ID: 1111895788

View in Genome Browser
Species Human (GRCh38)
Location 13:94139834-94139856
Sequence CCACCAGCTGTAGCTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111895784_1111895788 -2 Left 1111895784 13:94139813-94139835 CCTTAGTCATATCTGATCATTCC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1111895780_1111895788 11 Left 1111895780 13:94139800-94139822 CCCCTGCCTGTTTCCTTAGTCAT 0: 1
1: 0
2: 1
3: 35
4: 269
Right 1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1111895781_1111895788 10 Left 1111895781 13:94139801-94139823 CCCTGCCTGTTTCCTTAGTCATA 0: 1
1: 0
2: 0
3: 27
4: 353
Right 1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1111895782_1111895788 9 Left 1111895782 13:94139802-94139824 CCTGCCTGTTTCCTTAGTCATAT 0: 1
1: 0
2: 0
3: 26
4: 212
Right 1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1111895783_1111895788 5 Left 1111895783 13:94139806-94139828 CCTGTTTCCTTAGTCATATCTGA 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111895788 Original CRISPR CCACCAGCTGTAGCTTCCTG GGG Intronic
902934865 1:19757757-19757779 CCAACTGCTGTACCTACCTGGGG + Intronic
903230665 1:21920504-21920526 CCACTAGCAGCAGCTTCCAGTGG + Intronic
904385238 1:30137095-30137117 AATCCAGCTGTACCTTCCTGAGG + Intergenic
904409077 1:30314090-30314112 TCACCTGCTGTCCCTTCCTGGGG + Intergenic
904441038 1:30530958-30530980 CCAACATCTGTAAATTCCTGGGG + Intergenic
906142214 1:43540533-43540555 CCAGCAGAGGTATCTTCCTGCGG - Intronic
910689730 1:89953863-89953885 CCACCTGCCTTAGCCTCCTGAGG + Intergenic
911535346 1:99093222-99093244 ACACATGCTGTGGCTTCCTGTGG - Intergenic
913380694 1:118207398-118207420 CCACCAGATGAAGCTCCTTGTGG - Intergenic
914877088 1:151520239-151520261 CCACCATCTATGGCATCCTGAGG + Exonic
915006338 1:152640608-152640630 CCTTCAGCTGTGGCCTCCTGTGG + Intergenic
915270729 1:154751481-154751503 GCACCTGCTGCAGCTCCCTGAGG - Intronic
917247406 1:173019335-173019357 CTAGCAGATGTAGCTTCTTGAGG + Intergenic
917450990 1:175147103-175147125 CCACCAGCTGTGGCAGCTTGGGG + Exonic
917516800 1:175715054-175715076 CCAGCAGCTTCAGCATCCTGTGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918204979 1:182300250-182300272 CCTGCAGCTGTTGCTGCCTGGGG + Intergenic
918249074 1:182685530-182685552 TCCCCAGCTGCAGCTTCCTTTGG - Intergenic
922418272 1:225441720-225441742 CCCCCTGCTGTAGCTGGCTGAGG - Intergenic
922896679 1:229106180-229106202 CCACCAACTGTAGGTTCATTTGG - Intergenic
923035894 1:230284997-230285019 CCACCAGTGGAAGCTTCCTGAGG - Intergenic
1064237170 10:13587110-13587132 CCACCAGCTGCCGCTTCCGAAGG - Exonic
1065453947 10:25887156-25887178 CCTCCAGGTGTAGCTTGCTTAGG + Intergenic
1069734943 10:70647966-70647988 CCACCAGCTGGAGTTCCCTGGGG + Intergenic
1070934471 10:80282582-80282604 CCCAGAGCTGCAGCTTCCTGAGG - Intronic
