ID: 1111883331

View in Genome Browser
Species Human (GRCh38)
Location 13:93986407-93986429
Sequence ATCTGAACAAAGATGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111883331 Original CRISPR ATCTGAACAAAGATGAAGCA GGG Intronic
901829034 1:11880906-11880928 ATCTGAACACAGAAGATGGAAGG - Intergenic
901874609 1:12160210-12160232 ATCTAAACAAAGATAATGTAGGG + Intergenic
902542338 1:17164033-17164055 ATCTGCACAAAGAGGTTGCATGG + Intergenic
903040903 1:20529511-20529533 CTCTGGAGAAAAATGAAGCAGGG - Intergenic
903779121 1:25810415-25810437 ATCTGGACAAACTTGAAGCCAGG - Intronic
904488419 1:30843153-30843175 ACCTGAACAAAGAGGAGGGAAGG + Intergenic
905676690 1:39830837-39830859 ATCTGAAAAAACATGAGGCCTGG - Intergenic
905957008 1:42005608-42005630 ATCTTCAGAAAGATGCAGCATGG - Intronic
906732136 1:48091931-48091953 ATCTGGCCAAAGAGGAAGCTGGG + Intergenic
908808030 1:67950834-67950856 AGCTCAACAAGGATGAGGCAGGG - Intergenic
909461777 1:75924318-75924340 ACCTGAACAAAGATCCAGCAGGG - Intronic
910212625 1:84809059-84809081 ATATGCACAAAGATGTAACATGG + Intergenic
910536923 1:88309201-88309223 CTATGAATAAAAATGAAGCAGGG + Intergenic
910786550 1:91004554-91004576 ATCTGAAGAAATAAGGAGCATGG + Intronic
911537284 1:99115589-99115611 ACCTCTACAAAGATGAAGCAGGG + Intergenic
912128245 1:106568104-106568126 ATCTAAAGAAAAATGAGGCAAGG - Intergenic
913121088 1:115741468-115741490 AGCTGAACAAAGATCAATAATGG - Intronic
914730160 1:150363082-150363104 TTCTGTAAAAAGGTGAAGCAGGG - Intronic
915652787 1:157331013-157331035 AACTGAAAAAACATGAGGCAAGG - Intergenic
916680425 1:167099499-167099521 ATCTGAACATAGAAGAATAAAGG + Intronic
918350947 1:183655076-183655098 ATCTGAATGAAGATGAAACATGG - Intronic
918608478 1:186458775-186458797 ATATGAGAAAAGATGAAGAATGG + Intronic
1063865457 10:10360447-10360469 ATGTGAAAAAAGAGGAAGGAAGG + Intergenic
1063936116 10:11080262-11080284 ATTTAAACAAAGAAAAAGCAAGG - Intronic
1064719121 10:18210410-18210432 CTTTGAACAAAGGTGAAGAATGG + Intronic
1065634348 10:27715386-27715408 ATCTGAAGTAAGACGAAGGAGGG + Intronic
1066073613 10:31848121-31848143 ATATGAACAAATATGACACAAGG - Intronic
1067701004 10:48572062-48572084 AACTGAAGAAGGATGTAGCAAGG - Intronic
1067785702 10:49244515-49244537 ATCTTCACAAAGATGACCCATGG + Intergenic
1067824390 10:49559402-49559424 ACCTGAACACAGAGGTAGCATGG + Intergenic
1068038483 10:51791663-51791685 ATATGAATAACTATGAAGCAAGG + Intronic
1068076630 10:52264071-52264093 ATAATAACAAAGCTGAAGCAGGG - Intronic
1069150650 10:64954695-64954717 ATCTGGACAAAGATGGTGGACGG - Intergenic
1069328665 10:67263605-67263627 ATCCTTACCAAGATGAAGCAGGG - Intronic
1072989682 10:100180171-100180193 ATCTGAACAAAGGTGTGACAAGG - Intronic
1073383783 10:103104420-103104442 ATCTCAATGAAGATGAACCAGGG - Intronic
1074596792 10:114875361-114875383 AAGTGAAGAAAGAAGAAGCAAGG + Intronic
1077986654 11:7358832-7358854 ATCTGAAGAAATTAGAAGCAGGG - Intronic
1078700269 11:13673800-13673822 ATCTCAAAATTGATGAAGCATGG + Intronic
1078858508 11:15226148-15226170 ATCTGAACAGAGATTGAGGAAGG - Intronic
