ID: 1111884347

View in Genome Browser
Species Human (GRCh38)
Location 13:94000567-94000589
Sequence CAAGTTGGACAGTTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111884347 Original CRISPR CAAGTTGGACAGTTGGAACT GGG Intronic
901824882 1:11854787-11854809 CAAATGTGACAGTTGGAGCTGGG - Intergenic
902568962 1:17334259-17334281 CAAGTTAGGAAGTAGGAACTTGG + Intronic
905615180 1:39392089-39392111 CAAGGTGGACAGGTGGAACAGGG - Intronic
905798578 1:40829376-40829398 CATGCTGGATAGTGGGAACTGGG + Intronic
910184328 1:84520398-84520420 TAAGTTGGCCACTTGGCACTTGG - Intergenic
915504235 1:156342928-156342950 AAAGTCAGACAGCTGGAACTAGG - Intronic
917558733 1:176121597-176121619 CTACTTTGACAGTTGCAACTTGG + Intronic
919253733 1:195095591-195095613 CATGTAGGACAGTTGGAAATAGG + Intergenic
920833158 1:209483280-209483302 CAGGTTGCACAGTTAGAAATTGG - Intergenic
921401840 1:214732753-214732775 CAAGTTTGACTTTTGCAACTTGG + Intergenic
1063614172 10:7588008-7588030 CAAGTTGGACAGTGGAATGTGGG - Intronic
1065669377 10:28097964-28097986 AAACTTGGACAGTTGCAATTTGG + Intronic
1067372652 10:45699631-45699653 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067387126 10:45826493-45826515 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067419001 10:46130758-46130780 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067447147 10:46358114-46358136 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067504354 10:46837347-46837369 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1067590232 10:47502646-47502668 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1067637352 10:48010748-48010770 TAAGTGGGCCAGTTTGAACTTGG - Intergenic
1067876135 10:50009586-50009608 TAAGTGGGCCAGTTTGAACTTGG + Exonic
1068716719 10:60196942-60196964 GAAGTTGGAGAGCTGGATCTGGG + Intronic
1070133950 10:73675177-73675199 TAAGTGGGCCAGTTTGAACTTGG - Exonic
1071126260 10:82338878-82338900 TAAGTTGGATATTTAGAACTCGG + Intronic
1071607765 10:87009305-87009327 TAAGTGGGCCAGTTTGAACTTGG + Intergenic
1072769847 10:98128529-98128551 CAAAATGGACAGTTTGAACAAGG - Intergenic
1074599676 10:114900949-114900971 TAAGTTGCACCCTTGGAACTGGG - Intergenic
1080260456 11:30343953-30343975 CATGTTTGAAAATTGGAACTTGG + Intergenic
1087899386 11:103623457-103623479 CAAGTTGGAATATTGAAACTTGG + Intergenic
1091141372 11:133237825-133237847 CCAGGTGCAGAGTTGGAACTAGG + Intronic
1097176966 12:57148913-57148935 GAAGTTGGCCAGCTGGACCTGGG - Intronic
1100632819 12:96405642-96405664 AAAGTTGGAAAGTGGGAACTGGG + Intergenic
1101125491 12:101629485-101629507 CAAGATGGACAGCTGGGAGTTGG - Exonic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103293904 12:119869958-119869980 CAAGTGGGCCAGTTGGAAGATGG - Intronic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1107529263 13:41266308-41266330 CAACTTAGACATTTAGAACTCGG + Intergenic
1108037567 13:46307439-46307461 TAAGTAGAACAGTTGGTACTAGG - Intergenic
1108210045 13:48129007-48129029 CAATTCTGACAGTTGGAATTAGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112593209 13:100783411-100783433 CAAGTTGGAGGTTTGGAACATGG - Intergenic
1116520436 14:45840136-45840158 CAAGTAGGACAGATGTAATTTGG + Intergenic
1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG + Intronic
1130086469 15:80781425-80781447 CAAGTTGGTCACTTGAAACAGGG + Intronic
1131714443 15:95093033-95093055 CAAATTGGACACTTGGCACTGGG + Intergenic
1149181380 17:53941440-53941462 CAAGCTGGCCAGTTGGCACATGG + Intergenic
1151551280 17:74823858-74823880 CAAGGTGCACAGTTGGATCGAGG + Intronic
1151580921 17:74978178-74978200 CAAGGTGGAGTCTTGGAACTTGG + Intergenic
1161920880 19:7264867-7264889 CATGTTGGATGGTTGGAAATCGG - Intronic
1165053138 19:33155914-33155936 CAAGGTGGACATTTTGAGCTGGG - Intronic
1166796235 19:45428012-45428034 CAAGTTGGCAAGTTGGATGTTGG + Intronic
1167316297 19:48765067-48765089 AAAGTTGCACAGTTAGCACTAGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
927016400 2:18966988-18967010 CATGTAGGATAGTTGGAAGTAGG + Intergenic
929726004 2:44428236-44428258 CAGGATGGAGAGTTGGAAATGGG + Intronic
930047133 2:47182590-47182612 CAAGTTTGACAGGTAGAAATTGG + Intergenic
932739367 2:74280087-74280109 CATGTTGCAGTGTTGGAACTTGG - Intronic
938030364 2:127987061-127987083 GAAATTGGACAGTTAGAACATGG - Intronic
948189795 2:236049063-236049085 CAACTGGGCCAGTTTGAACTTGG + Exonic
1170403004 20:16007913-16007935 TAAGTTTCACAGTTGGAACCTGG + Intronic
1170845310 20:19957190-19957212 CAAGTTGGATGGCTGGACCTTGG - Intronic
1171284112 20:23923722-23923744 CAAGTTGGGCACTTGCAATTGGG - Intergenic
1172894724 20:38292477-38292499 CAAGGTGCACAGTAGGCACTTGG + Intronic
1173163662 20:40671118-40671140 CAACTTAGACAGATGGAGCTGGG - Intergenic
1176676153 21:9779370-9779392 CAAGCTAGGGAGTTGGAACTGGG + Intergenic
1179668016 21:42925795-42925817 CAAGTTTGAGCGTTGGGACTGGG + Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
949693884 3:6671296-6671318 CAGGTTGGGCTGTGGGAACTAGG + Intergenic
953675158 3:44995311-44995333 TAATTTAGACAGTTGGACCTGGG + Intronic
954573690 3:51662990-51663012 CAAATTGGACAGCTGGTAGTAGG - Exonic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
957272222 3:78045893-78045915 CAAGTTTGACAGATGGAATTCGG - Intergenic
959651577 3:108756114-108756136 CAAGTGAGAGACTTGGAACTTGG + Intronic
960513657 3:118579418-118579440 AGAGTTGGACAGTTGCAACAGGG - Intergenic
973127242 4:46602456-46602478 AAAGTTGAACAGTTGGAAGTTGG - Intergenic
977025434 4:91813055-91813077 CAAGTTGGGTGGTTGGAACTTGG - Intergenic
977592031 4:98837474-98837496 CAAATTAGACAGTATGAACTTGG + Intergenic
978661174 4:111128367-111128389 CAAGTTTGATAGGTGGACCTGGG - Intergenic
978951154 4:114561318-114561340 AAAATGGGACAGCTGGAACTGGG + Intergenic
984376877 4:178942670-178942692 TAAGTTGGACAGTTGGATTAGGG - Intergenic
985399375 4:189579376-189579398 CAAGCTAGGGAGTTGGAACTGGG - Intergenic
993071510 5:83170247-83170269 GGAGTTGGACAGTTACAACTAGG - Intronic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1001132168 5:169073302-169073324 CCAGTTGGTCAGTTGGGCCTTGG + Intronic
1001690341 5:173628321-173628343 AAAGCTGGAGAGTTGGAATTTGG + Intergenic
1002208144 5:177578515-177578537 CAAGTTGGACAACTAGAAGTAGG - Intergenic
1003761093 6:9179916-9179938 CAAGTTCTTCAGTTGGAACTTGG - Intergenic
1008070399 6:47093579-47093601 CAAGTTGCAAAGTGGGAACATGG - Intergenic
1009651953 6:66488448-66488470 AAAGTTGGATAGTTGGGATTAGG + Intergenic
1011080635 6:83486830-83486852 GAAGTTGGCCAGTGGGAACATGG + Intergenic
1013273783 6:108564358-108564380 AAACTTGGACACTTGGAAATGGG - Intronic
1016403141 6:143701997-143702019 TAAGTAGCAGAGTTGGAACTAGG + Intronic
1016761511 6:147742678-147742700 GAAGTTGGACAGTTGGACATTGG + Intergenic
1023871479 7:44265343-44265365 CAAGTTGGAAAGGTGGAACGTGG - Intronic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG + Intronic
1029322540 7:99777357-99777379 CAAGTTCTACAGTCTGAACTAGG - Intronic
1032095396 7:128935647-128935669 CAAGATGGACAGTGGGAAGGGGG + Intergenic
1032493613 7:132344047-132344069 CAAGTTGGCCATTGGGTACTAGG - Intronic
1033270670 7:139930188-139930210 TAAATTGGTCAGTTGGCACTGGG - Intronic
1035906447 8:3515647-3515669 CAAGTTGGTCTGTTGCAAGTTGG - Intronic
1045716488 8:105052986-105053008 CAAGTTGGTTATTTGTAACTTGG + Intronic
1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG + Intergenic
1048190314 8:132282411-132282433 CAAGGGGGACAGATGGGACTGGG - Intronic
1048199495 8:132360043-132360065 CATATTGGATAGTTGTAACTGGG - Intronic
1049454383 8:142679615-142679637 AAAGGTGGGCAGCTGGAACTGGG + Intronic
1059267365 9:113048086-113048108 CAAGTTGTACAATTCAAACTGGG + Intronic
1059911425 9:119048579-119048601 CAAGCTGGACAGTTAGAAAGTGG - Intergenic
1061275252 9:129566502-129566524 CAAGCTGGCCTGTTGGGACTGGG - Intergenic
1062103130 9:134738669-134738691 TTGGTTGGCCAGTTGGAACTTGG + Intronic
1187218110 X:17296721-17296743 AAATGTGGCCAGTTGGAACTGGG + Intergenic
1191682739 X:63857881-63857903 CAAGTTGAACAGTGGTGACTGGG + Intergenic
1200971101 Y:9153264-9153286 CAAGTTGGACAGTGTTAAGTTGG + Intergenic
1202139924 Y:21711039-21711061 CAAGTTGGACAGTGTTAAGTTGG - Intergenic