ID: 1111894334

View in Genome Browser
Species Human (GRCh38)
Location 13:94121937-94121959
Sequence GAGTCATATCTTTATCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111894333_1111894334 5 Left 1111894333 13:94121909-94121931 CCATGCTTCAGCACAACTGTTCT 0: 1
1: 0
2: 1
3: 13
4: 209
Right 1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1111894329_1111894334 23 Left 1111894329 13:94121891-94121913 CCTACCCAACCACTCATTCCATG 0: 1
1: 0
2: 2
3: 15
4: 265
Right 1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1111894330_1111894334 19 Left 1111894330 13:94121895-94121917 CCCAACCACTCATTCCATGCTTC 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1111894332_1111894334 14 Left 1111894332 13:94121900-94121922 CCACTCATTCCATGCTTCAGCAC 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1111894328_1111894334 26 Left 1111894328 13:94121888-94121910 CCTCCTACCCAACCACTCATTCC 0: 1
1: 0
2: 3
3: 81
4: 798
Right 1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 136
1111894331_1111894334 18 Left 1111894331 13:94121896-94121918 CCAACCACTCATTCCATGCTTCA 0: 1
1: 0
2: 2
3: 14
4: 221
Right 1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111894334 Original CRISPR GAGTCATATCTTTATCTACT AGG Intronic
901663501 1:10813594-10813616 GAGTCACTTCTTCATCTCCTTGG - Intergenic
903866919 1:26406055-26406077 GGGTCCTATATTTATCAACTAGG + Intergenic
910746133 1:90576831-90576853 GATTCTTATCTTTTTCTAGTGGG - Intergenic
911255499 1:95628480-95628502 GAGTATTATCTTGATCTATTTGG - Intergenic
911294868 1:96102723-96102745 GAGTCAAATCTGTATTGACTAGG + Intergenic
918008061 1:180560563-180560585 GAGACATATCTTTATTTCTTTGG - Intergenic
918268703 1:182873742-182873764 GGGGCATATCCCTATCTACTGGG - Intronic
918359079 1:183736872-183736894 GCTTCTTATCTTTATCTATTAGG - Intronic
919307022 1:195855332-195855354 GACTCATATCTTCCTTTACTTGG - Intergenic
920174014 1:204089002-204089024 GAGGCATTTCTTTCTCTGCTTGG + Intronic
921526242 1:216222122-216222144 GAATCATAACTTTATAGACTGGG - Intronic
922050230 1:221982250-221982272 TATTCATATATTTATCTAGTAGG - Intergenic
922431101 1:225554443-225554465 GAATCACATTTTTACCTACTGGG + Intronic
923201244 1:231714075-231714097 CAGTCATGTTTTTATCTACCTGG + Intronic
924507814 1:244702711-244702733 GAGTCCTATCTATAGCCACTTGG - Intronic
1065092598 10:22250390-22250412 GATTCATTTATTTATCTACGAGG + Intergenic
1065541886 10:26778642-26778664 GAGAGGTGTCTTTATCTACTTGG - Intronic
1066335683 10:34475710-34475732 CAGAAATATCTTTATGTACTGGG + Intronic
1068412185 10:56670537-56670559 CAGTCATATCTTTTTCAAATGGG - Intergenic
1069159946 10:65080746-65080768 GAGGAATATCTTTATGCACTTGG - Intergenic
1080156281 11:29115149-29115171 GACTCATATCTTATTCTAATTGG + Intergenic
1081331031 11:41800428-41800450 GAGTCAGATTTTTATCCACTTGG - Intergenic
1083084039 11:60124182-60124204 GAGTCAGAATTTTATTTACTAGG + Intergenic
1085661651 11:78373203-78373225 GAGTCATATCTAAAGCTACTAGG + Intronic
1085821338 11:79796891-79796913 GATTCATTTCCTTATCTGCTGGG - Intergenic
1086208501 11:84289654-84289676 GAATCCTCTCTTTCTCTACTAGG - Intronic
1088592974 11:111419148-111419170 GAGTCATATCCTGAGGTACTGGG + Intronic
1088795080 11:113260957-113260979 GAGACAGATCTGTATCTCCTAGG - Intronic
1091574183 12:1717272-1717294 GAGTCACTTCTTTATTTTCTAGG + Intronic
1093254690 12:16852707-16852729 GATTCATATTTTCAACTACTTGG - Intergenic
1095697491 12:45157787-45157809 GAGTAATATCATTCTCTACGTGG - Intergenic
1095923470 12:47554983-47555005 TAGACATATCTTTATTGACTTGG + Intergenic
1096652922 12:53070940-53070962 GAGTCATGTCTTTGGCTTCTTGG - Intronic
1097327445 12:58293836-58293858 GATTGATATCTTTATCTGTTTGG + Intergenic
1097828925 12:64203198-64203220 GATTCATATCTTTACATAGTTGG - Intronic
1098631081 12:72721976-72721998 GAGTCATAACTTCATCTACGTGG + Intergenic
1099842409 12:87982358-87982380 GTGTTATATGTTTATATACTGGG - Intronic
1100121929 12:91378591-91378613 GAATCATATGTGTATATACTAGG - Intergenic
1101772493 12:107764307-107764329 GACTCATATATCTATTTACTTGG + Intergenic
1105760710 13:23511872-23511894 GATTTATGTCTTTATTTACTGGG + Intergenic
1107651120 13:42546281-42546303 TAGTCATATCTTTAGGTGCTAGG - Intergenic
1110880971 13:80571827-80571849 CAGTCATATCCTTTTATACTGGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1111894334 13:94121937-94121959 GAGTCATATCTTTATCTACTAGG + Intronic
1112106446 13:96245637-96245659 GAGCCATTTCTTTATCCATTAGG + Intronic
1114295208 14:21322939-21322961 GAGTCAGATCTTTCACCACTGGG - Intronic
1116682137 14:47985138-47985160 GAGTCATCTCTCTTTCTTCTTGG - Intergenic
1119984176 14:79117004-79117026 TTGACATACCTTTATCTACTAGG + Intronic
1120073310 14:80127148-80127170 GAGTCAAATCTTACTCTACATGG + Intergenic
1120249631 14:82047173-82047195 CTTTCATGTCTTTATCTACTTGG + Intergenic
1121022989 14:90593125-90593147 GAGTCATAGCTGTACCAACTGGG - Intronic
1121186171 14:91971728-91971750 AAGTCATAACTTTATCTAAGAGG - Intronic
1122562929 14:102629961-102629983 GAGGCATCTCTTTATCTAGGAGG - Intronic
1125070037 15:35543843-35543865 TAGTCATATCTTTTTATCCTGGG - Intronic
1125359985 15:38854799-38854821 GAGTCATGTCATTAACTGCTAGG + Intergenic
1126220052 15:46203033-46203055 GAGTCTTATCTCTATTTTCTTGG + Intergenic
1130076093 15:80691838-80691860 AAGTTAGATCTTTCTCTACTAGG + Intronic
1131369824 15:91870809-91870831 GTTTCATATCTTTATTTTCTAGG + Intronic
1131824266 15:96305434-96305456 GAGTCAAATCTTAATCATCTGGG - Intergenic
1137958199 16:52853964-52853986 AAGTCATATATTTATTAACTTGG + Intergenic
1140594357 16:76391494-76391516 CAGCCAGATCTTTATTTACTAGG - Intronic
1140829050 16:78734499-78734521 GAGACATTTCTTTACCTACCTGG + Intronic
1146019669 17:29266770-29266792 CATTCATATCTTCATCTAGTAGG + Intronic
1155037887 18:22040668-22040690 GAGTCTGATCTTTATCTAGAAGG - Intergenic
1158750859 18:60258758-60258780 GAGTTATATAATTGTCTACTTGG + Intergenic
1158804262 18:60950709-60950731 TAGTTATATCTTTATCTTGTTGG + Intergenic
925978541 2:9157851-9157873 GACTCATTTGTTAATCTACTGGG + Intergenic
926269840 2:11356912-11356934 GAGACAGATCTTGATCAACTCGG - Intergenic
927768881 2:25840610-25840632 GAGTCATATATTTGTCTTTTTGG + Intronic
930845930 2:55904016-55904038 GAGCCATACCTTTATCTTCCAGG - Intronic
934138934 2:89026371-89026393 CACTCATATCTATATCTTCTAGG + Intergenic
934230313 2:90174189-90174211 CACTCATATCTATATCTTCTAGG - Intergenic
934894805 2:98106695-98106717 CAGTCATATTTCTATATACTAGG - Intronic
938860068 2:135358989-135359011 AAGTCATTTTTATATCTACTTGG + Intronic
939888901 2:147712160-147712182 GAGTCATATCTGTGTCAACATGG - Intergenic
942851069 2:180486722-180486744 AAGACATATTTTTATTTACTTGG - Intergenic
943018367 2:182542828-182542850 AAATCATATCTTTATCTCTTAGG + Intergenic
943426521 2:187743791-187743813 CAGTCATATTTTAATATACTGGG + Intergenic
947170346 2:227304661-227304683 AAGTAATATCTTTATCTCCCAGG - Intronic
1172580408 20:36042941-36042963 AAGTCATACCTTGATATACTGGG - Intergenic
1173480402 20:43394068-43394090 GAGTGTTATCTTCATCTTCTTGG - Intergenic
1177247956 21:18554670-18554692 GAGCCATCTCTTTAGTTACTGGG - Intergenic
1177354476 21:19989762-19989784 GAGAAATATCTTTATCAACTAGG + Intergenic
1181865046 22:25848229-25848251 AAGTCATATCATCATCTCCTGGG - Intronic
1183661283 22:39222979-39223001 GAGCCAGATCTTTAGCTTCTGGG + Intergenic
950003600 3:9676957-9676979 GAGTCATGCCTTTGTTTACTGGG + Intronic
952310986 3:32190161-32190183 TTGTCATATCTTTATCTCCTAGG - Intergenic
957164825 3:76658817-76658839 GAGTCATATCTTTTCATGCTAGG + Intronic
958632620 3:96701964-96701986 GACTCATATCTTTAATTCCTTGG - Intergenic
959555472 3:107712323-107712345 GACTCATATTTCTATTTACTTGG + Intronic
959561251 3:107784926-107784948 GAGTCTTCTCTTTTTCTTCTTGG - Intronic
962054981 3:131862025-131862047 GGGTAATATCTGTGTCTACTGGG - Intronic
962214085 3:133504677-133504699 GAGTCCTATTTTCATCAACTTGG - Intergenic
974144482 4:57930026-57930048 CAGACATATCTTTATTTATTTGG - Intergenic
978071937 4:104483998-104484020 AAGTCATATCTTTGCCAACTGGG + Intronic
979035343 4:115709317-115709339 GTGATATATCTTTATCCACTTGG + Intergenic
981824361 4:148923087-148923109 AACTAATATCTTTGTCTACTGGG - Intergenic
982793576 4:159620103-159620125 CATGCATATATTTATCTACTTGG - Intergenic
983714350 4:170759453-170759475 GAGTCTTCTCTTTTTCTTCTTGG + Intergenic
987837931 5:23185995-23186017 GAGTGATATATTCATCAACTGGG + Intergenic
988633905 5:32960814-32960836 GAATCACATGTTTATCTTCTGGG - Intergenic
999045572 5:148465487-148465509 AATTCATTTCTTTATCTCCTTGG - Intronic
1001370069 5:171191008-171191030 CAGTCATATTTTTAATTACTAGG + Intronic
1004868859 6:19882715-19882737 GCGTCATATCTTTATGACCTAGG + Intergenic
1006534769 6:34689756-34689778 TGGTTATATCTTTATCTAGTAGG + Intronic
1007237306 6:40400022-40400044 GCATCATATCTTTCTCCACTGGG + Intronic
1008259089 6:49342900-49342922 GAGACATATCCTTATCTGCTAGG + Intergenic
1009513526 6:64583312-64583334 GAATCATATGTTTATATCCTAGG - Intronic
1009656499 6:66552790-66552812 GAGAAATATCTTTATGTACTGGG + Intergenic
1011952403 6:92983226-92983248 GAGTCAGTTTTTTATCTATTTGG - Intergenic
1015448017 6:133330729-133330751 AAGACATTTCTTTATTTACTTGG - Intronic
1017452883 6:154570799-154570821 GAGCTATATCTTTGGCTACTGGG - Intergenic
1021304140 7:19010916-19010938 GCGGCCTATCTTAATCTACTTGG + Intergenic
1021595600 7:22313042-22313064 GAGTCAGATCTGCATGTACTTGG - Intronic
1023288667 7:38646083-38646105 GAGTTATATTTTTATCTATATGG + Intergenic
1023654143 7:42403030-42403052 GAGTGAGACCTTTATCAACTGGG + Intergenic
1024230822 7:47361975-47361997 GAGTCATTTCTTTTGTTACTGGG + Intronic
1024921340 7:54558336-54558358 GAATCAAATCTGTATCTACCTGG - Intronic
1031352065 7:120745210-120745232 AAGTCATATTTTTCTGTACTGGG + Intronic
1034772205 7:153790960-153790982 GAGGCCTTTCTTTATCTCCTCGG - Intergenic
1035490608 7:159273409-159273431 GAGGAATATCTTTATATATTTGG + Intergenic
1037956216 8:23061997-23062019 TTGTAATATCTTTATCTGCTTGG + Intronic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1039582002 8:38674713-38674735 GTGTCAAATCTTTCTCTACAAGG + Intergenic
1043332562 8:79135404-79135426 GAGTGAAATGTTTATCTACATGG + Intergenic
1047054972 8:121153687-121153709 GGCTCATATATTAATCTACTAGG + Intergenic
1047160314 8:122370828-122370850 GACTCATATGTTAATCTCCTTGG - Intergenic
1050146815 9:2576939-2576961 GAGTCAAATCATTTTCTTCTTGG - Intergenic
1050494873 9:6230273-6230295 GAGTCATAGATTGATCTACTAGG + Intronic
1051323525 9:15937802-15937824 AAGGCACATCTTTTTCTACTGGG + Intronic
1051949854 9:22618682-22618704 AAGTCATAACTTTGTCAACTTGG + Intergenic
1052527285 9:29634714-29634736 GGGTGATATCTAAATCTACTAGG - Intergenic
1053095299 9:35322139-35322161 GAGTCATCTCTGTGTCTTCTGGG + Intronic
1055822494 9:80283928-80283950 GAGGAACATCTTTCTCTACTTGG + Intergenic
1057250880 9:93500588-93500610 CAGTCAAATATTTATCCACTGGG - Intronic
1059660000 9:116391281-116391303 GCATCATGCCTTTATCTACTTGG + Intronic
1060626069 9:125112987-125113009 CAGTCATATATTTATGTAATTGG - Intronic
1186671651 X:11773228-11773250 CAGTCATTTTTTTATCTAATAGG + Intronic
1192457107 X:71285214-71285236 GAATCAAATCTTTTCCTACTTGG - Intronic
1192742569 X:73907446-73907468 TAGTCCTATTTTTTTCTACTTGG + Intergenic
1194599186 X:95899567-95899589 CAGTCATATTTTTAGGTACTGGG + Intergenic
1195718059 X:107837429-107837451 GAATCATATCTCTGTCTTCTAGG - Intronic
1196507260 X:116462265-116462287 GGTTCATATGTTTACCTACTGGG - Intronic
1196522715 X:116693483-116693505 GGTTCATATGTTTACCTACTGGG - Intergenic
1199529075 X:148826663-148826685 GAGGCATATCTTTTTCTAAAAGG - Intronic