ID: 1111877296

View in Genome Browser
Species Human (GRCh38)
Location 13:93913159-93913181
Sequence TTTCAATTCATTCTCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111877296 Original CRISPR TTTCAATTCATTCTCTATGT AGG (reversed) Intronic
900493983 1:2967889-2967911 TTTCACTTCATCCTCCATGCTGG - Intergenic
900786193 1:4652275-4652297 TTTCCTTTCATTATCAATGTCGG + Intergenic
901520634 1:9782027-9782049 TTTAGATTCATTATGTATGTCGG + Intronic
902007128 1:13241238-13241260 GTACAATTCATTCTCTGTGGAGG - Intergenic
902393805 1:16121216-16121238 CTTCAATTCAAGCTCAATGTTGG + Intergenic
903636413 1:24820709-24820731 TTATTATTCATTCTCTATGAAGG + Intronic
905534064 1:38705294-38705316 TTTCTATTCATTCTCTCCATTGG - Intergenic
908603122 1:65762928-65762950 CTTCAATACATTCTCTTTTTAGG + Intergenic
909542740 1:76808657-76808679 TTTCAGTTCTTTCTCTATTCAGG - Intergenic
909978942 1:82075173-82075195 TTTAAATTCCATCTCTATATTGG + Intergenic
910875911 1:91877556-91877578 TTTAATTTCATTCACTGTGTGGG - Intronic
913470817 1:119183571-119183593 TTTCAATTCCTTATATATTTTGG + Intergenic
917337424 1:173939856-173939878 TTTTAATTCATGCACTATCTTGG - Intronic
919549764 1:198970358-198970380 TTTCTATTTTTTTTCTATGTGGG + Intergenic
920577681 1:207073708-207073730 TGTCATTTCATTTTCTTTGTAGG + Exonic
920714483 1:208326813-208326835 TTTCAATTCATCATCTTTTTTGG - Intergenic
920795220 1:209130500-209130522 GTTCAAATGATTCTCTACGTAGG + Intergenic
920997464 1:211009179-211009201 TCTCATCTCATTCTCCATGTTGG - Intronic
921433359 1:215088126-215088148 TTTCACTTCATTCTCTCTTTGGG + Intronic
921997342 1:221435430-221435452 TTACAATTCCTTATCTAAGTAGG - Intergenic
923981574 1:239329476-239329498 TTTCAGTTCAGTCACTAGGTGGG + Intergenic
924471413 1:244345926-244345948 TTTCTATTCATTCTTCATCTAGG - Intergenic
1063293298 10:4774565-4774587 ATTCACTTAATTCTTTATGTTGG + Intergenic
1063659290 10:8022600-8022622 TTTCAAAACATTCTCGATGTAGG + Intergenic
1064882026 10:20065944-20065966 TTTAAATTCATTCTCTAAGCCGG - Intronic
1065819106 10:29508944-29508966 TTTCAATTCCATCCCTATTTCGG - Intronic
1068409241 10:56633822-56633844 TTTCAATTAATTCAGTAAGTGGG - Intergenic
1068723371 10:60272855-60272877 TGTCAGTTCGTTCTCAATGTTGG + Intronic
1070096707 10:73344364-73344386 TTTCAATACAATCTCAAAGTTGG + Intronic
1070339609 10:75485262-75485284 TTTTAATTTATTCTGTATCTGGG + Intronic
1071956811 10:90769722-90769744 TTTAAATTCCTTTTCTAGGTTGG - Intronic
1072390125 10:94975189-94975211 TTTCATTTCATTCACTCTGTTGG - Intronic
1073716332 10:106112133-106112155 TTTCATTTCGTACTGTATGTTGG + Intergenic
1073900886 10:108219477-108219499 TTACAAGTCATTGTCTATATTGG - Intergenic
1077923705 11:6660157-6660179 TCTCACTTCATGCTCTCTGTGGG - Intergenic
1078974468 11:16456341-16456363 TTTCAGTTCATTCTCTATAGAGG + Intronic
1079872118 11:25811487-25811509 TATTAACTCATTCTTTATGTTGG + Intergenic
1080189347 11:29525974-29525996 TTTCAAGTCATTCTATAAGCAGG + Intergenic
1081011586 11:37819882-37819904 TTCCAAATTGTTCTCTATGTTGG - Intergenic
1081298015 11:41415657-41415679 TTTTAATTCATTTTAGATGTTGG + Intronic
1081570557 11:44288072-44288094 GTTCAAGTGATTCCCTATGTTGG + Intronic
1085481820 11:76829384-76829406 TGACAATTCATTCTAGATGTTGG + Intergenic
1085539620 11:77254351-77254373 TTTCCTTCCATTCTCTATGTGGG + Intronic
1085772611 11:79338642-79338664 TTTCATTCCATACTCTATTTAGG - Intronic
