ID: 1111880146

View in Genome Browser
Species Human (GRCh38)
Location 13:93945727-93945749
Sequence CTGAATATACAAATGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 7, 2: 23, 3: 90, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111880146 Original CRISPR CTGAATATACAAATGGGCAG TGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
907040953 1:51258904-51258926 CTAAATATACAAAGGCCCAGTGG - Intronic
908020738 1:59895886-59895908 GTGAATAAATAAATGGGGAGGGG - Intronic
908121846 1:60993255-60993277 CTGAAAAAGGAAATGGGCAGGGG + Intronic
908899088 1:68935114-68935136 CTGAATATTCAAATAGGATGTGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909193080 1:72579432-72579454 GTGTATATATAAATGGGAAGCGG + Intergenic
909404969 1:75278064-75278086 CTGAATAGACACATGGGTAGTGG - Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
909987102 1:82174401-82174423 CTGCTTAAAAAAATGGGCAGAGG + Intergenic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
911819382 1:102397890-102397912 CTGAATATTCAAATGAGATGAGG + Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913050398 1:115112578-115112600 CTGAATAGGCAAATGCCCAGAGG - Intergenic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914879785 1:151538402-151538424 CTGACTGTAAAAATGGGAAGAGG + Exonic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
915016927 1:152743063-152743085 CTTTATAGACACATGGGCAGAGG - Intronic
916552937 1:165866294-165866316 CTGAAACCACAATTGGGCAGGGG - Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917823624 1:178792997-178793019 CTGATTTTACAAAGGGGGAGGGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919573297 1:199275520-199275542 CTGAGTTAAAAAATGGGCAGAGG + Intergenic
920403337 1:205691108-205691130 AAGGATATACAAATGGGAAGAGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922722780 1:227907015-227907037 GTGAAAAGACAAATGGGCATGGG - Intergenic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923880941 1:238103642-238103664 CTGAATTTACAGATGTGAAGGGG + Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924604070 1:245517062-245517084 ATGAATATAAAAATGGGGATGGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1064399925 10:15012793-15012815 CTGAATATCCAAAGAGGGAGAGG + Intergenic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067788350 10:49269565-49269587 CTGGACATACAGATAGGCAGTGG - Intergenic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068313880 10:55316566-55316588 CTGAAGCTACAAATGGGCTCAGG - Intronic
1068440307 10:57046152-57046174 CTGAATATAGAAATGGGAGTTGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069057991 10:63864856-63864878 CTGAAACTAGAAATGGGCAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070274949 10:74997058-74997080 CCTAATAGAGAAATGGGCAGAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071421918 10:85509034-85509056 GTGAATAGACAAATGAGCATGGG + Intergenic
1072230822 10:93412743-93412765 ATGAGTAAACAAATGGGAAGGGG + Intronic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075440291 10:122474756-122474778 CTGAAAAAAAAAATGTGCAGTGG + Intronic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1078521483 11:12067307-12067329 CTTAGTAAGCAAATGGGCAGTGG + Intergenic
1079012215 11:16838158-16838180 CTCAGTAGAAAAATGGGCAGAGG + Intronic
1079291295 11:19190417-19190439 TTCAATATACAAATGATCAGTGG - Intronic
1079541811 11:21585317-21585339 CTTGATTTAAAAATGGGCAGAGG + Intergenic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081836551 11:46160174-46160196 CTGCCTGTACAAACGGGCAGAGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082936599 11:58662636-58662658 CTTAATATCCAAATGGGGAGAGG - Intronic
1084455653 11:69266719-69266741 CTGAACAAAGAAATGTGCAGGGG - Intergenic
1084655727 11:70516771-70516793 CTGAATATAAAAATGGGGCTGGG + Intronic
1085074056 11:73573951-73573973 CTCAAAATACCAAGGGGCAGGGG + Intronic
1085831384 11:79904960-79904982 CTGAATTTAGAGATGGGGAGAGG - Intergenic
1086444660 11:86860160-86860182 CTTAATATCCATATGGGGAGAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1091890063 12:4046330-4046352 CTGGAAATAGAAATGGGCATGGG - Intergenic
1091938272 12:4450756-4450778 CTGAATCTGCAAAGGGGCAGAGG + Intergenic
1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG + Intergenic
1093029039 12:14271275-14271297 GTTGAAATACAAATGGGCAGTGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093714034 12:22361177-22361199 CTGGAAATACCAATGGGCATAGG - Intronic
1094237835 12:28189108-28189130 CTGGATATACAAGTGAGAAGTGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096506707 12:52098326-52098348 CTGAATATCCAAAGAGGGAGAGG - Intergenic
1096812140 12:54177915-54177937 TTCAACATACAAATCGGCAGGGG - Intronic
