Intronic
1179542273 21:42091217-42091239 TGTCTAGTGGATTGTGGAAATGG + Intronic
1181714622 22:24715314-24715336 TGTCTAGTGGGTAGAGGCCAGGG - Intergenic
1183007450 22:34915245-34915267 TCTCAGGAGGGTTGAGGAAAGGG - Intergenic
949168257 3:966764-966786 TGTCAAATGAGGTGAGGAGAGGG + Intergenic
950695987 3:14701510-14701532 TGTCAGGTGGTATGAGGATGTGG - Intronic
950920002 3:16684622-16684644 TATCTAGTGGGTAGAGGCTAGGG + Intergenic
951901855 3:27664872-27664894 AGTCAAGATGGTTGAGGAGAAGG + Intergenic
953913927 3:46906171-46906193 AGCCAAGTGGGCTGAGGATTTGG - Intergenic
954710645 3:52503646-52503668 TGTAAAGTGGGGAGAGGATAAGG + Intronic
955039430 3:55300770-55300792 TGCCAAGTGTGTAGAGGAAAGGG - Intergenic
956158326 3:66321577-66321599 TGTCCAGTGGGTGGGGGACAGGG + Intronic
957208927 3:77235827-77235849 TGTCTAGGGGGAAGAGGATATGG - Intronic
961633180 3:128316611-128316633 TGTCACGTGGGCTGAAGATCTGG + Intronic
963956901 3:151263989-151264011 TGTTAAGTGGGTAGGGGAGAGGG - Intronic
964560397 3:157989095-157989117 TGTCAGGTTTGTTGAAGATAAGG - Intergenic
970174663 4:13327103-13327125 TGTCAAGAGGGTTGGGGGCAAGG + Intergenic
972214305 4:36877963-36877985 TGCCAAGTGGATTGCAGATATGG - Intergenic
972585833 4:40436456-40436478 TGGCAACTGGGTTGACGGTAGGG + Exonic
974078443 4:57189365-57189387 TGGCAAGTGGGGTGAGGGAAGGG + Intergenic
976691650 4:87874499-87874521 TGTTGAGTAGGTTGAGGAGAAGG + Intergenic
977743289 4:100513476-100513498 TGAGAAGTTGGTTGAGAATAAGG + Intronic
978333479 4:107641236-107641258 TGGGAAGTGGGTGGAAGATAAGG - Intronic
979997225 4:127445389-127445411 TGTTTAGTGGGTTGGGGCTAAGG - Intergenic
981125585 4:141102585-141102607 TGTAGAGTGGTTTGAGGATAAGG - Intronic
981198800 4:141953346-141953368 TGCCAAGTAGGCTGAGGAGAAGG + Intergenic
982676415 4:158381299-158381321 TGTCTAGTGGGTAGAGGCCAGGG - Intronic
983266899 4:165516859-165516881 TGTCAAGTTGGCTGTGTATATGG + Intergenic
986568481 5:9139913-9139935 TTTCAAGTGGATAAAGGATAGGG - Intronic
986642067 5:9881718-9881740 TGTCAGGTTTGTTGAAGATAAGG - Intergenic
989602896 5:43216221-43216243 TGTGAAGTGAGTTGAGGAAATGG + Intronic
991110999 5:62899194-62899216 TGTTAAGTGGCTTGAGTATATGG + Intergenic
992268675 5:75043655-75043677 GGTTCAGTGGCTTGAGGATACGG - Intergenic
996346390 5:122492941-122492963 TATCTAGTGGGTAGAGGTTAGGG + Intergenic
996456934 5:123695387-123695409 TGTCAAGTGAGCTGATGATCAGG + Intergenic
998436525 5:142114196-142114218 TAACAAGTATGTTGAGGATATGG - Intronic
998437045 5:142119431-142119453 ACTCAAGTGGGTGGAGGAAAAGG - Intronic
999151785 5:149431026-149431048 TGGGAAGTGGGTTGAGGGTGTGG - Intergenic
999625103 5:153512336-153512358 TGTTCAGGTGGTTGAGGATATGG + Intronic
999753139 5:154645280-154645302 TGTGCTGTGGGTTGAGGATGTGG - Intergenic
1000130971 5:158298917-158298939 TGTAAAGTGCTTTGAAGATAAGG - Intergenic
1003197506 6:3928225-3928247 TGTCTAGTGGGTGGAGGCTAGGG - Intergenic
1005770440 6:29065236-29065258 TGACAAGAGGCTTGAGGAAAGGG - Intronic
1006151446 6:31992262-31992284 TGCCGAGGGGGTTGAGGACAGGG + Intronic
1006157747 6:32025000-32025022 TGCCGAGGGGGTTGAGGACAGGG + Intronic
1008914578 6:56773514-56773536 TGTCAAGTGGACTAAGCATAAGG + Intronic
1009311555 6:62159875-62159897 TATCAAGTAGGCTGAGGAAAAGG + Intronic
1010627729 6:78159172-78159194 TGTCAAGGGAGCTGAAGATATGG + Intergenic
1011570769 6:88732031-88732053 TGTCAAGTAGGCTGAGGAGATGG + Intronic
1013238074 6:108216317-108216339 TGTCTAGTGGGCAGAGGCTAGGG - Intronic