1071865540 10:89726407-89726429 AAACAAGCAGTAGCTTCCTGGGG - Exonic
1072269007 10:93757238-93757260 CGGCCAGCTCTAGCTTCCTGGGG - Intergenic
1073104348 10:101023668-101023690 CCATCAGATGGAGCTCCCTGGGG + Intronic
1073274725 10:102300305-102300327 ATAACAGCTGTAGCTTCCAGAGG + Intronic
1074788609 10:116864088-116864110 ACACCAGGTATGGCTTCCTGTGG - Intronic
1075551479 10:123395804-123395826 GCACCAGCTGTCCCTTCCTGGGG - Intergenic
1076842845 10:133054988-133055010 ACAGCAGGTGTAGCTTCCTGAGG + Intergenic
1081704609 11:45173856-45173878 CCATCTGCTGGAGCCTCCTGAGG - Intronic
1083725165 11:64624098-64624120 CCAGCAGCTGAAGGTTCCGGGGG - Intronic
1088953634 11:114596359-114596381 CCAGCAGCTACTGCTTCCTGTGG - Intergenic
1089158116 11:116417381-116417403 CCCTCAGCTGTTGCTTCCTGTGG + Intergenic
1089784547 11:120898659-120898681 CTCCCAGCTGCAGCATCCTGGGG + Intronic
1090838713 11:130472054-130472076 CTCCCAGCTTGAGCTTCCTGAGG + Intronic
1091817869 12:3453458-3453480 CCAGCAGCAGTAGCCTCCAGGGG - Intronic
1092005899 12:5070250-5070272 CCATCAGCTGGAGGTGCCTGAGG - Intergenic
1093030558 12:14284723-14284745 CCGCTCGCAGTAGCTTCCTGGGG + Intergenic
1094084465 12:26574733-26574755 CCACGAGTGGAAGCTTCCTGAGG - Intronic
1094738598 12:33262624-33262646 CCAGCAGCTGCCCCTTCCTGTGG - Intergenic
1095728234 12:45475150-45475172 CCACCATTGGGAGCTTCCTGAGG + Intergenic
1096524299 12:52201341-52201363 TCTCCAGCTGGGGCTTCCTGAGG - Intergenic
1100775185 12:97965840-97965862 TCACCAGCTGTGGGTTCATGGGG + Intergenic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1101379526 12:104202469-104202491 CCACCCGCTTCAGCCTCCTGAGG - Intergenic
1101757643 12:107633650-107633672 CCACAAGCAGTAGCATCCTCTGG - Intronic
1101939859 12:109091835-109091857 CCACCACGCCTAGCTTCCTGTGG + Intronic
1102661905 12:114536492-114536514 CCATGAGCGGAAGCTTCCTGAGG - Intergenic
1102665779 12:114571531-114571553 CCATGAGCGGAAGCTTCCTGAGG + Intergenic
1103841989 12:123872437-123872459 GCACCAGCTGCAGAGTCCTGGGG - Intronic
1104799400 12:131543647-131543669 GCTCGAGCTGGAGCTTCCTGGGG - Intergenic
1105533657 13:21243668-21243690 CCACCAGCTGTGACTTCGAGAGG + Intergenic
1105606526 13:21930702-21930724 CCAGCAGCTGGGGCTTCCTGAGG - Intergenic
1105659459 13:22477671-22477693 CCAGCACCTGTTGTTTCCTGAGG - Intergenic
1106567649 13:30900268-30900290 CCACCTGCTGTATCCTCATGTGG + Intergenic
1107449055 13:40492263-40492285 CCATGAGCAGAAGCTTCCTGAGG + Intergenic
1109683870 13:65787665-65787687 CAACTAGATGTAGATTCCTGAGG - Intergenic
1111895788 13:94139834-94139856 CCACCAGCTGTAGCTTCCTGGGG + Intronic
1113763677 13:112867586-112867608 CCACCAGGTGCAGCTGACTGCGG - Intronic
1113920186 13:113903398-113903420 CCACCAACAGCAGCCTCCTGAGG - Intergenic
1117833768 14:59780497-59780519 CCACCAGCTTTGACTTCCTCCGG - Intronic
1118188974 14:63563361-63563383 CCACCAGGTATATCTTCCTTAGG + Intergenic
1118327682 14:64792619-64792641 CTGCCAGCTCTAGCTTTCTGTGG - Intronic
1119056165 14:71422161-71422183 ATACCAGCTGAAGCTTCATGTGG + Intronic
1119083787 14:71721604-71721626 CCACCTGCTTTATTTTCCTGTGG + Intronic
1119673194 14:76535196-76535218 CCACCAGAGGTACCTTCCTGCGG - Intergenic
1120291146 14:82572420-82572442 TCACCACCTGTAGCTTTGTGGGG - Intergenic
1120479035 14:85025100-85025122 CCAGAAGCTGGAGCTCCCTGGGG - Intergenic
1120774301 14:88416045-88416067 CCACGAGCAAAAGCTTCCTGTGG + Intronic
1122157084 14:99756184-99756206 CCACCTGCAGTCGCCTCCTGGGG - Intronic
1122381826 14:101313406-101313428 ACACCAGCTGTGACCTCCTGTGG + Intergenic
1123480541 15:20627441-20627463 CCACCTGCTGGAGTTTCTTGCGG - Intergenic
1123637467 15:22372926-22372948 CCACCTGCTGGAGTTTCTTGCGG + Intergenic
1125464404 15:39936152-39936174 CCACCAGCTATAAATTCTTGAGG - Intronic
1128473221 15:67974233-67974255 CCATGAGCGGAAGCTTCCTGAGG + Intergenic
1129072364 15:72961943-72961965 CCACCAGATTTAGCTTCAAGAGG - Intergenic
1129475775 15:75783772-75783794 CCCCCAGCTGGAGCTGCCTTTGG - Intergenic
1129839608 15:78735544-78735566 CCCCCAGCTGGAGCTGCCTTTGG - Intergenic
1130283948 15:82540363-82540385 CCCCCATCTGCAGCTTCCCGCGG - Intronic
1130550741 15:84888704-84888726 CCCCCAGCTGTAAGTTCCTGGGG + Intronic
1131453432 15:92564872-92564894 CCACAAATGGTAGCTTCCTGAGG - Intergenic
1132761497 16:1510606-1510628 CCTCCAGCTGCAGCTTCCTGAGG + Exonic
1133260991 16:4549875-4549897 CCACAATTTGAAGCTTCCTGAGG + Intergenic
1134029514 16:10980499-10980521 CCAACAGCTGAAGGGTCCTGAGG - Intronic
1134059664 16:11191465-11191487 CCACCTGCTGAAGCCTCCTGGGG - Intergenic
1134624660 16:15714976-15714998 GCTCCCGCTGCAGCTTCCTGCGG + Exonic
1135524975 16:23207293-23207315 CTACAGGCTCTAGCTTCCTGGGG - Intronic
1139971628 16:70779949-70779971 CCTCCCGCTTCAGCTTCCTGAGG + Intronic
1141204375 16:81922177-81922199 CCTCCAGCTGCAGATCCCTGTGG + Intronic
1141814949 16:86403547-86403569 CCACCACTGGAAGCTTCCTGAGG - Intergenic
1143130578 17:4674591-4674613 CATCCAGCTTTAGCTTCTTGGGG + Exonic
1143775540 17:9196407-9196429 CTACCAGCTGCCGCCTCCTGTGG + Intronic
1144461981 17:15465948-15465970 CCACCAGCTGTAGAATGCTCAGG - Intronic
1144718074 17:17448093-17448115 CTACCTGCTTTAGTTTCCTGTGG - Intergenic
1144732766 17:17538006-17538028 GCAGCAGCTGTCCCTTCCTGAGG - Intronic
1145799926 17:27676446-27676468 CCCCCATCTGCTGCTTCCTGGGG + Intergenic
1145996976 17:29110432-29110454 TCACCACCTGTAGCTTCATCTGG + Exonic
1148836429 17:50468150-50468172 CCACCACCCGTAGCTTGCTCAGG + Exonic
1150276934 17:63904540-63904562 CCACCTGCTGTAGATCTCTGAGG + Intergenic
1151419047 17:73985501-73985523 CCACCAGCCAGAGCCTCCTGAGG - Intergenic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1153431565 18:5023040-5023062 TCTCCAGCTCTGGCTTCCTGAGG - Intergenic
1155089678 18:22494297-22494319 CCAAGAGCTGTGGCTTCCTGGGG + Intergenic
1155826539 18:30451147-30451169 CAATCAGCTGTAGCTTGCTGAGG + Intergenic
1158956670 18:62546720-62546742 CAAACAGCTGAAGCTTCCAGAGG - Intronic
1158967229 18:62633252-62633274 GCAACAGCTTTAGCTTGCTGAGG + Intergenic
1158980373 18:62754841-62754863 CCACCAGGTGTAGCTGACTATGG - Intronic
1159162969 18:64668203-64668225 CACTCATCTGTAGCTTCCTGGGG - Intergenic
1159354956 18:67327134-67327156 ACACCAACAGTAGATTCCTGGGG - Intergenic
1160073557 18:75650133-75650155 CCACCAGCTGAAGCTTCAACTGG + Intergenic
1160689099 19:452733-452755 CCACCAGCTGCAGCTGCGTGTGG - Intronic
1161029249 19:2050399-2050421 CAACCAGCTGGAGCTTGCAGGGG + Intronic
1161055907 19:2190550-2190572 CCACCAGCTGCAGCAGGCTGAGG - Intronic
1161349433 19:3783975-3783997 CCAGCAGCTGCAGCCTCCCGAGG - Exonic
1161873242 19:6886805-6886827 CCCCCAGCTGGTGCTTTCTGGGG + Intergenic
1161888928 19:7019599-7019621 TCACCAGCTGCATCTTCCGGAGG - Intergenic
1161890440 19:7032422-7032444 TCACCAGCTGCATCTTCCGGAGG + Exonic
1161891008 19:7038311-7038333 TCACCAGCTGCATCTTCCGGAGG - Exonic
1161892526 19:7051150-7051172 TCACCAGCTGCATCTTCCGGAGG + Exonic
1161893093 19:7056772-7056794 TCACCAGCTGCATCTTCCGGAGG - Exonic
1163178892 19:15584655-15584677 CGATCAGCTCCAGCTTCCTGCGG - Intergenic
1165234219 19:34407380-34407402 CCACCCGCCTTGGCTTCCTGAGG + Intronic
1166696402 19:44854092-44854114 CCACCACTTTTAGCTTCTTGTGG - Intronic
1166869728 19:45864148-45864170 CCCCCAGCTGTCGCGTCCTGGGG + Intronic
1167166646 19:47803503-47803525 CCTGCAGCTGTTGCTCCCTGAGG + Exonic
1167175191 19:47860261-47860283 CCTGCAGCTGTTGCTCCCTGAGG - Intergenic
1167274537 19:48528652-48528674 GCAACAGCTCTAGCTTTCTGAGG - Intergenic
1168162862 19:54523688-54523710 CCACCTGTGTTAGCTTCCTGGGG + Intergenic
928172622 2:29013050-29013072 CCACCAGCTGAGGCTGCCTGAGG - Intronic
928605074 2:32937979-32938001 GCCCCAGGTGAAGCTTCCTGTGG - Intergenic
928803705 2:35125550-35125572 ACACCAGCTGTGGCTGTCTGTGG + Intergenic
931301252 2:60980495-60980517 CCACCAACTGTTCCTGCCTGTGG + Intronic
931676636 2:64702962-64702984 CAACCAACTGAAGCATCCTGAGG + Intronic
931924996 2:67062779-67062801 CCACCAGCTGTTCCCACCTGTGG - Intergenic
932447242 2:71788391-71788413 CAACATGCTGGAGCTTCCTGTGG + Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
933847255 2:86336519-86336541 CCACCTGCTGTAGCTAGCAGGGG - Intronic
934050030 2:88202118-88202140 CCAGCAGCTTCAGCTTCCTCAGG - Intergenic
934099684 2:88641086-88641108 CCCCATACTGTAGCTTCCTGTGG + Intergenic
934631812 2:95934091-95934113 CCAGCATCTGTTGTTTCCTGAGG - Intronic
934706552 2:96485558-96485580 GCACCACCTCTAGATTCCTGTGG + Intergenic
935234373 2:101126096-101126118 CCACGAGTGGAAGCTTCCTGAGG - Intronic
935712722 2:105913484-105913506 ACATCAGCTGGAGCTTCCAGAGG + Intergenic
937920961 2:127130254-127130276 CCACTAGTTGGAGCTTGCTGGGG - Intergenic
941200710 2:162505549-162505571 TGACCAGCTGTATCTTCCTTTGG + Intronic
942641926 2:178069676-178069698 TCAGCAGCTGATGCTTCCTGTGG - Intronic
946013051 2:216581993-216582015 CCACCTGTACTAGCTTCCTGGGG + Intergenic
946597308 2:221320393-221320415 CCACCAGCTTTGGCTGGCTGTGG - Intergenic
946664093 2:222031293-222031315 CCAGCACATGTAGCTTCCGGAGG + Intergenic
947916792 2:233837858-233837880 CCACCAGCTTGTGCTCCCTGGGG - Intronic
948735791 2:240004105-240004127 CCACCAGCTGCTGCCTTCTGGGG - Intronic
949058912 2:241945280-241945302 CCACCAGAGGAAGCTTCCTGAGG + Intergenic
1169745072 20:8935301-8935323 TCGCCAGCTGTAGCTTCCGGAGG + Intronic
1170652484 20:18255655-18255677 CCAGCAGCTAAAGCTGCCTGTGG + Intergenic
1172465228 20:35151738-35151760 CCTCTAGCTTTAGCTTCATGTGG + Intergenic
1173037289 20:39424608-39424630 ACACCAGCAGTAGCAGCCTGTGG + Intergenic
1174217134 20:48924697-48924719 CCACCAGCTGTAGCATATTAGGG + Intronic
1175893662 20:62326679-62326701 CCACCAGCTGCAGCTGCCCACGG + Exonic
1175913016 20:62413628-62413650 CCACCAGCTGCAGCCTCAAGAGG - Intronic
1176043101 20:63076453-63076475 CCATGAGCGGAAGCTTCCTGAGG - Intergenic
1177116931 21:17097005-17097027 CCACGAGTGGAAGCTTCCTGAGG + Intergenic
1178474597 21:32926486-32926508 CCACCAGTGGAAGCTTCCTGAGG - Intergenic
1179348592 21:40585082-40585104 CCACAAGTAGAAGCTTCCTGAGG + Intronic
1180247687 21:46559183-46559205 GCAACAGCTGTAGCTATCTGAGG - Intronic
1181003133 22:19997334-19997356 CCTCCAGCAGTGGCTCCCTGTGG - Intronic
1181012039 22:20046977-20046999 CCATCAGTAGAAGCTTCCTGAGG - Intronic
1181019592 22:20092349-20092371 CCACCAGCTCTGTCTTCCTTGGG + Intronic
1181906627 22:26202367-26202389 GCTTCAGCTGTACCTTCCTGTGG - Intronic
1183929364 22:41227295-41227317 CTACCAGCTCCAGCCTCCTGTGG + Exonic
1183934616 22:41255152-41255174 CCCACACCTGTAGCTTCCTGAGG - Intronic
1184292066 22:43502660-43502682 CCACCCGCTGCATCTTCTTGGGG - Exonic
1184887671 22:47356287-47356309 CCACCAGCTGCCACTTTCTGAGG + Intergenic
1185118717 22:48952891-48952913 CCACCTGCTGTAGCTAACGGAGG + Intergenic
1185314608 22:50173625-50173647 CCGCCAGGATTAGCTTCCTGTGG + Intronic
950094133 3:10318560-10318582 ACACCAGCTGTAGCTCCCTTGGG - Intronic
950430179 3:12946232-12946254 CCACCCACTGTAGCTGCCTTGGG + Intronic
950683193 3:14599352-14599374 CCACCAGCAGATTCTTCCTGTGG - Intergenic
950870181 3:16221516-16221538 CCAACAGCTGTAGATTCCCGGGG - Intronic
952598512 3:35048978-35049000 CCAGACGCTGAAGCTTCCTGAGG + Intergenic
952817526 3:37458553-37458575 CCTCCAGCTGCAGCTTTCTTGGG - Intronic
955578079 3:60388031-60388053 CCATGAGCAGAAGCTTCCTGAGG + Intronic