1097258966 12:57702909-57702931 CTCAATTCAAAAATGGGCAGAGG - Intronic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1098627935 12:72696466-72696488 GTGAAAAGACAGATGGGCAGAGG - Intergenic
1098677814 12:73313634-73313656 CAGAAAATACAAAAGAGCAGGGG - Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1100928327 12:99576069-99576091 CAGAAAACACAAAAGGGCAGAGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102929668 12:116852502-116852524 CTGAATAATCAAGTGGGAAGGGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105067566 12:133214102-133214124 CCCAATATCAAAATGGGCAGAGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108144781 13:47464652-47464674 CTGAAAATTCAAAAGGCCAGAGG + Intergenic
1108248097 13:48537468-48537490 CCCAATTTAAAAATGGGCAGAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109354245 13:61219253-61219275 CTTAATATACAGGTGGGGAGAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109523786 13:63547267-63547289 CATAATATACAAATGAGCAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109807398 13:67461350-67461372 CAGAGGATACAAATGGTCAGTGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110517707 13:76435913-76435935 ATGAATATAAAAATGGGAGGAGG - Intergenic
1111025906 13:82523386-82523408 CTGAGAAAACAAATGGGTAGTGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112780056 13:102890617-102890639 CAGAATATATAAATGGGATGGGG - Intergenic
1112978554 13:105352323-105352345 TTGTATTTACAAATAGGCAGTGG - Intergenic
1113050858 13:106210491-106210513 CTGAATATATTGCTGGGCAGAGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114436536 14:22711670-22711692 CCGAATATCCAAAGGGGGAGAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115142030 14:30182730-30182752 TTAAATATGCAAAAGGGCAGGGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115705090 14:35990331-35990353 CTGAATATATTGGTGGGCAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116487973 14:45474425-45474447 CTGGATATACAAATATGAAGTGG - Intergenic
1116890434 14:50262648-50262670 ATGAAAATAAAAATGAGCAGGGG - Intronic
1117793955 14:59372131-59372153 CCAAATATACAAATAGGCAGTGG - Intergenic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1119816891 14:77577556-77577578 GTGAATATACACATGAGAAGGGG + Intronic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1125500702 15:40238974-40238996 CTGAATTTACAAATCAGCTGGGG - Intronic
1127641540 15:60920394-60920416 CTTCACATACAAATGGGCATAGG - Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1128571109 15:68733494-68733516 ATGTATATATAAATGGCCAGAGG + Intergenic
1129910853 15:79225236-79225258 CTGATTTAAAAAATGGGCAGAGG - Intergenic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131492551 15:92875537-92875559 CTGATTATTTAAATGGGCAAAGG - Intergenic
1131883679 15:96886274-96886296 CTGTGAATACAAATGGGGAGTGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1131980377 15:97988635-97988657 CTAATTATAAAAAGGGGCAGAGG - Intergenic
1133493926 16:6298034-6298056 CTGCATTTGCAAATAGGCAGAGG + Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134129406 16:11639082-11639104 ATGAGTAAACAAATGGGTAGAGG + Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136061197 16:27727650-27727672 CTGAAAATGCAAATGGTCATAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1139330341 16:66183674-66183696 TTGAAAATACAACTGGGGAGGGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143175979 17:4955330-4955352 CTGGATCTCCACATGGGCAGGGG + Intronic
1146428023 17:32762428-32762450 GTGAAAGTACAAATGGGGAGAGG - Intronic
1146800945 17:35821597-35821619 CTTATTATAAAAATGGGCTGGGG - Intronic
1149032559 17:52100551-52100573 CTGAACAGAGAAATGGGGAGAGG + Intronic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1152144645 17:78561065-78561087 CTGAATATGCAAACAAGCAGTGG + Intronic
1152212654 17:79010519-79010541 CTGAAGGTGCAGATGGGCAGGGG - Intergenic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157458957 18:47867279-47867301 CTGGTTTTACAAATGGGAAGTGG - Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161144286 19:2668380-2668402 CGGGATATGCAAATTGGCAGGGG + Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
925862090 2:8188849-8188871 ATAATTATACAACTGGGCAGGGG + Intergenic
927128981 2:20040837-20040859 CTGTATATAAAAATTAGCAGGGG + Intronic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928189105 2:29145260-29145282 CTGAATTTGCAAGTGGGCAGTGG + Exonic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
931696130 2:64871914-64871936 CTTAATATCAAAATGGGCAGGGG + Intergenic
931928091 2:67097080-67097102 CTGCATATGCAAAGGGTCAGAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933334191 2:80935796-80935818 AAAAATATACAAATGGCCAGTGG + Intergenic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
934140928 2:89046548-89046570 GGGAATATGCAAATGAGCAGAGG + Intergenic