1079405584 11:20142475-20142497 CTCTGAACAAATGTGAAGCAGGG + Intergenic
1079678847 11:23266661-23266683 ACCTGAAAAATAATGAAGCAGGG - Intergenic
1079853237 11:25565566-25565588 ATCTGAAGAAAAATGAATAATGG + Intergenic
1080864208 11:36179065-36179087 ACTTGAACAACAATGAAGCAGGG + Intronic
1082166083 11:48952880-48952902 ATCTGGACAAATATGAAAAAGGG + Intergenic
1082237117 11:49832133-49832155 ATCTGGACAAATATGAAAAAGGG - Intergenic
1082241582 11:49877624-49877646 ATCTGGACAAATATGAAAAAGGG + Intergenic
1084478632 11:69403489-69403511 ATCTGATCAATGATGATGAATGG + Intergenic
1084573336 11:69973233-69973255 TTTTGAAGAAAAATGAAGCAGGG - Intergenic
1086941830 11:92806341-92806363 ACCTGGACAAAGGTGAAGAAAGG - Exonic
1088403457 11:109446008-109446030 ATCCAAACAAAGGTGAACCAAGG - Intergenic
1089883066 11:121793596-121793618 AAATGCACAAAGATGAAGCATGG - Intergenic
1090237332 11:125158971-125158993 ACCAGAACAAAAATGAAGCCTGG + Intergenic
1090324393 11:125872043-125872065 ACCTGAACAAAGAAGGAGAAGGG + Intergenic
1090480209 11:127061286-127061308 ATTTAAACCAAGATGAAGAAAGG - Intergenic
1090739476 11:129644001-129644023 AGATGATGAAAGATGAAGCATGG - Intergenic
1090843994 11:130516141-130516163 AGCTGAGCACAGATGAAGCAGGG + Intergenic
1091241672 11:134056824-134056846 ATCTGTACCCAGAGGAAGCAAGG - Intergenic
1092402523 12:8188798-8188820 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1093313471 12:17619864-17619886 ATATGTCAAAAGATGAAGCAGGG - Intergenic
1094034195 12:26049056-26049078 ACCTTAAAAAAGATGAAGGAGGG - Intronic
1095241651 12:39866871-39866893 AACAGAACAAAGTTGAAGGATGG + Intronic
1099012440 12:77308136-77308158 ATCTGAACAGAGAGAAACCATGG - Intergenic
1100943271 12:99748701-99748723 CTCTGAAGAAAGATAAAACAGGG + Intronic
1102086641 12:110146388-110146410 ATGTGAACAAATATGCACCAGGG - Intronic
1104148337 12:126056685-126056707 CTCAGAACCAAGAGGAAGCAAGG - Intergenic
1104337885 12:127917751-127917773 ATCTGAACAAAGATAATGTTGGG + Intergenic
1105394811 13:20020812-20020834 ATCTGAAAAAATATGCTGCATGG - Intronic
1106351478 13:28935036-28935058 ATCTGCACAAACAAGAAGCATGG - Intronic
1108090569 13:46845312-46845334 ATCTGGACAGGGATGAGGCAAGG + Intronic
1108416825 13:50206088-50206110 AGCTGAACAAATTTGAAACACGG - Intronic
1111279247 13:85997675-85997697 ATCTTCAGAAAGATGCAGCATGG - Intergenic
1111883331 13:93986407-93986429 ATCTGAACAAAGATGAAGCAGGG + Intronic
1116748911 14:48856692-48856714 CTCCTAACAAAGATGTAGCATGG + Intergenic
1117729934 14:58712249-58712271 TTCTTAACAAAGAGGTAGCAAGG - Intergenic
1118001031 14:61523880-61523902 ATCTGATAAAAGATGGATCAGGG + Intronic
1119124470 14:72112835-72112857 ATCTGAGCCTAGATAAAGCAAGG - Intronic
1119657411 14:76427007-76427029 ACCTGAACAGAGATGCTGCAGGG + Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120615376 14:86697674-86697696 ATCTTCACAAAGAGGAAACAAGG - Intergenic
1120893452 14:89509265-89509287 CTATGGATAAAGATGAAGCAGGG - Intronic
1121963991 14:98287772-98287794 ATCTGCTCAAAGCTGAAGCCTGG + Intergenic