1085774610 11:79354116-79354138 TTTAACTTTATTCTCTATCTGGG - Intronic
1085961212 11:81464697-81464719 TTTCAATCTATTCTCTCAGTTGG - Intergenic
1086323342 11:85672661-85672683 TTTCAGTTCCTCCTCCATGTGGG + Intronic
1086366905 11:86116339-86116361 ATCCAATTCTTTCTCTCTGTGGG - Intergenic
1086700129 11:89892373-89892395 ATTCAAGTCATTCTCTATGAAGG - Intergenic
1086706041 11:89952143-89952165 ATTCAAGTCATTCTCTATGAAGG + Intergenic
1087858752 11:103127045-103127067 TTTCAATTCTTTTCCTAGGTAGG + Intronic
1088081848 11:105926678-105926700 TTTCTTTTCTTTCTCTATGTTGG + Intronic
1088102210 11:106167897-106167919 TTACCATTCATTCTCTCTGAGGG - Intergenic
1088632355 11:111786055-111786077 TTTCAATTCTTCCTGTAAGTTGG + Intronic
1091329191 11:134717256-134717278 TTTCACTTCCTTCTCTGTGAAGG + Intergenic
1091518008 12:1205520-1205542 TTTCAATTTATTTTCTTTTTTGG - Intronic
1093475523 12:19550120-19550142 TTTTAATTAATTATCTGTGTGGG - Intronic
1093631133 12:21411030-21411052 TGTAATTTCATTCTTTATGTTGG + Intronic
1094646292 12:32327897-32327919 TTGCAACTCCTTCTCCATGTGGG - Exonic
1094869183 12:34579710-34579732 TTTCTTTTCATTCTACATGTTGG - Intergenic
1097780263 12:63694923-63694945 TTTCATTTCATGTTCTTTGTTGG + Intergenic
1098452289 12:70633154-70633176 TTTCAAATCATTGTTTAAGTTGG - Intronic
1098800886 12:74956328-74956350 TTTTAATTGATTTTTTATGTGGG + Intergenic
1099636427 12:85219533-85219555 TTTGAATTCATTCTCAAAATTGG - Intronic
1100472542 12:94906276-94906298 TTTTAATTCATTCTCTTTCATGG + Intronic
1101686501 12:107028709-107028731 TTTTAAATGATTCTGTATGTAGG - Intronic
1103644625 12:122381501-122381523 TTTCAATTCACTTTCTATGGAGG - Intronic
1105587105 13:21755661-21755683 TTTCCATTTATTCTCTCTGAAGG + Intergenic
1107814348 13:44231138-44231160 TTTCTATGCTTTTTCTATGTGGG - Intergenic
1109821227 13:67657966-67657988 TCTCCATTCATTCTTTGTGTTGG - Intergenic
1110325302 13:74207273-74207295 TTTCAATACATGCTTTATGCGGG + Intergenic
1110503943 13:76262411-76262433 CTCCAATTCATTCTCTCTATTGG - Intergenic
1110514620 13:76395339-76395361 TGTGAATTCAATCTATATGTTGG - Intergenic
1111093272 13:83475053-83475075 TTTCAGTTCCTTGTCTATTTTGG - Intergenic
1111190871 13:84804813-84804835 TTTCTATTCATTCTCCTTGTTGG - Intergenic
1111244418 13:85516962-85516984 TTTCAATTCATTTTTTATAATGG - Intergenic
1111795397 13:92912799-92912821 TTTCAAAGCAGTCTCTATGCTGG + Intergenic
1111877296 13:93913159-93913181 TTTCAATTCATTCTCTATGTAGG - Intronic
1112204626 13:97312104-97312126 TTTCAAGTTATTGTCTATGCTGG - Intronic
1114792262 14:25672888-25672910 TCTCATTTCATTCTGTTTGTAGG - Intergenic
1114865196 14:26583998-26584020 CTTAAATTCATTCAATATGTAGG - Intronic
1116175170 14:41460133-41460155 TTTTTATTCATTTTATATGTGGG - Intergenic
1116177541 14:41492151-41492173 TTTCAGTTCCTTGTCTATGCTGG - Intergenic
1116307759 14:43280583-43280605 TTACAATACATTTTCTATGCCGG + Intergenic
1118107158 14:62672797-62672819 TTCCAATGCATACTATATGTGGG + Intergenic
1119055439 14:71414632-71414654 TTTAAATGCATTCACTATGGAGG - Intronic
1120095098 14:80379554-80379576 TTTAAATCCATTTTCTCTGTAGG - Intronic
1120694550 14:87630249-87630271 TTTCAATTCTTTTTGGATGTTGG - Intergenic
1123400922 15:19985563-19985585 ATTGAATTTATTCTCAATGTTGG + Intergenic
1124901887 15:33831674-33831696 TTTCTATTCATTGTCTATGGTGG + Intronic