934228304 2:90153994-90154016 GGGAATATGCAAATGAGCAGAGG - Intergenic
934228897 2:90159757-90159779 GGGAATATGCAAATGAGCAGAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938291301 2:130152227-130152249 CAGAGTAGCCAAATGGGCAGTGG + Exonic
938807828 2:134823026-134823048 CTAAATATAGAAAGGGCCAGAGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939427703 2:142060771-142060793 CTGATTTTACAAATTGGAAGTGG - Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940365692 2:152846280-152846302 CTAACAATACAAATGGGGAGAGG - Intergenic
940707830 2:157126419-157126441 CTGAACACACACATGGGTAGTGG + Intergenic
941288331 2:163643355-163643377 CACAATATACAAATGTACAGGGG + Intronic
941327768 2:164138575-164138597 CCAAATAAACAAATGAGCAGAGG + Intergenic
941583281 2:167326673-167326695 ATAAATAAATAAATGGGCAGGGG - Intergenic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947120227 2:226806261-226806283 GTGACTCTACAAGTGGGCAGAGG + Intergenic
947153086 2:227134208-227134230 CTGAATGTAGTAATGGGGAGAGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170503076 20:16994915-16994937 CCCAATTTAAAAATGGGCAGAGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171186788 20:23128647-23128669 CTGAATAGACAGCTCGGCAGCGG - Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1172866028 20:38098129-38098151 CTCAATTCAAAAATGGGCAGAGG - Intronic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1174119551 20:48252465-48252487 TTGAATAGATAAAGGGGCAGGGG - Intergenic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178472012 21:32902303-32902325 CTGAATATTCAAGTGGTGAGAGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181313840 22:21959731-21959753 CTGCATCTGCAAGTGGGCAGGGG + Exonic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1182210230 22:28670085-28670107 CTGAAAATAAAAATGGGGGGGGG + Intronic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
952047871 3:29345876-29345898 CAGACTGTACAAATGGCCAGAGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
955047385 3:55372913-55372935 CAGAAGACAGAAATGGGCAGGGG - Intergenic
955767341 3:62358779-62358801 CTGAATATAAATATGGGGTGTGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
959230522 3:103645219-103645241 CTGAGGATACAAATAGGCAGAGG - Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961689617 3:128659387-128659409 AAGAGTATACAAATGGCCAGTGG + Intronic
962368694 3:134803309-134803331 ATGAACAGAGAAATGGGCAGAGG + Intronic
962777457 3:138676134-138676156 CCCAATTTACAAATGAGCAGAGG + Intronic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964860551 3:161196700-161196722 CTGCAGATAAAAATGGGCAGAGG - Intronic
965916205 3:173849472-173849494 CTGAATATAAACATTAGCAGAGG + Intronic
965923540 3:173949445-173949467 CTGAAAATATAAATAAGCAGAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966555286 3:181252123-181252145 CTAAACATACAAACAGGCAGAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968544029 4:1186693-1186715 CTCAATTTAAAAATGGGCAGAGG + Intronic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
972804368 4:42513033-42513055 CTTTATTTACAAATAGGCAGTGG + Intronic
973189234 4:47368175-47368197 CTGCATATACACATAAGCAGGGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974148255 4:57972721-57972743 TTGAATATACACATGGGCTGTGG + Intergenic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
977735375 4:100408787-100408809 CTGATTATTCTAATTGGCAGTGG - Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982656691 4:158158886-158158908 CACAAAATAAAAATGGGCAGTGG + Intronic
982798245 4:159671045-159671067 TTGAATATACAAAGTTGCAGAGG - Intergenic
983409195 4:167375325-167375347 CTGGATATACAGATTTGCAGGGG - Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
989773752 5:45177158-45177180 ATAAAAATAAAAATGGGCAGAGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995731702 5:115250523-115250545 CTGAAGAAAAAAATTGGCAGTGG + Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997436247 5:133877814-133877836 CGGAATATTCAAATGGGAGGAGG + Intergenic
997684594 5:135779770-135779792 CTTAATATCCAACTGGGGAGAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001870687 5:175152004-175152026 CTCAATATATAAATGTGCTGTGG - Intergenic
1002014311 5:176306972-176306994 CCCAATTTAAAAATGGGCAGAGG + Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002953261 6:1837261-1837283 CTGTATTTACAAAAGGGCAGGGG + Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007705645 6:43789427-43789449 CTTAATATACACATGGCTAGTGG + Intergenic