1122472407 14:101979127-101979149 ATGTGAACAAACATGAAACCAGG - Intronic
1127429846 15:58893920-58893942 ATCTGAAAAAAAAGAAAGCAAGG - Exonic
1128194045 15:65734637-65734659 ATCTAAACAAACGTCAAGCAGGG + Intronic
1129180532 15:73871782-73871804 ATCTGAAAAAAGAAGAAAGAGGG + Intergenic
1130389760 15:83445381-83445403 TTCTGAACAAAAGTGAAGGAAGG + Intergenic
1131633228 15:94201836-94201858 AACTGAACAAAGGTAAAGGAAGG - Intergenic
1131840055 15:96427646-96427668 ATGTCAACAAAGATGTAGCGTGG - Intergenic
1132101229 15:99024824-99024846 TTCTGAACCCAGATGAATCATGG + Intergenic
1134903741 16:17961494-17961516 AGCTGGACAGAGCTGAAGCAGGG + Intergenic
1135898925 16:26437759-26437781 ATCAGAACTTAAATGAAGCAAGG - Intergenic
1135934853 16:26771097-26771119 ATCTGGACAGAGATGAAGCCTGG - Intergenic
1139129081 16:64118589-64118611 ATCAGAACATAGAAGAAGGATGG - Intergenic
1140517312 16:75553066-75553088 AGCTGACCAAAGCAGAAGCAAGG + Intronic
1141389607 16:83653716-83653738 ATTTGAAGAAAAATAAAGCAGGG - Intronic
1141421120 16:83916292-83916314 ATGAGAACAAAGGTGAAGGAAGG + Exonic
1141844917 16:86601773-86601795 GGCTGAACAAAGAGGCAGCATGG - Intergenic
1143006428 17:3838218-3838240 ACCTGACCAGAGATAAAGCATGG + Intronic
1144700964 17:17339257-17339279 ATCTGAAAAAAAATTAAGAAAGG - Intronic
1152141385 17:78538930-78538952 ATCTCAACAAAAAAGATGCAGGG + Intronic
1153502544 18:5763693-5763715 ATTGGGACAGAGATGAAGCAAGG - Intergenic
1153519453 18:5938128-5938150 ATCTGAACTGAGATGGAGCGAGG + Intergenic
1157190161 18:45574973-45574995 ATCCTCAGAAAGATGAAGCAAGG + Intronic
1158707003 18:59801713-59801735 ACCTGAACAAGGGTTAAGCATGG - Intergenic
1160079909 18:75715898-75715920 ATCTGAAAAAAGAAGAAATATGG - Intergenic
1160342991 18:78105628-78105650 TTCTAAGCAAATATGAAGCATGG - Intergenic
1161959331 19:7515173-7515195 ATATAAACAATGATGAGGCAAGG - Intronic
1162231119 19:9267899-9267921 AGCTGAACAATAATGAAGAAGGG - Intergenic
1162551976 19:11362991-11363013 TTCTAAATAAAGATGAATCAAGG + Intronic
1163025840 19:14511509-14511531 ACCTGATCAGAGATGCAGCATGG + Intergenic
1163067211 19:14806585-14806607 ATCTGAACAATGAGAATGCATGG - Intronic
1164240025 19:23378353-23378375 ATCTAAACAGGGCTGAAGCAGGG + Intronic
1164317266 19:24102486-24102508 ATCTAAACAGGGCTGAAGCAGGG - Intronic
1164971209 19:32534230-32534252 ATTTGACCAAAGATGGAGAATGG + Intergenic
1165034914 19:33025803-33025825 AACTGAACAGACATTAAGCAAGG - Intronic
1166207604 19:41282136-41282158 ATGTGTACAAATATGAAGGAAGG - Intronic
1167797141 19:51716860-51716882 TTGGGAACAAAGATGCAGCAGGG - Intronic
1168512840 19:56987283-56987305 ATTTGAACATAAATGAAGTAGGG + Intergenic
925001482 2:406471-406493 ATCTGCACAGAGACCAAGCATGG - Intergenic
926470410 2:13248345-13248367 ATCTGTACAAAGAAGGAGCAAGG - Intergenic
928025341 2:27735164-27735186 AACTACACAAAGATGAAGAAGGG - Intergenic
928042878 2:27896190-27896212 ATATGGACAAAGATGCAGCCAGG + Intronic
928135199 2:28682679-28682701 ATCAGACTCAAGATGAAGCAGGG + Intergenic
928205091 2:29278285-29278307 CTCTGAACAGAGATCAGGCAAGG + Intronic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
930151804 2:48067374-48067396 ATCTGAACGACGAAGAGGCAGGG + Intergenic
930389750 2:50745993-50746015 ATCTGAACACAGAAGAGGCTGGG - Intronic
930414514 2:51074477-51074499 ATCTGTACACAGATGAAAAAAGG - Intergenic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
932995702 2:76849375-76849397 ATTTGCACAAAGATGTTGCATGG - Intronic
934891080 2:98069791-98069813 ATATGAACAAAGTTGCAGAATGG + Intergenic
934971233 2:98766183-98766205 ACCTGAACAAGGATGAGGAAGGG + Intergenic
937084444 2:119161404-119161426 ATCTGGGCAAAGATGAAGCAAGG + Intergenic
937624630 2:124029599-124029621 ATTAGAACAAAAATAAAGCAAGG - Intronic
937913658 2:127088431-127088453 CTCCGAACAAAAATGCAGCAGGG + Intronic
938787320 2:134642958-134642980 AGATGAACAAAGAATAAGCATGG + Intronic
939502188 2:143001628-143001650 ACCAGAACAAAGTTGAAGGAGGG - Intronic
940345530 2:152624157-152624179 ATCTCAAAAAAGAGGAAGGAAGG - Intronic
940432286 2:153606938-153606960 ATATGAAAAGAGATGAAGAATGG - Intergenic
941155720 2:161975737-161975759 ATTTGAACAAAGAAGGGGCAAGG + Intronic
941483817 2:166053259-166053281 ATGTGAACAAAGATTAATGATGG - Intronic
941649445 2:168078310-168078332 AGATGAACAAAGGAGAAGCATGG + Intronic
941989961 2:171546127-171546149 ATCTGAGCAAGGAAGAAGCCAGG - Intronic
943447147 2:188001153-188001175 ATGAGAACAAAAATGAATCATGG + Intergenic
943852228 2:192738604-192738626 TGCTGAAAAAATATGAAGCATGG - Intergenic
943853440 2:192757450-192757472 CTATGAACAAAATTGAAGCAGGG - Intergenic
944128431 2:196319492-196319514 ATCTGAATCAATATGAAGCATGG + Exonic
944856032 2:203767737-203767759 ATCTGAAGAAAGAAAAAGCCTGG - Intergenic
948277963 2:236724642-236724664 ATCTGAAGGAAGATGGAGAAGGG - Intergenic
948288902 2:236809575-236809597 ATCGGAAAAATAATGAAGCATGG + Intergenic
1169185733 20:3615833-3615855 AACTGAACAATGAGGACGCATGG + Intronic
1169978524 20:11357605-11357627 AACTGAACAGAGAGGGAGCAGGG + Intergenic
1170476154 20:16716607-16716629 ATATAAAAAAATATGAAGCAAGG + Intergenic
1172586867 20:36091828-36091850 ATCTGAAAGAAGATGGGGCAGGG - Intronic
1172849020 20:37947295-37947317 ATCTGAAGACAGAGGATGCAAGG - Intergenic
1173322586 20:42001603-42001625 ATCAGAACTAGGATGAAGCAGGG - Intergenic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1174966089 20:55217024-55217046 ATTTGTTCAATGATGAAGCAGGG - Intergenic
1175390550 20:58624600-58624622 CTCTGAAAACACATGAAGCACGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176994351 21:15537303-15537325 AGGTGCACAAAGATGAGGCAAGG + Intergenic
1177602046 21:23328059-23328081 ATCTGCACCAAGGAGAAGCAAGG + Intergenic
1177705230 21:24695464-24695486 ATCTGGAAAAAGAAGCAGCAGGG - Intergenic
1177832954 21:26159535-26159557 ATCTGCACACAGAAGAATCACGG + Intronic
1182560148 22:31153286-31153308 TTCCTAGCAAAGATGAAGCATGG - Intergenic
1183471802 22:38012465-38012487 ATCTTAACATAGAGGAAGCTGGG - Intronic
951957165 3:28269974-28269996 AGCTGAACAATGAGAAAGCATGG - Intronic
952022742 3:29042259-29042281 ATGTCAGCAAAGATGGAGCAGGG - Intergenic
952205524 3:31178235-31178257 ATCTGGAGAAAGAGAAAGCAAGG + Intergenic
953487912 3:43319722-43319744 ATGTTAACAGAGATGAACCAAGG + Intronic
953900049 3:46834749-46834771 ACTTCAACAAAGATGAAGCCAGG - Intergenic
956126667 3:66017398-66017420 ATCTGAAGAAAGCTGAGGCCAGG - Intronic
956164180 3:66384058-66384080 ATGTGAAAATAGATGACGCAGGG - Exonic
957857936 3:85903197-85903219 ATCAGAACAAAGATTATTCAGGG - Intronic
957957866 3:87211829-87211851 TTATGAACATAGATGAAGAAAGG - Intergenic
959079107 3:101780923-101780945 CCTTGAAAAAAGATGAAGCAGGG - Intronic
959908410 3:111735382-111735404 ATCTGAACAAAAGTGAAACTAGG - Intronic
960284296 3:115809922-115809944 AGATGAAAAAAGATGAAGGAAGG + Exonic
960396486 3:117143922-117143944 ACCTGAATAAAAAAGAAGCATGG + Intergenic
960470560 3:118059809-118059831 ATTTGAACAAACATGAATCTAGG - Intergenic
963099993 3:141592108-141592130 AGATGAACAAAAAAGAAGCAGGG + Intronic
963328725 3:143890916-143890938 ATATGAATAAAGATGTAGGAGGG + Intergenic
963369865 3:144385525-144385547 ATCTCATAAAAGATGAAACATGG + Intergenic
963682742 3:148400495-148400517 ATCTAAACAAAGAGTAAACAAGG + Intergenic
963863013 3:150330290-150330312 ATCTCAATAAAGCTGAAGGAAGG + Intergenic
964215513 3:154276110-154276132 ATTTAAACAATGATGAAGAATGG + Exonic
964434242 3:156635290-156635312 CTATGAAGAAAAATGAAGCAGGG - Intergenic
964438643 3:156679748-156679770 CTGTGAACAAAGATGACTCAAGG - Intronic
964856960 3:161156950-161156972 ATCTGAAGACATAAGAAGCAGGG - Intronic
965654243 3:170967030-170967052 AGCTTAACAAAAATGTAGCATGG - Intergenic
966149695 3:176853666-176853688 ATTTTAACAAAGATGATACAAGG + Intergenic
967777360 3:193398296-193398318 GTCTGAATAAAGATCAAGCAGGG + Intergenic
968596009 4:1485570-1485592 AACTCAACAAATATCAAGCATGG - Intergenic
970235729 4:13956363-13956385 TTCGGAGCAAGGATGAAGCAAGG - Intergenic
970505729 4:16728027-16728049 ATCTGAACAAAGATTTACTATGG + Intronic
973638298 4:52879776-52879798 TGCTGAACACAGAGGAAGCAGGG + Intronic
974574736 4:63703667-63703689 ATCTGCACAAAGATAAACTATGG + Intergenic
974622121 4:64370078-64370100 ATGTGAACAAACATGGAGAAAGG + Intronic
974881233 4:67759869-67759891 ATTAAAACAAAGATGAAGCTTGG + Intergenic
974972854 4:68851764-68851786 CTGAGAACAAAGTTGAAGCAGGG - Intergenic
975018459 4:69455685-69455707 CTGAGAACAAAGTTGAAGCAGGG - Intergenic
975274824 4:72484541-72484563 ACCAGACCAAAGATGAAGCCAGG + Intronic
975437838 4:74374547-74374569 ATATAAATAAAAATGAAGCAAGG + Intronic
976293686 4:83448205-83448227 ATCTCAAAAAAGAAAAAGCAGGG + Intronic
976665209 4:87583328-87583350 ATCTGAGCAAAGCTGAAAAAAGG - Intergenic
977639753 4:99343581-99343603 TACTGAACAAAAATGAAGAAAGG - Intronic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
978952686 4:114580311-114580333 AAATGAACAAAGATCAAGAAAGG - Intergenic
980271726 4:130592790-130592812 ATATGCACAAAGTTGAAGCCAGG - Intergenic
980525413 4:133985354-133985376 ATCTGATTGAATATGAAGCAAGG - Intergenic
981086934 4:140693346-140693368 ATCTGAAATAAGAAGAAGCCTGG + Intronic
982693882 4:158578254-158578276 TTCTGAGCAGAGATGAAGAATGG - Intronic
982892790 4:160877091-160877113 ATATGAACAAAGAAAAAGGAAGG - Intergenic
983387381 4:167082666-167082688 AACTGAACAAAGATCAAGGAAGG - Intronic
983890351 4:173023738-173023760 ATCTGATTAAAAATGAAGCTGGG + Intronic
986034343 5:3923891-3923913 ATCTGCACAGAGATGAACCTGGG + Intergenic
986034351 5:3923961-3923983 ATCTGCACAGAGATGAACCTGGG + Intergenic
987247921 5:16068041-16068063 ATCTGAGCCATGATGGAGCAAGG - Intronic
987646488 5:20679169-20679191 ATCTCAGACAAGATGAAGCAGGG - Intergenic
987776995 5:22380133-22380155 TTCTGAACAAAGAAAAAGAAAGG + Intronic
987837185 5:23177082-23177104 AGATAAACAAAGATGAAGAAGGG - Intergenic
990616611 5:57515014-57515036 ATCTAAACAGAAATCAAGCAGGG + Intergenic
993149258 5:84139280-84139302 ACCTGTACAAAAATGAAGGATGG + Intronic
993611208 5:90056740-90056762 ATCTGAACAAATATAAAACTTGG - Intergenic
993644452 5:90445395-90445417 ATCTGAAGAAAGAAGAAGGAAGG - Intergenic
994095834 5:95846689-95846711 ATCTGGATAGATATGAAGCATGG + Intergenic
994605379 5:101961146-101961168 ATATGAACAAAGAAGAAGTGGGG - Intergenic
995070839 5:107919800-107919822 ATCTGGAGAAAAATGATGCAGGG - Intronic
996612715 5:125402434-125402456 ATCTGAAGAAAGATGTTGTAAGG - Intergenic
996810037 5:127506610-127506632 TTATGAAGAAAAATGAAGCAAGG + Intergenic
997408016 5:133667729-133667751 ATATGAAGAAAGATGTAGCAGGG - Intergenic
998594297 5:143512250-143512272 GTATGAACAAAGATTAAGCCAGG - Intergenic
999155828 5:149456955-149456977 ATGAGAACAGAGATGAGGCAAGG + Intergenic
1000020134 5:157311317-157311339 ATCTGAGCACAGAAAAAGCAAGG - Intronic
1001257813 5:170198072-170198094 TTCTGAGCAGAGCTGAAGCAGGG + Intergenic
1001311281 5:170612773-170612795 ATCTGAAAGAAGATACAGCATGG - Intronic
1002578101 5:180189222-180189244 ATCTGAGCAAAGATGTACAAGGG + Intronic
1002966111 6:1968149-1968171 AACTGAACAGAGATGAAAGAGGG + Intronic
1004133012 6:12939074-12939096 TTCTGAACAAAGATAAACCTAGG + Intronic
1004213585 6:13679217-13679239 AGCTGAAGAAAGATGCAGCTTGG - Intronic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1005567075 6:27106895-27106917 TTCTTAACAACAATGAAGCAAGG - Intergenic
1006362963 6:33597505-33597527 ATCTGAGGAAAGATAAAGCAGGG - Intergenic
1006540028 6:34732141-34732163 AAATGAAAAAAAATGAAGCATGG - Intergenic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1007164801 6:39821701-39821723 ATCTGAACATAGCTGGAGCCTGG + Intronic
1007718844 6:43873406-43873428 TTCTGAAGAAATATAAAGCAGGG + Intergenic
1008191613 6:48465082-48465104 ATCTAAACAAAATTAAAGCATGG + Intergenic
1008544705 6:52574842-52574864 TTCTGAGCAAAGATAAAACAGGG + Intronic
1009463001 6:63936380-63936402 ATATGAACAATGATGATCCAGGG - Intronic
1011237231 6:85230847-85230869 TTCTGATCAGAGAGGAAGCAAGG - Intergenic
1011430892 6:87285419-87285441 ATGGGAACCAAGAAGAAGCAGGG - Intronic
1012500356 6:99881367-99881389 ATTTGAACAAACATGGATCATGG - Intergenic
1012762476 6:103319269-103319291 AACTGAACACAGATGAACTAAGG + Intergenic
1013958240 6:115866023-115866045 AACTGGACAGCGATGAAGCAGGG + Intergenic
1014145428 6:117992906-117992928 ATTTGACCAGAAATGAAGCATGG - Intronic
1014260148 6:119207184-119207206 ATGTGTACAAAGAGGAAGGAAGG - Intronic
1014410408 6:121110598-121110620 ATATGAACAAATCTGCAGCATGG - Intronic
1015345811 6:132157226-132157248 AACTGAACAAAAATTCAGCAAGG + Intergenic
1016366909 6:143328993-143329015 CTCTGCACAAAGATGACTCATGG - Intronic
1016454989 6:144221539-144221561 AGCTGAACAAAGAAGAAGAGAGG - Intergenic
1016619611 6:146092747-146092769 AGCAGAACCAAGAGGAAGCAAGG + Intronic
1016945381 6:149527491-149527513 ACTTGAAAAAAGATGAAGTAGGG - Intronic
1017743536 6:157427234-157427256 TTCTGAACACAGATAAACCAAGG - Intronic
1018222190 6:161592638-161592660 CTATGGAGAAAGATGAAGCAGGG + Intronic
1018726829 6:166619171-166619193 ATCTTAACAAAGAAAACGCATGG - Intronic
1018845023 6:167549750-167549772 ATCTGAGCAAAGATTAACCACGG - Intergenic
1020734543 7:11931281-11931303 ATCAGAACAAAGAGAAAGTATGG - Intergenic
1021538742 7:21733384-21733406 ATCTCAAAAAAAAAGAAGCAGGG + Intronic
1021559188 7:21952465-21952487 ATCTGAACAAAAATAAAGGATGG - Intergenic
1023002700 7:35827906-35827928 CTCTGTACAAAGATAAAACATGG - Intronic
1025866248 7:65384328-65384350 ATCTGAACAGAAATGGGGCAGGG - Intronic
1026008764 7:66620391-66620413 ATCAAAAAAAAGAAGAAGCAGGG - Intergenic
1027708640 7:81568410-81568432 ATCTGAGTAAAGAAAAAGCATGG - Intergenic
1028628282 7:92903119-92903141 ATCTGAACAAAGTTCAAAAACGG + Intergenic
1029176619 7:98669305-98669327 ATATGAACAGAGATGAGGCTGGG + Intergenic
1031061346 7:117054854-117054876 TTCTTTACAAAGATGAAGAAAGG + Intronic
1032303616 7:130712462-130712484 ATGTGAGCAGAGATTAAGCAAGG - Intergenic
1032477175 7:132219795-132219817 ATCTGAACATAGAAAAAGCATGG - Intronic
1035314279 7:157988531-157988553 ATCAGAACAGTGATGAATCAGGG + Intronic
1036103761 8:5817369-5817391 CCCTGAGCAAAGATGGAGCATGG - Intergenic
1036275572 8:7348798-7348820 AATTGAACAGAGAGGAAGCAGGG - Intergenic
1036345775 8:7961559-7961581 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1036841111 8:12122313-12122335 AATTGAACAGAGAGGAAGCAGGG + Intergenic
1036862910 8:12368565-12368587 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1037399307 8:18477756-18477778 ATCTGAAGGAAGAGGAAGGAAGG + Intergenic
1039756771 8:40531645-40531667 ATCTGAACAATGAAGACGAAGGG - Exonic
1042993001 8:74661714-74661736 ATCTGAACCAAGAAAAAGCAAGG + Intronic
1043360284 8:79464168-79464190 ATCTGAACAAAAATAAAGAAGGG + Intergenic
1043593997 8:81863568-81863590 AGCTGAAGAAAGAGGAAGCTGGG + Intergenic
1043967458 8:86495186-86495208 ATCTGAAAAAGGAGGAAGCTGGG + Intronic
1044264210 8:90163402-90163424 ATCTGAAGATATATGAAGTATGG + Intergenic
1044339005 8:91025453-91025475 ATCTGAGAAAAGATGAAATATGG - Intronic
1044559670 8:93600601-93600623 GTCTGAACATACATGAAGCTAGG - Intergenic
1044924733 8:97200705-97200727 ATGTGAAAGAAAATGAAGCATGG - Intergenic
1045680315 8:104652423-104652445 TTCTTATCACAGATGAAGCATGG + Intronic