1125204419 15:37136533-37136555 CTTCAATTACTTCTCAATGTTGG - Intergenic
1125250419 15:37695823-37695845 TTTCTATTCACAGTCTATGTAGG + Intergenic
1125891444 15:43270023-43270045 TTTTAATTCATTCACTCTATCGG - Intergenic
1126064159 15:44812255-44812277 TTTCAATTCAGTATATTTGTAGG + Intergenic
1126591120 15:50340806-50340828 TACCATTTCATTCTCTTTGTAGG + Intronic
1128023700 15:64415916-64415938 CTCCAATCCATTCTCTACGTAGG - Intronic
1128373507 15:67058663-67058685 TTTCAATGCATCCTCTCTGGTGG + Intergenic
1129581270 15:76813532-76813554 TTTGAATTGATTCTATATGCAGG + Intronic
1131383670 15:91985253-91985275 TTGCAGTACATTCTCTTTGTTGG + Intronic
1131883987 15:96889583-96889605 TGTCAATTCAAACACTATGTCGG + Intergenic
1131959603 15:97774526-97774548 TTTTAATTCATTGGTTATGTAGG - Intergenic
1133708012 16:8373919-8373941 TTTCTTTTCATTCTTTGTGTGGG - Intergenic
1133891482 16:9883493-9883515 TTTCCATTGATTCTATATCTGGG - Intronic
1134381297 16:13729119-13729141 TTTCAATTCCTCCTATAAGTGGG + Intergenic
1139110994 16:63890560-63890582 TATAAATTCAATCTCTATATTGG + Intergenic
1140089743 16:71827881-71827903 TTTCAATACCTTCTTTATGGTGG - Intergenic
1143331083 17:6136244-6136266 TTTCAATTCTTTGTCTGTGGGGG - Intergenic
1143420229 17:6784441-6784463 TTTGACTTCATTTTCTATTTGGG - Intronic
1143975425 17:10825790-10825812 TTTCATTTCATTTTCTTTTTTGG - Intronic
1144097468 17:11914295-11914317 TTTTTATTCGTTCTCTATATTGG + Intronic
1144214078 17:13039307-13039329 TTTCCCTTCATTCTATAGGTGGG - Intergenic
1147004536 17:37391629-37391651 TTTCCTTTCAATCTCTAGGTTGG + Exonic
1147676872 17:42213027-42213049 TTTCACTTAATCCTCTATCTGGG + Intronic
1148033658 17:44641224-44641246 TTTCAATTAATTCCATGTGTTGG - Intergenic
1151495523 17:74455834-74455856 TTTCAACTCATTCTCTCCTTGGG + Intergenic
1153213929 18:2799582-2799604 TTACACTTCCTTCTCTATATGGG + Intronic
1153994431 18:10427703-10427725 TTACAATTCATGCTCCAAGTAGG + Intergenic
1155231749 18:23780921-23780943 TTCTAATTCATTCTCCATGCTGG - Intronic
1155635510 18:27950155-27950177 TTTCTATTGATTCACTTTGTAGG - Intergenic
1156271510 18:35537874-35537896 TTTTAATTAATTCTTTATTTTGG + Intergenic
1156816703 18:41320187-41320209 TTACAATCTATTCTCTATGAAGG - Intergenic
1157184495 18:45526869-45526891 TCTCTATTCATGCTCTTTGTGGG - Intronic
1157474928 18:48017469-48017491 TTTCACTTTATTCTACATGTTGG - Intergenic
1157921270 18:51715022-51715044 TTCCAATTAAATCTCTATGTAGG - Intergenic
1158250120 18:55478617-55478639 TTTGAATTCATTCTGCATTTCGG - Intronic
1158561400 18:58516762-58516784 TTTCAATTCAATCTCAATGCTGG - Intronic
1159221398 18:65468754-65468776 TTTCAATTTATTGTCTTTCTAGG + Intergenic
1159816612 18:73081776-73081798 TTTCAATTGATTATCAATGTTGG - Intergenic
1160669368 19:349903-349925 TTTCTATTCATTCTCTTTTATGG - Intergenic
1162214378 19:9121071-9121093 TTTCAATTTTTTCTTTATTTTGG - Intergenic
1162647871 19:12063357-12063379 TTTGCATCCATTCTCTCTGTGGG - Intergenic
1163356021 19:16811686-16811708 TTTCTATCCAATCTCTATGGAGG + Intronic
1164067340 19:21729335-21729357 TTTCAGTACATTTTGTATGTAGG - Intronic
1164081181 19:21862740-21862762 TTTCAAAACCTTTTCTATGTGGG + Intergenic
1164170992 19:22725138-22725160 AGTCAATACATTCTGTATGTTGG - Intergenic
1164662819 19:29992847-29992869 TTTCAAGTCATTCTATATACCGG - Intronic
1164990900 19:32682986-32683008 TTTAAATTCAGGCTCTAAGTCGG + Intergenic