1007955875 6:45917419-45917441 CTGAATATCCCAAGGTGCAGTGG + Intronic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009227220 6:61030759-61030781 TTTAATATACAAAGGGGAAGAGG - Intergenic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1010773224 6:79856797-79856819 TTCAATATACAAATGCGGAGGGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1012130804 6:95489838-95489860 ATTAATAAACAAATTGGCAGAGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016580265 6:145621765-145621787 CTCAATCTAAAAATGGGCACAGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017797530 6:157859755-157859777 CCTAATACAAAAATGGGCAGAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018513427 6:164551830-164551852 CTGAATATTTATAGGGGCAGAGG - Intergenic
1018885120 6:167928689-167928711 ATGGATGCACAAATGGGCAGAGG - Intronic
1019773353 7:2897358-2897380 CTGAGTATAAAAATGGTCACTGG + Intergenic
1020441226 7:8218843-8218865 CCAAATGTAGAAATGGGCAGTGG - Intronic
1020952104 7:14692921-14692943 AGGAATATACAAATGAGCTGAGG - Intronic
1022851787 7:34270782-34270804 TTTAATATGCAAATGGGCTGGGG + Intergenic
1023109589 7:36795896-36795918 GTGACTTTACAGATGGGCAGGGG + Intergenic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023787943 7:43726850-43726872 CCTAATTTAAAAATGGGCAGAGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026064565 7:67058869-67058891 CTGGATATCCATATTGGCAGAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026713732 7:72767852-72767874 CTGGATATCCATATTGGCAGAGG + Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028110943 7:86940445-86940467 ATAAATATACAAGTGGGCTGAGG - Intronic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028193904 7:87882636-87882658 CCCAATTTAAAAATGGGCAGAGG + Intronic
1028463568 7:91123550-91123572 ATGAATATCCAAATGAGAAGAGG + Intronic
1028624218 7:92859710-92859732 CTGAATATAAAAAGGCCCAGGGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030821344 7:114095696-114095718 CTAAATATATAAATGAGCACAGG - Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1033434770 7:141322861-141322883 CTCAAAATACAATGGGGCAGGGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035956763 8:4088891-4088913 CTGAATATAAAAATGAGTAGAGG - Intronic
1036160193 8:6380506-6380528 ATGAAAATACTAATAGGCAGGGG + Intergenic
1036989140 8:13572029-13572051 CTCAATTTGAAAATGGGCAGAGG - Intergenic
1038064457 8:23949206-23949228 TGGAATATAAAAATGGTCAGTGG + Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039398085 8:37244451-37244473 CTGTATTAAAAAATGGGCAGGGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040788734 8:51199064-51199086 CTGAAAATACAAATGGCTGGGGG - Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041527641 8:58824853-58824875 ATGAATATACAAATGGGGGGTGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044560409 8:93606662-93606684 CTGAACACAGAGATGGGCAGTGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045924956 8:107572436-107572458 CCTAATATTCAAATGGGGAGAGG + Intergenic
1046026796 8:108734150-108734172 CTGAATAGATAAAAAGGCAGAGG + Intronic
1047831031 8:128630044-128630066 CTGAAACTAAAAATTGGCAGGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049281933 8:141753820-141753842 CTGAATGAACAAAAGGGGAGAGG - Intergenic
1050409380 9:5347037-5347059 CTGATTGAAAAAATGGGCAGAGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050916068 9:11134991-11135013 CTCAATATACATATGTGCACAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052244229 9:26314219-26314241 CTGAATATAGAAATGGTCTTGGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055020543 9:71664558-71664580 CAGAATATAGAAACGGGGAGAGG + Intergenic
1058471879 9:105288117-105288139 CTGATTATACAAATATGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059306213 9:113355158-113355180 CTGAATAAAAAAATCTGCAGTGG - Intronic
1059389844 9:113992207-113992229 CTGGATGTAGAAGTGGGCAGTGG + Intronic
1060679981 9:125553628-125553650 CTACATAGACAAATGGGCATGGG - Intronic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1062514538 9:136925982-136926004 CTCACTGTACAAGTGGGCAGGGG + Exonic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188404765 X:29794370-29794392 CTGAATATCCAAATTGGCCTAGG - Intronic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190149404 X:47931364-47931386 CTGAATAAACAAATAAGCAGGGG - Intronic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193513392 X:82433346-82433368 CTGAATATTCTCATTGGCAGTGG + Intergenic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1195275961 X:103281021-103281043 CTGGACATAGAAATGGGCACAGG - Intergenic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1196671348 X:118371029-118371051 CCCAATTTAAAAATGGGCAGAGG + Intronic
1197204109 X:123774854-123774876 CTAAAAATACAAATAGCCAGGGG + Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197623908 X:128781593-128781615 CTGAACATACCCATTGGCAGTGG + Intergenic
1199431606 X:147767375-147767397 CTTAATATACAAACAGGCACAGG - Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic