ID: 1111897788

View in Genome Browser
Species Human (GRCh38)
Location 13:94162492-94162514
Sequence CTGGGGCTTGAGTGTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111897781_1111897788 1 Left 1111897781 13:94162468-94162490 CCAGCCCTGTGACACACTCAGTG 0: 1
1: 1
2: 1
3: 19
4: 250
Right 1111897788 13:94162492-94162514 CTGGGGCTTGAGTGTGTTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 250
1111897780_1111897788 2 Left 1111897780 13:94162467-94162489 CCCAGCCCTGTGACACACTCAGT 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1111897788 13:94162492-94162514 CTGGGGCTTGAGTGTGTTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 250
1111897784_1111897788 -4 Left 1111897784 13:94162473-94162495 CCTGTGACACACTCAGTGGCTGG 0: 1
1: 1
2: 4
3: 12
4: 177
Right 1111897788 13:94162492-94162514 CTGGGGCTTGAGTGTGTTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 250
1111897783_1111897788 -3 Left 1111897783 13:94162472-94162494 CCCTGTGACACACTCAGTGGCTG 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1111897788 13:94162492-94162514 CTGGGGCTTGAGTGTGTTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111897788 Original CRISPR CTGGGGCTTGAGTGTGTTGT TGG Intronic
901902343 1:12375858-12375880 ATGGGGCTTGTGTGTGTGGTGGG - Intronic
902765845 1:18614536-18614558 CTGGGGCGGGAATGTGTTGGTGG - Intergenic
903399517 1:23030573-23030595 GTGGGGCTTGAGGGGGTGGTGGG - Exonic
904882514 1:33711709-33711731 CATGGGCTTGGGTGTGTTTTTGG + Intronic
906077527 1:43063032-43063054 CTGGGGTCTGTGTGTGTTCTGGG + Intergenic
906870580 1:49475556-49475578 CCAGGGCTTGTGTTTGTTGTAGG + Intronic
908133503 1:61101625-61101647 CTGGGACTTGGCTGTGTTTTAGG - Intronic
911374968 1:97041310-97041332 CTGTGGTTTGAGAGTGTGGTTGG + Intergenic
914899285 1:151703350-151703372 CTGGGCCTTGACTGGGTTCTGGG - Exonic
915840934 1:159212418-159212440 CTGGGGCTTGAGGGAGATGATGG - Intergenic
916032273 1:160887793-160887815 GTGGGGCTGGAGTGAGTTGGTGG - Intergenic
916248769 1:162715245-162715267 ATGGAGCTTGTGTGTGTTGGGGG + Intronic
917055661 1:170978532-170978554 TTGTGGCTGGAGTGTGTTGGAGG + Intronic
918092237 1:181307597-181307619 CCGGGCCATGACTGTGTTGTAGG + Intergenic
918620002 1:186592346-186592368 CTGTGGTCTGAGTGTGTGGTTGG - Intergenic
918852594 1:189711151-189711173 CTGTGGATTGAGGGTGATGTTGG - Intergenic
920204818 1:204283773-204283795 CTGGGGACTGTGTGTGATGTGGG + Intronic
920298324 1:204973476-204973498 CTGGGGCTTGGTTATGTCGTGGG + Intronic
921973473 1:221176074-221176096 CTTGTGCTTGAGTGTGTAGCAGG - Intergenic
923807416 1:237273010-237273032 CCGGGGCTGGAGGGTGTTTTGGG + Intronic
923873636 1:238023195-238023217 CTGGGCCTGGAGTTTGTTTTAGG - Intergenic
924091538 1:240506925-240506947 CTTGGGCTTTAGCGTGTTGAAGG + Intronic
924527027 1:244862730-244862752 ATGGGGCTCGTGTGTGTTTTAGG - Exonic
1062971652 10:1653398-1653420 CTGGGGTTTGAGGCTGCTGTAGG + Intronic
1063958139 10:11284305-11284327 CTGAGGGATGAGTGTGTGGTGGG + Intronic
1066065658 10:31759578-31759600 CTGGGGGATGGGTGTGTTGGGGG + Intergenic
1066783743 10:38979661-38979683 CTGGGGCTGGGCTGTGATGTGGG + Intergenic
1068087227 10:52389387-52389409 ATGGGGCTTGTGAATGTTGTTGG + Intergenic
1068463018 10:57351442-57351464 CTTGGGCTAAAGTGTCTTGTGGG + Intergenic
1070164378 10:73886888-73886910 CTGGGGCTGGAGTGGGTGCTGGG + Intergenic
1070593033 10:77813625-77813647 CTGGGGCAGGAGGGTGATGTAGG - Intronic
1071704896 10:87987437-87987459 CTAGAGCTTCAGTGAGTTGTGGG + Intergenic
1071836338 10:89421821-89421843 CTTGGGCCTGCCTGTGTTGTAGG - Intergenic
1073117547 10:101100247-101100269 CTGGGGCCTGAGCATGTTGTGGG - Intronic
1076781282 10:132726045-132726067 TTGGGGTTTGAGTGAGTTGGCGG + Intronic
1076853234 10:133103181-133103203 CTGGGGCTGGCGTGTGTTGGGGG + Intronic
1078187897 11:9068055-9068077 CTGTTGCTTGAGTGTGATGGTGG + Intronic
1078194024 11:9119781-9119803 CGGGGGCATGAGAGGGTTGTAGG + Intronic
1080117735 11:28639297-28639319 CTGAGGCTTGAGTAGGTGGTTGG + Intergenic
1080958937 11:37135197-37135219 CTGGGGGTTAAGAGTGTGGTTGG - Intergenic
1081227187 11:40538286-40538308 CTGGGGCCTGTGTGGGTTGGGGG - Intronic
1083514453 11:63243564-63243586 CTGAGGCTTGATGGAGTTGTCGG - Intronic
1084004377 11:66315317-66315339 CTGGGGCTTGAGGGGGTAGCTGG + Exonic
1084302741 11:68262009-68262031 ATGGGGCTTGGCTGTGTCGTGGG + Exonic
1084619204 11:70257270-70257292 TTGAGTCTTGACTGTGTTGTTGG + Intergenic
1091207436 11:133831415-133831437 CTGGGGCATGAGTGGGGGGTGGG + Intergenic
1091916900 12:4276189-4276211 CTGAGGCTTGATGGAGTTGTCGG - Exonic
1092029521 12:5272590-5272612 CTGCTGCTGGAGTGTGTTCTCGG + Intergenic
1092465617 12:8729096-8729118 TTGGGGCTTTAGAGGGTTGTGGG - Intronic
1092766726 12:11859834-11859856 CTGGGGCTACAGTGTGTGGCAGG + Intronic
1098597582 12:72292674-72292696 CTGGGGCTTGAGGAGGCTGTTGG - Intronic
1098774348 12:74592566-74592588 CTGGGTCTTGATTGTCTTGATGG - Intergenic
1099917714 12:88915724-88915746 CTGAGGCATGAGTGAGGTGTGGG - Intergenic
1101075789 12:101128296-101128318 CAGGGTCTTGTCTGTGTTGTTGG - Intronic
1101442774 12:104715815-104715837 CTGGGGCTGCAGGCTGTTGTTGG + Intronic
1102959531 12:117083725-117083747 CAGGGGCTGGAGGGTGTTGAGGG + Intronic
1103164473 12:118758254-118758276 CAGGACCTTGAGTGTGTTGAGGG - Intergenic
1103961036 12:124609530-124609552 GTGGGGCTTGATTGTATTCTCGG - Intergenic
1104551600 12:129762095-129762117 CAGGGGCTTAAGTGTGCAGTTGG - Intronic
1106646401 13:31638861-31638883 CTGGGGATTTAGTGTCTTCTTGG - Intergenic
1108172635 13:47758367-47758389 CTGGGACGTGACTGTGTTCTTGG - Intergenic
1111897788 13:94162492-94162514 CTGGGGCTTGAGTGTGTTGTTGG + Intronic
1113607576 13:111621450-111621472 GTGGGGCTTGTGTGTGTGGTAGG + Intronic
1117912685 14:60649634-60649656 CTGGGGGTTGGGGGTGTTGCCGG + Intronic
1117943375 14:60992619-60992641 CTGGGGACTGAGTGTGAGGTGGG + Intronic
1119453497 14:74733649-74733671 TTGGGGCTTGGGTGTGCTCTGGG - Intronic
1121891646 14:97598962-97598984 CTGGGCCTGGACTGTTTTGTAGG - Intergenic
1122037582 14:98960162-98960184 CTGGGGCAGGAGTGGGGTGTAGG - Intergenic
1122104331 14:99440754-99440776 AAGGGGCTTGACAGTGTTGTGGG + Intronic
1122265886 14:100546599-100546621 CTCGAGCTTGTGTGTGGTGTAGG + Exonic
1123150602 14:106177996-106178018 CTGGGGCTGGAGCCTGTTCTGGG + Intergenic
1123202720 14:106681717-106681739 CTGGGGCTGGAGCCTGTTCTGGG + Intergenic
1125522001 15:40353513-40353535 CTGGGCCTTGAGTGTGCGGTGGG - Intronic
1127294005 15:57593873-57593895 CTGGGGATTGTGTGTGTGGTGGG + Intronic
1127667827 15:61166287-61166309 CTGGTGCTTGGGCATGTTGTAGG - Intronic
1129239652 15:74243978-74244000 CTGGGTCTTCAGTGTTCTGTGGG - Exonic
1129599803 15:76992130-76992152 ATGGGGCTTGAGTGGATTGGTGG - Intergenic
1129999754 15:80036312-80036334 CTGGGCCTCTAGTGTGTTGCAGG + Intergenic
1130977404 15:88788097-88788119 GTTGGGCTGGAGTGAGTTGTGGG - Intergenic
1133197050 16:4178473-4178495 CCGGGGCTCGAGTGTGTGGAAGG - Intergenic
1133285918 16:4690760-4690782 CAGGGGGCTGTGTGTGTTGTTGG - Exonic
1134104552 16:11476476-11476498 GTGAGGAGTGAGTGTGTTGTGGG - Intronic
1134689428 16:16181537-16181559 CTGGGGCCAGAGTGTGCTGTGGG + Intronic
1135612459 16:23880314-23880336 GTGGGCCTTGTGTGTGTGGTGGG - Intronic
1136713162 16:32256897-32256919 CTTGGTCTTGAGGGTGTTGCTGG + Intergenic
1136754750 16:32672530-32672552 CTTGGTCTTGAGGGTGTTGCTGG - Intergenic
1136813362 16:33197834-33197856 CTTGGTCTTGAGGGTGTTGCTGG + Intronic
1136819838 16:33307914-33307936 CTTGGTCTTGAGGGTGTTGCTGG + Intergenic
1136826402 16:33364454-33364476 CTTGGTCTTGAGGGTGTTGCTGG + Intergenic
1136831468 16:33463225-33463247 CTTGGTCTTGAGGGTGTTGCTGG + Intergenic
1137022274 16:35440550-35440572 CTTGGCCTTCAGTGTGTTGATGG - Intergenic
1137024379 16:35457835-35457857 CTTGGTCTTGAGGGTGTTGCTGG - Intergenic
1137028844 16:35503355-35503377 CTTGGTCTTGAGTGTGTTGCTGG - Intergenic
1137575192 16:49594954-49594976 CTGGGCCTTGTCTGTGTTTTGGG - Intronic
1137983801 16:53091157-53091179 CTGGGGGTTCAGAGTGTTCTTGG + Intronic