1046023555 8:108695520-108695542 ACCATAACAAAAATGAAGCAGGG + Intronic
1048199726 8:132362252-132362274 ATCTAAACTAAGATGTAGAAAGG - Intronic
1048381718 8:133871259-133871281 AGCTGAACAATGAGAAAGCATGG - Intergenic
1048536196 8:135297393-135297415 ATCTCAGCAAACATAAAGCAAGG + Intergenic
1049906858 9:225833-225855 CTCTGAGCCAAGATCAAGCAGGG + Intronic
1049986978 9:960822-960844 AGCTCAAGAAAGATGAAGTAGGG + Intronic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1051364199 9:16309521-16309543 AGCTGAACAAAGCTGAGGAAGGG - Intergenic
1053366881 9:37529085-37529107 AGGTTAACAAAGATGAAGGAGGG + Intronic
1054738214 9:68778163-68778185 ATCTGAACCAATTTGAATCAAGG - Intronic
1055475856 9:76663325-76663347 AGCTGAAGAGAGATGAAGGAGGG + Intronic
1055823582 9:80297757-80297779 AGCTGAACAATGAGAAAGCATGG + Intergenic
1055995143 9:82149290-82149312 CTCTGAACAAAGATATTGCAGGG + Intergenic
1056088789 9:83184353-83184375 ATCTGATCAAAGGGAAAGCAGGG + Intergenic
1056297109 9:85204312-85204334 TTTTGGTCAAAGATGAAGCAAGG + Intergenic
1057781879 9:98056860-98056882 ATCTCGGCAATGATGAAGCACGG - Exonic
1058015560 9:100028438-100028460 ATGTGAAGCAAGTTGAAGCAAGG + Intronic
1059028924 9:110668359-110668381 ATCTGAAAAAAGATATAGAATGG + Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1060086823 9:120710837-120710859 ATCTGATCAAGTATGGAGCATGG - Intronic
1060372292 9:123085886-123085908 ACCTTAATAAAGATGCAGCAGGG - Intronic
1185543100 X:919972-919994 ATCTGAACAAAGTTGAAACTTGG - Intergenic
1185912354 X:3994027-3994049 ATCAGAACAAAGATGAACTATGG - Intergenic
1185922840 X:4113225-4113247 AACTGAACTAAGAAGAATCAAGG - Intergenic
1189050218 X:37637188-37637210 GTCTGAACACAGATGATGGAAGG - Intronic
1189276535 X:39790549-39790571 ATGTGACAAAAGAGGAAGCAAGG + Intergenic
1189669912 X:43396600-43396622 TTCTGATAAAAGATGAAGCTAGG - Intergenic
1189947034 X:46189883-46189905 ATATGAAGGAAGATAAAGCAAGG + Intergenic
1192985214 X:76391782-76391804 AACTGAACAATGAGGACGCATGG - Intergenic
1194273919 X:91856652-91856674 ATCTGAACAACGAGAACGCATGG - Intronic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1195390715 X:104359188-104359210 ATCTCAACTAAGATGAAGCATGG - Intergenic
1195568462 X:106372487-106372509 ATATCAAAAAAGATGAAGAAGGG + Intergenic
1195738663 X:108039546-108039568 ATCTGAGCAAAGGTGAGACATGG + Intergenic
1196480212 X:116139583-116139605 ATCCTAACCCAGATGAAGCAGGG + Intergenic
1196635443 X:117996902-117996924 ATCTGCAAAAAGATAAAGTATGG + Intronic
1197078785 X:122386859-122386881 ATCTCAATTAAGATGCAGCATGG - Intergenic
1198279457 X:135127318-135127340 ATGTTAATAAAGATGAAGAAGGG + Intergenic
1198291499 X:135245196-135245218 ATGTTAATAAAGATGAAGAAGGG - Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1198671680 X:139087865-139087887 ATCTATACAAAGATCAAGTAAGG - Intronic
1198740314 X:139835376-139835398 ATCTGATCTAAAATGAAGCAGGG + Intronic
1200591156 Y:5078069-5078091 ATCTGAACAACGAGAACGCATGG - Intronic
1201525855 Y:14933557-14933579 ATCAGAAGAAAGAGGAAGAAAGG + Intergenic