1165193895 19:34086281-34086303 GTTTCATTCATTCTCAATGTGGG - Intergenic
1165260770 19:34615447-34615469 TTTTTTTTCATTCTCAATGTAGG + Intronic
1165280135 19:34789721-34789743 TTTCAGTTCATTATATATTTTGG + Intergenic
1166510462 19:43405380-43405402 TTTCATTATATTCACTATGTTGG - Intronic
1166654992 19:44604577-44604599 TTACAATCCATTCTCTCTGAAGG + Intergenic
1167607011 19:50486754-50486776 TTTCAAGTCATTCTATGGGTGGG - Exonic
1167881158 19:52458526-52458548 TTTCAATTTATTGTCTACATAGG + Intronic
925600055 2:5599032-5599054 TTTCAAAGCATTTTCTATGATGG - Intergenic
927077012 2:19588849-19588871 TTTCATTTCATTGGCTATGAAGG - Intergenic
927404150 2:22748598-22748620 TTGTAATTGATTCTCTTTGTTGG - Intergenic
927800033 2:26090123-26090145 TTTCATTTCTTCCTCTTTGTTGG + Intronic
927910681 2:26896749-26896771 TTTCAATTCCTTATTTATTTTGG + Intronic
928151759 2:28837142-28837164 TTCCAATACATTCCCTATATTGG - Intronic
929315860 2:40477785-40477807 TTTGCATTCATTCCCCATGTTGG - Intronic
930343461 2:50147440-50147462 TTTTAGTGCATTCTATATGTGGG + Intronic
930733139 2:54747589-54747611 ATTAAGTTCATTCTTTATGTGGG - Intronic
930885743 2:56323872-56323894 ATTCTATTTGTTCTCTATGTGGG - Intronic
931028680 2:58144982-58145004 ATGTAATTCATTCTCTATTTTGG + Intronic
931371262 2:61665244-61665266 TTTCAATTCATAGGCTATCTTGG - Intergenic
931501251 2:62870099-62870121 TTTCAAAACACTCTATATGTGGG + Intronic
931928329 2:67099571-67099593 TTTCATTTTATTCACAATGTTGG + Intergenic
932067447 2:68580782-68580804 TTCCCATTCAGTCTCTTTGTTGG + Intronic
933168631 2:79100333-79100355 CTTCAATACATTCTCTTTTTTGG - Intergenic
933375895 2:81479414-81479436 TTTCATTTAATTCTCTTTTTTGG + Intergenic
934609757 2:95726309-95726331 TTTCAAATATTTCTCAATGTTGG - Intergenic
935508258 2:103934765-103934787 TTTCTGTTCATTCTCTATCATGG - Intergenic
935724630 2:106012572-106012594 TTTCAAGTCATCATCTGTGTGGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936550223 2:113431597-113431619 TTTGAATTCATTATCTTTGGTGG - Intergenic
936766401 2:115854232-115854254 TTTCAATTGATTTTATATCTTGG + Intergenic
937284707 2:120742901-120742923 TTTAAACTCATTCATTATGTTGG + Intronic
937881578 2:126870540-126870562 TTTCATTTCATTCTTGATATTGG - Intergenic
938690084 2:133779676-133779698 ATTCATTTCATTCAATATGTGGG - Intergenic
939507414 2:143064449-143064471 TTTAAATTCCTACTATATGTAGG - Intergenic
941412204 2:165172916-165172938 TTGCAATTCTTTCACTATGCAGG - Intronic
942889318 2:180968242-180968264 TTTTAAGTCATTCTCAATTTAGG - Intronic
942957119 2:181786673-181786695 TTACAATGCATTCTCTAGGTAGG - Intergenic
943071942 2:183151819-183151841 TATCAATTCATTCTTTTTGTTGG + Intronic
943403168 2:187442401-187442423 TTTCATTACATTCTCAATGTGGG + Intronic
943540076 2:189202722-189202744 TTTAAAATCATTATCTTTGTTGG + Intergenic
944901099 2:204217011-204217033 TTTCAATTCACTTTCTACATCGG + Intergenic
945129339 2:206551673-206551695 TTTCAAGGCATTCTCTGAGTAGG - Intronic
945728224 2:213500113-213500135 TTTCATATCATTCTCCATTTGGG + Intronic
945979376 2:216296729-216296751 TTTCAATTCTTTCTCTATGTGGG + Intronic
948148023 2:235723179-235723201 TTTCATCTCATTCTCTTTATAGG - Intronic
1173120550 20:40285429-40285451 TTTCTAATTAATCTCTATGTTGG - Intergenic
1173758287 20:45537771-45537793 TTTCATTTCTTCCTCTATTTTGG - Intronic
1174538688 20:51272813-51272835 TTTGAATACCTTCTCTTTGTCGG + Intergenic
