ID: 1111880929

View in Genome Browser
Species Human (GRCh38)
Location 13:93956145-93956167
Sequence TGGGGTATTATAGCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111880929_1111880935 9 Left 1111880929 13:93956145-93956167 CCTGCAACTGCTATAATACCCCA 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1111880935 13:93956177-93956199 TTCTCTCACTCTCTCCACTGTGG 0: 1
1: 1
2: 4
3: 45
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111880929 Original CRISPR TGGGGTATTATAGCAGTTGC AGG (reversed) Intronic
903176695 1:21585811-21585833 TGGTCTATTATAGCAGTGTCTGG - Intergenic
904949136 1:34222049-34222071 AGGTGTTTTATAGCAGTTGGTGG + Intergenic
906579358 1:46923534-46923556 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
907441977 1:54484574-54484596 TGTGGTATTCAAGCAGTGGCTGG + Intergenic
912607776 1:111009765-111009787 TGGTGTATTTTTGCAGTGGCTGG - Intergenic
913059319 1:115190343-115190365 TGAGGTTTTATAGCTCTTGCTGG - Intergenic
913183774 1:116347680-116347702 TGGGGTGTTGTGGCAGATGCTGG + Intergenic
913503207 1:119490867-119490889 TGGAGAATTATAGCAGTTAGAGG + Intergenic
914782399 1:150797662-150797684 TGGGTAATTAGAGAAGTTGCTGG - Intronic
917292759 1:173488315-173488337 TGGGTTATTCTAGAAGTTCCTGG - Exonic
917346976 1:174038470-174038492 TAGGTTTTTATATCAGTTGCAGG - Intergenic
1065239501 10:23691843-23691865 TGGGCTATAATTGCAGTTGCTGG + Intergenic
1074463353 10:113659303-113659325 TGGGGTATTATTGCATCTGGTGG - Intronic
1075468453 10:122670118-122670140 TGGGGGATTTTAGCAGGTGATGG + Intergenic
1078148861 11:8741796-8741818 TGGGGGATTCTAGCTGTTGCTGG - Intronic
1089112817 11:116070737-116070759 TGGGGTATTCCAGGAATTGCTGG + Intergenic
1090221048 11:125026353-125026375 AGGGGTAGTATAGCATTTGTGGG - Intronic
1090724881 11:129516203-129516225 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
1097787914 12:63780967-63780989 TAAGGTATTATTGCAGTTGTAGG - Intronic
1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG + Intergenic
1098228945 12:68353245-68353267 TGGTATCTTATAGCAGTTGTTGG - Intergenic
1101596059 12:106165477-106165499 TGGTGTGTTTTTGCAGTTGCTGG - Intergenic
1102516699 12:113453695-113453717 TGTGTTATAATACCAGTTGCAGG - Intergenic
1111880929 13:93956145-93956167 TGGGGTATTATAGCAGTTGCAGG - Intronic
1111931264 13:94515296-94515318 TGGGTTATTGCAGCAGTTTCTGG - Intergenic
1113919322 13:113898080-113898102 TGGGGTATTATCTCAGATGGAGG - Intergenic
1116685501 14:48034214-48034236 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
1124869085 15:33522717-33522739 TGGGGTTTCATACCAGTTTCAGG + Intronic
1125339291 15:38658890-38658912 TGGTGTTTTAAAGCAGTTGTAGG - Intergenic
1126196484 15:45937296-45937318 TGGGGCAGTAAAGCAGTTGGAGG - Intergenic
1128150059 15:65357150-65357172 AGGGGTATTAAAGCAGGTCCAGG - Intronic
1144886980 17:18469894-18469916 TGGAATATAATAGCAGTTGAGGG + Intergenic
1145145235 17:20474401-20474423 TGGAATATAATAGCAGTTGAGGG - Intergenic
1146817153 17:35951909-35951931 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
1148170571 17:45516106-45516128 TCTGGTATGATAGCAGTTTCTGG + Intergenic
1148171048 17:45520099-45520121 TCTGGTATGATAGCAGTTTCTGG + Intergenic
1150401662 17:64861695-64861717 TCTGGTATGATAGCAGTTTCGGG + Intronic
1150410917 17:64940045-64940067 TGGGGTTTTATAACACTTGTGGG + Intergenic
1150781773 17:68129005-68129027 TATGGTATGATAGCAGTTTCTGG + Intergenic
1153125618 18:1786540-1786562 TGGGGTGTTTTTGCAGTGGCTGG - Intergenic
1157031927 18:43921578-43921600 TTTGGTATTATACCATTTGCTGG - Intergenic
1160158801 18:76455328-76455350 TGGGGTAGGAGAGAAGTTGCAGG - Intronic
1161045210 19:2130880-2130902 TGGGGAATTTGAGCAGTCGCAGG - Intronic
1161091836 19:2364275-2364297 TGGGGTTTTATTGAAGTTGATGG + Intergenic
926710301 2:15874122-15874144 AAGGGTATTATAACAGTTGTAGG + Intergenic
931820818 2:65950430-65950452 TGAGGAATGACAGCAGTTGCAGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
937621486 2:123992857-123992879 TGGTGTGTTTTTGCAGTTGCTGG - Intergenic
938224083 2:129600691-129600713 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
940430404 2:153583712-153583734 TGATGTCTTATAGTAGTTGCTGG - Intergenic
943095098 2:183418648-183418670 TGGTGTGTTTTTGCAGTTGCTGG - Intergenic
943651016 2:190457511-190457533 TGTTTTATGATAGCAGTTGCTGG + Intronic
1170543576 20:17413060-17413082 TGGGGTGTTTTTGCAGTGGCTGG - Intronic
1172415081 20:34758891-34758913 GGGGGTATCATAACAGTGGCAGG + Exonic
1174968329 20:55244992-55245014 TGGTGTATTTTTGCAGTGGCTGG - Intergenic
1182364762 22:29771080-29771102 GGGAGTATTAAAGGAGTTGCAGG + Intergenic
1182989090 22:34749734-34749756 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
949116584 3:333635-333657 TGGTGTATTATGGGAGTTTCAGG - Intronic
955870344 3:63432089-63432111 AGAGGTATTATAGGAGGTGCGGG - Intronic
956187566 3:66576962-66576984 TGGAATATGATAGCACTTGCTGG - Intergenic
958672795 3:97226700-97226722 TAGGAAATTATAGCAGTTGAAGG + Intronic
958964041 3:100538098-100538120 TGGGTTATTAAAGCACTTGGAGG + Intronic
960859843 3:122141206-122141228 TGGCGTATTTTTGCAGTGGCTGG + Intergenic
964224454 3:154381965-154381987 TAGGGTATGATAGAAGTAGCTGG - Intronic
968834923 4:2956184-2956206 TGTGGAATTATAGCAGTTTGAGG - Intronic
972738649 4:41869147-41869169 TGTGGTATTATTGCAGATGAAGG - Intergenic
974107435 4:57486190-57486212 TGAGGCATTATAGCAGCTGGTGG + Intergenic
974560285 4:63507986-63508008 TGGTGTGTTTTTGCAGTTGCTGG - Intergenic
978363768 4:107958693-107958715 TGGCGTATTTTTGCAGTGGCTGG - Intergenic
981298916 4:143165192-143165214 TGGGGGATTACAGCAGAAGCAGG - Intergenic
982103273 4:151989487-151989509 TGGGGTATAATAGCATGTCCTGG + Intergenic
982635001 4:157884440-157884462 TGGGGAATGAAAGCAGGTGCTGG - Intergenic
983896015 4:173082953-173082975 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
984198410 4:176688085-176688107 TGGAATTTTATAGCAGTTGTGGG - Intronic
986273585 5:6254429-6254451 GGGAGCATTAAAGCAGTTGCTGG - Intergenic
987790033 5:22553189-22553211 TTGGGTGTCATAGCATTTGCAGG - Intronic
989676497 5:43979988-43980010 TGGTGTATTTTTGCAGTGGCTGG + Intergenic
991164046 5:63540846-63540868 AGGGGTATTTCAGCAGTTACAGG - Intergenic
995593861 5:113728352-113728374 TGGTGTGTTATTGCAGTGGCTGG + Intergenic
998702530 5:144719290-144719312 TGGAGTATAATAGCAACTGCTGG + Intergenic
1012401642 6:98846417-98846439 TGGGTTAAAATAGCATTTGCTGG - Intergenic
1013379714 6:109556120-109556142 TGGTGTATTTTTGCAGTGGCTGG + Intronic
1014051624 6:116962143-116962165 TGGGATATTTTAGCATTTGCAGG - Intergenic
1014330524 6:120058387-120058409 TGAGGTATTTTATCAGTTTCAGG - Intergenic
1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG + Intergenic
1017449157 6:154537585-154537607 TGGGGTTTTATGGCCTTTGCTGG - Intergenic
1024149994 7:46561658-46561680 TGGTGTGTTTTTGCAGTTGCTGG + Intergenic
1027754373 7:82193381-82193403 TGGGATATTTTAGCAGTTTTTGG + Intronic
1032743475 7:134762952-134762974 TGTGATATTATACCAGATGCTGG + Intronic
1032976870 7:137234908-137234930 TGGGTTATTAAAGCAGTGGGAGG + Intronic
1036630492 8:10510993-10511015 TGGGGGATTATTGGAGATGCAGG - Intergenic
1040304852 8:46206703-46206725 TGGGGTATTATAGCATGTCCGGG - Intergenic
1044372867 8:91434179-91434201 GGGGGCATTATTTCAGTTGCTGG + Intergenic
1049764701 8:144349374-144349396 TGGAGTTTTCTAACAGTTGCTGG - Intergenic
1053002051 9:34582474-34582496 TGGGGTCTTATAGAAGGTGAGGG - Intronic
1058951481 9:109907865-109907887 TGGGGTGCTATGGCAGTGGCTGG - Intronic
1059379707 9:113913509-113913531 GGAGGTATGAAAGCAGTTGCTGG + Intronic
1059692294 9:116697784-116697806 TGGGGCATTCTAGCACTTCCCGG - Exonic
1192269856 X:69568823-69568845 TGAGGTTTTTTAGCAGCTGCTGG + Intergenic
1193040000 X:76995487-76995509 TGGTGTGTTTTTGCAGTTGCTGG + Intergenic
1193953957 X:87835528-87835550 GGGGGTATTAGATCAGTTGATGG + Intergenic
1195579445 X:106484661-106484683 TGGGGTTATATTGCAGTTACAGG + Intergenic
1196551541 X:117032581-117032603 AGGGTGATTATAGCATTTGCTGG - Intergenic
1196944038 X:120806488-120806510 TGGTCTATAATAGCAGTTGTGGG - Intergenic
1197302754 X:124801698-124801720 TGGTGTGTTTTTGCAGTTGCTGG + Intronic
1200242200 X:154502834-154502856 TGGGCAATCACAGCAGTTGCTGG + Intergenic
1201525324 Y:14926772-14926794 TGGGGTATGCTTGCAGCTGCAGG + Intergenic
1201732053 Y:17214764-17214786 TGGTGTATTTTTGCAGTGGCTGG - Intergenic