956177938 3:66491156-66491178 CCTCCAGCTGTGGCTACTTGAGG - Intronic
960477298 3:118145128-118145150 GCACCTGCTGTGGCTGCCTGTGG - Intergenic
960490170 3:118307771-118307793 CCACAAGCGGAAGCTTCCTGAGG + Intergenic
962723464 3:138198084-138198106 CCACCAGCCTCAGCCTCCTGAGG - Intronic
967743502 3:193029193-193029215 CCACCTGCTTTAGCTTAGTGCGG + Intergenic
968054408 3:195680536-195680558 GCATCAGCTTTTGCTTCCTGTGG - Intergenic
968101483 3:195968622-195968644 GCATCAGCTTTTGCTTCCTGTGG + Intergenic
969373876 4:6750496-6750518 CCACCTGCAGTGGCTCCCTGGGG - Intergenic
973647803 4:52967674-52967696 GCACCAGCTGTAGTCTCATGAGG - Intronic
974760312 4:66266192-66266214 GCACCTGCTGCAGCTCCCTGCGG + Intergenic
982261388 4:153497103-153497125 CCACCTGCCTCAGCTTCCTGAGG + Intronic
984626156 4:182009708-182009730 GCACCAGCTGTGGCTGCCTGGGG - Intergenic
986295896 5:6438268-6438290 TCACCAGCTGTGGTTGCCTGAGG + Intergenic
986820514 5:11461551-11461573 ACCCCAGCTGAAGCTTGCTGTGG + Intronic
987062499 5:14256140-14256162 CCACAAGTGGAAGCTTCCTGAGG - Intronic
987091187 5:14509076-14509098 CCACCACCTGGGGCTTCCTCTGG + Exonic
988727454 5:33938657-33938679 CTACCAGCTCTAGATTCCTGGGG - Intergenic
990185701 5:53206793-53206815 CCCCCAGCTGCATCTTCCAGCGG + Intergenic
996563869 5:124859165-124859187 CCATCAGCTGTGTTTTCCTGAGG + Intergenic
996587393 5:125105615-125105637 CCTCCTGCCGTAGCCTCCTGAGG + Intergenic
996818018 5:127595075-127595097 CTACGAGCTGTGGCTTCCTTGGG + Intergenic
997336789 5:133114292-133114314 CCACCAGCTGCCCATTCCTGGGG - Intergenic
998197895 5:140091641-140091663 TCACCTGCTGTGGCTTTCTGAGG + Intergenic
1001267211 5:170282484-170282506 CCACCAGCTGTAGGACCTTGGGG - Intronic
1003377429 6:5592875-5592897 CCACCAGCTGTGACTTCAAGAGG - Intronic
1003443782 6:6166659-6166681 CCCACAGCTGTAGCTTCTGGGGG - Intronic
1006426295 6:33965130-33965152 ACACCAGCTGTCCCCTCCTGGGG - Intergenic
1007713259 6:43838282-43838304 CCCTCAGCTGAAGCTTCCAGGGG - Intergenic
1008075025 6:47136741-47136763 CCACCGTTTGTTGCTTCCTGGGG - Intergenic
1009396217 6:63203590-63203612 TCAGCAGCTGTACCATCCTGGGG + Intergenic
1009785293 6:68329831-68329853 TCAACAGCTGAAGCTTACTGGGG - Intergenic
1011090248 6:83589753-83589775 CTACCTGCTTTAGCTTCCTGAGG + Intronic
1013480697 6:110550450-110550472 CCACCGCCTGTGGCCTCCTGTGG + Intergenic
1014195803 6:118556949-118556971 CCACAAGCTATTGCTGCCTGTGG - Intronic
1017886773 6:158606289-158606311 CCACAACCTGCAGCTCCCTGTGG - Intronic
1019225508 6:170504351-170504373 CCAGCTTCTGTGGCTTCCTGTGG - Intergenic
1019426990 7:982613-982635 CCACCACCTGCATCTCCCTGAGG - Intergenic
1020146365 7:5647028-5647050 GTACCAGCTGCAGCTGCCTGAGG - Intronic
1020279033 7:6640883-6640905 CCACGAGTGGAAGCTTCCTGAGG + Intronic
1022788652 7:33664527-33664549 CCAGCAGCATTTGCTTCCTGGGG + Intergenic
1023840308 7:44093405-44093427 CCACGAGTGGAAGCTTCCTGAGG + Intergenic
1024010959 7:45266403-45266425 CCCCCTGCAGTAGCTTCCTAGGG + Intergenic
1026362361 7:69614460-69614482 CCTCCTGCTGCAGCCTCCTGAGG + Intronic
1027974244 7:85128998-85129020 CCACCTGCCTTGGCTTCCTGAGG + Intronic
1028087504 7:86654209-86654231 CCACCAGCTTTACCTCCCAGGGG + Intronic
1030564608 7:111137931-111137953 CCTCCAGCCTCAGCTTCCTGAGG + Intronic
1034204624 7:149304780-149304802 GAACCAGCTGCAGCTTCCTTCGG + Intergenic
1035287999 7:157818588-157818610 CCCCCAGCTGGTGCCTCCTGTGG + Intronic
1036222072 8:6929470-6929492 CCCCCACCTGTAGCTTCCCCAGG - Intergenic
1037977328 8:23222941-23222963 CCACCAGTGGAAGTTTCCTGAGG + Intronic
1039476827 8:37843198-37843220 ACACCACCTGCAGCTTTCTGGGG - Exonic
1039825874 8:41173744-41173766 CCACTAGCAAAAGCTTCCTGAGG - Intergenic
1041530336 8:58858542-58858564 TCACCAGCTGCTGCTTTCTGTGG + Intronic
1042197043 8:66239650-66239672 CCAACAGCAGTAGCTTCATCTGG + Intergenic
1043439644 8:80265889-80265911 CCCCCAGCTGCATCTTCCGGTGG - Intergenic
1044899915 8:96933413-96933435 TCATCAGCAGTAGCTTCTTGTGG + Intronic
1046876829 8:119264160-119264182 CCACCATCAGCAGCTGCCTGTGG - Intergenic
1047610661 8:126517699-126517721 CCATCCCCTGTAGCTTCCTAAGG + Intergenic
1048337872 8:133516303-133516325 CCACAACTTGAAGCTTCCTGAGG + Intronic
1048475158 8:134736239-134736261 CCACCTGCAGTAGGTTGCTGGGG - Intergenic
1049176491 8:141195758-141195780 CCACAAGCTGAAGATACCTGAGG - Exonic
1053050772 9:34958777-34958799 CCACCACCTCGAGGTTCCTGCGG - Intronic
1055367621 9:75562259-75562281 CCACGAGTGGAAGCTTCCTGAGG - Intergenic
1056846778 9:90045121-90045143 CCACAGGCTGCAGCTTCCTAGGG + Intergenic
1057385697 9:94604341-94604363 CATCCAGCTGTAGCTGCCTCGGG - Intronic
1059148190 9:111921145-111921167 CCACCAGCCTTGGCTTCCTGAGG + Intronic
1059437556 9:114285699-114285721 GCACCTTCTGTGGCTTCCTGTGG - Intronic
1059489828 9:114657891-114657913 TGACCTGCTGTAGCTCCCTGTGG + Intergenic
1059936424 9:119315932-119315954 CCAGCAGAGGTTGCTTCCTGAGG + Intronic
1060652675 9:125342893-125342915 CCCCCAGCTGTATTTTCCTTGGG - Intronic
1062304145 9:135893059-135893081 CCTCCAGCTGCAGCTTCTTGAGG - Intronic
1185479329 X:434364-434386 CCAGCACCTGTTGTTTCCTGGGG - Intergenic
1185501652 X:601262-601284 ACAGCAGCTGTAACTTACTGAGG + Intergenic
1189996976 X:46648212-46648234 CCCCCAGCTCTAACTTTCTGTGG - Intronic
1191897391 X:66007491-66007513 CCACCATGGGAAGCTTCCTGAGG + Intergenic
1192102932 X:68284405-68284427 CCACCACTGGAAGCTTCCTGAGG + Intronic
1195900168 X:109789362-109789384 CCACCAGCTGCAGCCTCCCAAGG + Intergenic
1198141387 X:133807314-133807336 CCACCAGTGGAAGCTTCCTGAGG + Intronic
1201487040 Y:14505693-14505715 GCACCAGCTGAAGTTTCCGGTGG + Intergenic