1176345906 21:5746424-5746446 TTTCAACTCATTTTCCATGATGG + Intergenic
1176352720 21:5867008-5867030 TTTCAACTCATTTTCCATGATGG + Intergenic
1176498921 21:7578031-7578053 TTTCAACTCATTTTCCATGATGG - Intergenic
1176540227 21:8144494-8144516 TTTCAACTCATTTTCCATGATGG + Intergenic
1176559178 21:8327539-8327561 TTTCAACTCATTTTCCATGATGG + Intergenic
1176965698 21:15209278-15209300 CTCCAATTCAATCTCTATCTGGG + Intergenic
1177171852 21:17663792-17663814 TTCCAATTCCTTCTCTATGCAGG - Intergenic
1177702950 21:24662459-24662481 TTTAAAATCATTCTCAATTTTGG - Intergenic
1177811506 21:25929621-25929643 TTCCAATTCATTCTATATCTAGG - Intronic
1178111721 21:29376010-29376032 TTTAAATTCTTTCTCTAGGCTGG - Intronic
1183290180 22:36996958-36996980 TTTCAATTCCTTCTTTATGTGGG - Intronic
1184198620 22:42949217-42949239 TTTAAATTCCTACTCTGTGTAGG - Intronic
1184538868 22:45106666-45106688 TCTGAATTCATTCACTATGTTGG + Intergenic
1184953299 22:47861651-47861673 TTGCAATTCCTTTGCTATGTAGG + Intergenic
1203245170 22_KI270733v1_random:60861-60883 TTTCAACTCATTTTCCATGATGG + Intergenic
949249698 3:1968485-1968507 TTTAAAAACATTCTTTATGTTGG - Intergenic
951457372 3:22907526-22907548 TTTCAAATCATTCACTGTGAAGG + Intergenic
951598274 3:24342181-24342203 TTTTAAACCATTTTCTATGTAGG - Intronic
951883498 3:27502055-27502077 TTGCAATACCTTCTCTATCTAGG - Intergenic
955887002 3:63610905-63610927 TTTCAATTCATTCTTTATTTTGG - Intronic
956311289 3:67883403-67883425 TTTGAACTCATTCTTTATATAGG + Intergenic
957927792 3:86837146-86837168 TATCTATTCATTCTCAATGCCGG - Intergenic
957931649 3:86886232-86886254 TTTCAATTGATTTTCAATTTTGG - Intergenic
959200819 3:103244491-103244513 TTTCAATTCTTGTTATATGTAGG + Intergenic
959207573 3:103330295-103330317 CTTCAATTCCTTCTCTATATTGG - Intergenic
959237494 3:103743478-103743500 TTCCAAATCACTCTTTATGTAGG + Intergenic
959930013 3:111970235-111970257 TTTTAATCCATTCTTTATTTAGG + Intronic
960237418 3:115299804-115299826 TTTCAATTCTTTGTCATTGTTGG - Intergenic
960457703 3:117893439-117893461 TTTCAATCCATTCTTCATATGGG - Intergenic
961537940 3:127581181-127581203 GTTCAAATCATTCTAAATGTTGG - Intronic
963364231 3:144314215-144314237 TTTCCATTCTTTCTCTTTTTAGG + Intergenic
963622138 3:147623901-147623923 TTTCTCTTCCTACTCTATGTGGG - Intergenic
963994771 3:151694811-151694833 TTTCAATTAATTCTCCCTTTTGG + Intergenic
964020581 3:152005485-152005507 TTTAAACTCATTTTCTTTGTAGG - Intergenic
965049852 3:163632575-163632597 TTTTAATTTAATCTCTATATAGG + Intergenic
965316758 3:167201123-167201145 TTTCAAATCATTAACTATCTTGG - Intergenic
965494530 3:169381775-169381797 GTTCAATTCATTATCCATCTGGG + Intronic
965913208 3:173807974-173807996 TTTCAATGAATTCTATAGGTTGG + Intronic
966665019 3:182462990-182463012 TTTTACTTAATTCTCTGTGTTGG + Intergenic
967279293 3:187806541-187806563 TATCTATTCCTTCTCTGTGTTGG + Intergenic
969216165 4:5724039-5724061 TTCCAATTCATTCTCCCTGTGGG - Intronic
971570127 4:28201334-28201356 TTTCACTTCAAACTCTATCTAGG - Intergenic
973023786 4:45239923-45239945 TTCCAATTCTATCTCTGTGTTGG - Intergenic
973059778 4:45707721-45707743 TTTCATTGCATTTTCTATATTGG + Intergenic
973192582 4:47402387-47402409 TCTAAATTCATTTTCTATTTAGG - Intronic
974344408 4:60660707-60660729 GTTAAATATATTCTCTATGTTGG - Intergenic
975228557 4:71904297-71904319 TTAGATTTCATACTCTATGTAGG - Intergenic
975635153 4:76441001-76441023 TTTCCATTCTTTATCTATGGAGG + Intronic
977071643 4:92397551-92397573 TTTCAGTTTATTCCATATGTTGG - Intronic
977165572 4:93692075-93692097 TTTGAATACATGTTCTATGTAGG - Intronic
977763035 4:100762374-100762396 TTTCAGTTCATTTTCAGTGTAGG + Intronic
979015486 4:115427295-115427317 TTTTAATTCATTTTCTCTTTTGG + Intergenic
979274991 4:118805533-118805555 GTTTAATTTATTCACTATGTTGG - Intronic
979545155 4:121932271-121932293 CTTGAACTCCTTCTCTATGTTGG + Exonic
979569252 4:122198157-122198179 TTTCAATTGATTATCTAAGCAGG - Intronic
979723288 4:123929156-123929178 TTTTTATTCTTTCTTTATGTAGG - Intergenic
980715733 4:136626261-136626283 TTTCCATACATTCTCTAGATTGG + Intergenic
981123699 4:141081720-141081742 TATCAGTTAATTCTCTAAGTAGG - Intronic
982659321 4:158188351-158188373 TTTCAATGCTTTCTCTAGGGAGG + Intergenic
983653238 4:170054473-170054495 TTCCGATCCATTCTCTATGCTGG + Intergenic
983991501 4:174125387-174125409 TTTCAATCTATTCTCTATTTGGG + Intergenic
984004479 4:174292771-174292793 TTTTATTTCATTTTCTATCTGGG + Intronic
985114117 4:186574285-186574307 GTTCAGTCCATTCTCTCTGTTGG - Intergenic
986771892 5:10981667-10981689 TTTCAGTTCTTTATGTATGTTGG + Intronic
986942317 5:12969135-12969157 TTTCAAATCACACTCAATGTGGG - Intergenic
987448696 5:18054749-18054771 TTTCAATCCTTTCTCCATATTGG + Intergenic
989473723 5:41850551-41850573 TTTTATTTCATGATCTATGTTGG + Intronic
989989996 5:50751616-50751638 TTTCATTTGATTCTCAATGCCGG + Intronic
990012599 5:51018607-51018629 TTTCAATACAACCTCTTTGTAGG + Intergenic
990113149 5:52352962-52352984 TTTAAATTCATATGCTATGTAGG + Intergenic
992339314 5:75806150-75806172 TTAAGATTCATTCTCTTTGTTGG + Intergenic
994041664 5:95265830-95265852 TTTCAATTCCTTATGTGTGTAGG + Intronic
995081800 5:108059879-108059901 TTTAAAATCACTCTCTATGTAGG - Intronic
995560099 5:113371355-113371377 TTTAATTTCATTCTCTGTATAGG - Intronic
995802647 5:116015567-116015589 TTTAAATTAACTCTTTATGTTGG + Intronic
996256185 5:121405663-121405685 TTCCATCTCATTCTCCATGTTGG - Intergenic
997023157 5:130025920-130025942 TTTCAATCCATTCTCAATGGTGG - Intronic
997752111 5:136356608-136356630 CTTAAATTCAGTCTCAATGTTGG + Exonic
998287116 5:140873547-140873569 TTTCAATTTATTTTCTAGTTTGG + Intronic
998553317 5:143098769-143098791 ATTAAATTCATTTTCTATGAGGG - Intronic
998648794 5:144093915-144093937 TTTCAAATCATTTTCTAGGTGGG + Intergenic
999839998 5:155414473-155414495 TTTCACTTCATTGTTTATCTGGG - Intergenic
1000196665 5:158966003-158966025 TTTCATTTTGTTCTCTATCTGGG + Intronic
1000630752 5:163587839-163587861 CTTCAATTTATTCTCCGTGTTGG - Intergenic
1001207487 5:169777919-169777941 GATGAATTCATTCTCTAAGTTGG - Intronic
1002564497 5:180102143-180102165 TTTCACTTCATTTTCTGTCTAGG - Exonic
1003583221 6:7361422-7361444 TTCCATTTCATTTTTTATGTTGG - Intronic
1003833548 6:10041839-10041861 TATCCATTCATTCTATTTGTAGG - Intronic
1004264963 6:14141272-14141294 TTTTATTTCATTCTCCCTGTGGG + Intergenic
1004853094 6:19720520-19720542 CTCCAATTCATTATATATGTGGG - Intergenic
1005463779 6:26092598-26092620 TTTCACTTCCTTCTATAGGTTGG - Intronic
1006590808 6:35155456-35155478 TTTCACTTTATTTTCTTTGTTGG + Intergenic
1007161514 6:39794981-39795003 TTTCAACTCTTTCTACATGTGGG + Intronic
1008897800 6:56577660-56577682 TTTTAATTCATGCTCTATTTAGG + Intronic
1009251623 6:61308019-61308041 TTTCTTTTCATTCTGTATTTTGG + Intergenic
1010296639 6:74206420-74206442 TTTTATTTGATTCTCTGTGTTGG + Intergenic
1010609405 6:77934878-77934900 TTTCAATTCATTCTTCACCTAGG - Intergenic
1011088199 6:83566721-83566743 TTTCATTTTATTATTTATGTTGG - Intronic
1011425168 6:87220352-87220374 TTTCAAAGCATTCACTATGATGG - Intronic
1013273937 6:108566246-108566268 TTTCATTTCATTTTCTAAGAAGG - Intronic
1013872715 6:114786329-114786351 TTCCAGATCATTCTCTTTGTAGG - Intergenic
1014681469 6:124436030-124436052 TATCATTTAATTCTCTATATTGG - Intronic
1014875307 6:126651439-126651461 TTTAAATTTAATCTCTTTGTAGG + Intergenic
1015092720 6:129378124-129378146 CTTCCTTTCATTCTCTATCTTGG - Intronic
1015599223 6:134896017-134896039 TTTCTACCCATTCTTTATGTTGG - Intergenic
1016239548 6:141913460-141913482 TTTCCATTCTTCCTCTATGGAGG - Intergenic
1016843809 6:148550900-148550922 TTTTAATTCGTTCTCCATGAAGG + Exonic
1017089213 6:150743625-150743647 TTTAAATGCATTCTTTATTTAGG + Intronic
1017196441 6:151705601-151705623 TGTCTCTTCATTCTCTATTTAGG + Intronic
1017482677 6:154873045-154873067 TTTCAATTCCCCCTCTATTTTGG + Intronic
1018347899 6:162921810-162921832 CTTCAATTAATTCTCTTTTTTGG - Intronic
1020587847 7:10093025-10093047 TTTCAATTCATTTGGTAAGTAGG + Intergenic
1021589496 7:22245182-22245204 TTTCAATTCTTTATATATGTTGG + Intronic
1022172501 7:27843440-27843462 TTTCAGTGCATACTCTATGGAGG - Intronic
1022938842 7:35211000-35211022 TTTCATTTCATGTTCTTTGTTGG + Intronic
1023200937 7:37695585-37695607 TTTCCTTCCGTTCTCTATGTGGG + Intronic
1024057630 7:45673470-45673492 TTTCAATTTACCCTTTATGTTGG + Intronic
1026668824 7:72368784-72368806 TTTCAAACCATTCTCTGTGATGG - Intronic
1027438873 7:78196777-78196799 TTTTAATTTGTTTTCTATGTGGG + Intronic
1027668672 7:81070918-81070940 TCTCAATACCTTCTCTCTGTAGG - Intergenic
1027749307 7:82121430-82121452 TTTCTATTCATTCTTTATTTGGG - Intronic
1028068974 7:86426156-86426178 TGTCAATTCATTCTCTTTACTGG + Intergenic
1028080934 7:86574978-86575000 ATTCAATTTATTCTCTGTGAAGG + Intergenic
1028241206 7:88423184-88423206 TTTCAACTCATTGGCTATATGGG + Intergenic
1029603401 7:101583371-101583393 TTTGTATTCACTCTCTCTGTAGG + Intergenic
1031058313 7:117019410-117019432 TTTCAATTATTTCTTTGTGTGGG + Intronic
1031237382 7:119194122-119194144 TTTCAAAAAATTCTGTATGTAGG - Intergenic
1032342036 7:131082883-131082905 CCTCAATTCCTCCTCTATGTGGG - Intergenic
1033599356 7:142877579-142877601 TTTCAAGTCAGTCTCTGTGATGG - Intronic
1035974638 8:4294560-4294582 TTTCACTTCATTCTCTAACATGG - Intronic
1038151695 8:24947040-24947062 TGTCAATTTCTTCTCCATGTGGG - Intergenic
1038381760 8:27101987-27102009 TTTCATTTTATTCTATTTGTAGG + Intergenic
1038910532 8:31958547-31958569 ATTCACTACATTCTCCATGTAGG - Intronic
1039089736 8:33815100-33815122 ATTCAATTTATTCTCTCAGTAGG + Intergenic
1039757772 8:40541704-40541726 TTTCATTTTATTTTCTATTTGGG - Intronic
1040343929 8:46467216-46467238 TTTCTTTTCATTTTGTATGTTGG - Intergenic
1041581890 8:59470495-59470517 TTTCAATTGATGTACTATGTGGG + Intergenic
1041587093 8:59533641-59533663 TTTTTATTCATTTTGTATGTAGG - Intergenic
1041995717 8:64054814-64054836 TCTAAAATCATTCTCTTTGTTGG + Intergenic
1043823499 8:84897048-84897070 ATTCAATTCCATTTCTATGTAGG - Intronic
1044795931 8:95897626-95897648 TTTCATTTCTTTCTCTCTGGTGG + Intergenic
1045993525 8:108337815-108337837 TTTCAATTGATTCCAAATGTAGG + Intronic
1046865716 8:119148126-119148148 TTTCAATGTAATTTCTATGTAGG - Intergenic
1047264463 8:123293019-123293041 TTTGAATTCATTTTATATGAAGG - Intergenic
1048036980 8:130686014-130686036 TTTAAATTCATTTTCTATAGTGG + Intergenic
1049902715 9:185223-185245 TTTGAATTCATTATCTTTGGTGG + Intergenic
1050240414 9:3628704-3628726 TTTCTATACATTCTGAATGTAGG + Intergenic
1050275705 9:3996715-3996737 ACTTCATTCATTCTCTATGTTGG - Intronic
1051140263 9:13970998-13971020 TTTCAGTTAATTCTCCTTGTAGG - Intergenic
1051415869 9:16839783-16839805 TTTCAATTCAGTCTATATATTGG - Intronic
1052119266 9:24690130-24690152 CTTCAATTTATTTTCTATGGAGG - Intergenic
1052309034 9:27044080-27044102 TTTCACTTCATTCTCTGCCTCGG + Intronic
1052498508 9:29259040-29259062 TTTCATTTCATGCAGTATGTGGG + Intergenic
1052567237 9:30170872-30170894 TTTCAATTTCTTTTCTATGTTGG + Intergenic
1053325256 9:37139909-37139931 TTTCAATACTTTTTCTATATTGG + Intronic
1053745738 9:41195509-41195531 TTTGAATTCATTATCTTTGGTGG + Intronic
1054481532 9:65669705-65669727 TTTGAATTCATTATCTTTGGTGG - Intronic
1054682605 9:68235763-68235785 TTTGAATTCATTATCTTTGGTGG - Intronic
1054794096 9:69282437-69282459 TTGCACTTCATTTTCAATGTGGG + Intergenic
1055018250 9:71642509-71642531 TTTCAATTTATTCTCTACACAGG - Intergenic
1055459657 9:76506841-76506863 TTTCAGTTCGTTTTCTCTGTAGG + Exonic
1055749318 9:79487259-79487281 TCTCAGTTCATTCTGGATGTAGG + Intergenic
1055982788 9:82021872-82021894 TTTCAAAAGATTCTCTATATTGG - Intergenic
1057103198 9:92384367-92384389 TTTCAATACATACTTTATGGTGG + Exonic
1202781870 9_KI270718v1_random:6289-6311 TTTGAATTCATTATCTTTGGTGG + Intergenic
1203461505 Un_GL000220v1:43930-43952 TTTCAACTCATTTTCCATGATGG + Intergenic
1186299706 X:8186792-8186814 TGTCAGTTCCTTCTCTATTTTGG - Intergenic
1187830588 X:23377085-23377107 TTTCCATCCATTCTCTATGACGG - Intronic
1188197480 X:27255145-27255167 ATTAAATTCATTCTCTAACTTGG + Intergenic
1189621358 X:42843224-42843246 TTTCATTTCATTCATTATTTAGG + Intergenic
1189924858 X:45942006-45942028 TATCAGTTCATTCTTTGTGTGGG + Intergenic
1190272232 X:48874677-48874699 TTTAAATTTTTTCTCTATCTGGG + Intergenic
1192300544 X:69897040-69897062 TTTCAATTCATTGTCTATTCTGG - Intronic
1192905122 X:75543421-75543443 TTTAAAAACATTCTCTAAGTTGG + Intergenic
1192971125 X:76231715-76231737 TCTCATTGTATTCTCTATGTTGG - Intergenic
1193274067 X:79565071-79565093 TTTCAATTCCTTATATATGCTGG + Intergenic
1194224260 X:91236134-91236156 TTTCCATTTATTCTCTACGTTGG + Intergenic
1196631665 X:117948004-117948026 ATACAAGTCATTCTCAATGTGGG + Intronic
1197193509 X:123675342-123675364 TTTCAATTCCTTATCTAGGCTGG + Intronic
1197516583 X:127439155-127439177 TTTCAATACATTCACTTTGAAGG - Intergenic
1199482829 X:148316552-148316574 TTTATATTCATGTTCTATGTGGG + Intergenic
1200560721 Y:4699497-4699519 TTTCCATTTATTCTCTACGTTGG + Intergenic
1200890252 Y:8315642-8315664 TCACAATGCATTCTCTAGGTAGG - Intergenic
1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG + Intergenic
1201719011 Y:17077094-17077116 TTTCTCTTCCTTCTCTGTGTGGG + Intergenic
1202167650 Y:22008686-22008708 TTTCACTTTATTTCCTATGTAGG + Intergenic
1202223710 Y:22577683-22577705 TTTCACTTTATTTCCTATGTAGG - Intergenic
1202319406 Y:23617978-23618000 TTTCACTTTATTTCCTATGTAGG + Intergenic
1202551363 Y:26052079-26052101 TTTCACTTTATTTCCTATGTAGG - Intergenic