1013887727 6:114989920-114989942 TGTCAAGAGGTTTGAAGAGAGGG - Intergenic
1014119784 6:117711599-117711621 TATCAAGTGGGATGAGGCCAAGG + Intergenic
1015412066 6:132904683-132904705 TGTCAAGTGGCTTGAAGAAGTGG + Intergenic
1016104389 6:140144134-140144156 TGTCAAGTGGGATAAGGCTCTGG + Intergenic
1016435093 6:144028437-144028459 TGTCAAGTGTGATGAAGATGTGG + Intronic
1017027089 6:150190885-150190907 TGGCATCCGGGTTGAGGATAGGG - Intronic
1020877820 7:13720489-13720511 TGTCTAGTGGGTAGAGAACAGGG + Intergenic
1021344144 7:19502633-19502655 TGTCAAGAGGGTTGAGGGGAGGG + Intergenic
1023806312 7:43875418-43875440 TGGCAAGTGGGCTGTGGATGAGG + Intronic
1030871622 7:114763277-114763299 TGTCAGGTGTGTTGAAGATCAGG - Intergenic
1031407463 7:121403824-121403846 TGTCATCTGAGTTGAGGATTTGG - Intergenic
1034513379 7:151553990-151554012 TGTCACCTGGGTGGTGGATAAGG - Intergenic
1036563507 8:9918374-9918396 AGTCAAGTGGGCTGTTGATAGGG - Intergenic
1039489606 8:37937568-37937590 TGGCAAATGGGGTGAGGATTAGG + Intronic
1042146446 8:65735134-65735156 TGTCAAGTAGGTTGATGGCAGGG - Intronic
1042696702 8:71561405-71561427 TGGTAATTGGGTTGAAGATACGG + Intronic
1043980087 8:86627913-86627935 TGTCGAGTAGGCTGAGGAGAAGG - Intronic
1044847829 8:96399271-96399293 AGACAAGTGGGGAGAGGATAAGG - Intergenic
1046722989 8:117641749-117641771 TATCAAGTGTAGTGAGGATATGG - Intergenic
1049894254 9:99037-99059 TGTCTAGTGGGTAAAGGCTACGG - Intergenic
1050158985 9:2697588-2697610 TGGCTGGTGGGTTGAGGAGATGG + Intergenic
1050315299 9:4395580-4395602 TGACAAGTGGGTAGAGGCCAGGG - Intergenic
1051071657 9:13175704-13175726 TGTCAAGGGGGTTGAGGAGTAGG + Intronic
1053462535 9:38281653-38281675 TGTCTAGTGGCTTGAGGGTTTGG + Intergenic
1053735481 9:41099142-41099164 TGTCTAGTGGGTAAAGGCTAGGG - Intergenic
1054692896 9:68332259-68332281 TGTCTAGTGGGTAAAGGCTAGGG + Intronic
1055673934 9:78635695-78635717 TGTCAGATGGGTTGAGTGTAGGG + Intergenic
1056063960 9:82914460-82914482 TTGCAAGTGGGTTGAGGAAGAGG - Intergenic
1056553987 9:87674130-87674152 TTTCAAGGGGGTTGAGGAGTTGG + Intronic
1059737773 9:117119427-117119449 TATCATGTGTGTTGAGGAGAAGG + Intronic
1062061671 9:134500072-134500094 TGTTGAGTGGGTTGAGGAGGAGG - Intergenic
1185718692 X:2364319-2364341 TGTCAAGTGGGTGGAGCCCAGGG + Intronic
1186645480 X:11502613-11502635 TGTTGAGTGGGCTGAGGAAAAGG - Intronic
1186826171 X:13341970-13341992 CATCTAGTGGGTAGAGGATAAGG + Intergenic
1186955518 X:14677721-14677743 TTTCTAGTGGGTTGAGGCCAGGG - Intronic
1187461521 X:19491470-19491492 AGGCAAATGGGATGAGGATATGG + Intronic
1188025101 X:25200033-25200055 CGTCTAGTGGGTAGAGGACAGGG + Intergenic
1188391084 X:29620507-29620529 AGTCAAGTGGGAAGAGGAAATGG - Intronic
1189915717 X:45853583-45853605 TGTCAAGTGGGCTATGGATTAGG - Intergenic
1190515514 X:51220104-51220126 TATCAAGTCAGGTGAGGATAAGG - Intergenic
1190889798 X:54558223-54558245 TGTCAAATGGGGGGTGGATAAGG - Intronic
1191715970 X:64193733-64193755 TATCAAAGGGGATGAGGATAGGG + Intronic
1192731301 X:73804959-73804981 TGTCAAGGGGGTTGGGGTTTGGG + Intergenic
1196964802 X:121044006-121044028 TGCCAAGAGGCCTGAGGATATGG - Intergenic
1199163995 X:144648357-144648379 TGTCACCTGGGTTTAGGAAATGG + Intergenic
1200411877 Y:2869035-2869057 TCTCAAGTGTGATGAGGAAAGGG - Intronic
1202345280 Y:23916303-23916325 TGACAAGTGTTTTGAGAATATGG + Intergenic
1202525490 Y:25753786-25753808 TGACAAGTGTTTTGAGAATATGG - Intergenic