1139970473 16:70771075-70771097 CTGGGGCTAGAGTGGATGGTGGG - Intronic
1140213229 16:72987083-72987105 CTGAGGCTGCAGTGAGTTGTGGG + Intronic
1141484678 16:84330790-84330812 CTGGAGCCTGAGTGTGGGGTGGG - Intergenic
1141990853 16:87608716-87608738 CTGGTGGTTGAGTGTGCTGGAGG - Intronic
1142017260 16:87756477-87756499 CTGCCGCTTGTGTGTCTTGTAGG - Exonic
1142125633 16:88408980-88409002 CTGGGGCTTGTGTGGGCTGAAGG + Intergenic
1202991939 16_KI270728v1_random:20809-20831 CTTGGTCTTGAGGGTGTTGCTGG + Intergenic
1203056894 16_KI270728v1_random:932865-932887 CTTGGTCTTGAGGGTGTTGCTGG - Intergenic
1144475148 17:15581355-15581377 CTGGGCCATGAGTATGTTGAGGG - Intronic
1145739980 17:27265575-27265597 CTGGGGCTTGAACATGTTGGTGG - Intergenic
1146070261 17:29674463-29674485 CTAGGCCTTGAGTGTATTTTAGG - Intronic
1146732732 17:35208901-35208923 CTGATGTTTGAGTGTGTTGTGGG - Intergenic
1147383326 17:40068438-40068460 CTGGGGCTGGTGTGTGGTGGGGG + Intronic
1148329263 17:46803705-46803727 CTGGAGCTTGAGGGTGTGGCTGG - Intronic
1148875597 17:50685046-50685068 CTGGGGCTTGTGTGAGGAGTCGG - Intronic
1149015057 17:51899404-51899426 CTGGGGTATGAGAGTGTGGTTGG + Intronic
1149652508 17:58284837-58284859 GTGGGGTGTGAGTGTGTTGGAGG - Intergenic
1151965553 17:77429437-77429459 CTGAGGGCTGATTGTGTTGTGGG + Intronic
1152579465 17:81159741-81159763 CTGTGGCTTGAGGCCGTTGTGGG - Intronic
1155450595 18:25959079-25959101 CTGGGGCTGGAGTCTTCTGTAGG + Intergenic
1155642915 18:28041465-28041487 GTGAGGCTTGAGTGTGATTTCGG - Intronic
1155916291 18:31560729-31560751 CTGTTGGTTGAGTGTGTGGTAGG - Intergenic
1156288798 18:35726143-35726165 CTGTGGTCTGAGTGTGTGGTTGG - Intergenic
1157980318 18:52372278-52372300 CTGGGGATTGGTTGTGTAGTTGG + Intronic
1159119781 18:64155087-64155109 CTGGGGGTTGGGTGTTATGTGGG + Intergenic
1159454934 18:68649354-68649376 CTTGAGCTTGAGTGTGATGAAGG + Intergenic
1159574557 18:70159229-70159251 CTGTGGCCTGAGAGTGTGGTTGG - Intronic
1159964228 18:74579999-74580021 CTGGGGCTTCAGTTTCTTGATGG + Intronic
1161034928 19:2079267-2079289 GTGGGGCTTGAGTGTGGGGCAGG + Intronic
1161144680 19:2670654-2670676 CTGGGGCTGGAGTGTTCTCTCGG + Intronic
1162198152 19:9001725-9001747 GGGGTGCTGGAGTGTGTTGTGGG - Intergenic
1162373048 19:10290279-10290301 CTGGGGCTCGGGTGTGTGTTGGG - Intronic
1162848024 19:13408855-13408877 GTGAGGCTCGATTGTGTTGTAGG + Intronic
1163294962 19:16406005-16406027 CTGGGGCCTGAGTGAGGTGGTGG + Intronic
1163692958 19:18746985-18747007 CTGGGCTGAGAGTGTGTTGTTGG + Intronic
1166758881 19:45212340-45212362 CTGAGTCCTGAGTGTGTTGTGGG - Intronic
1168036406 19:53723065-53723087 ATGGGGCTTCAGTGTGTATTGGG + Intergenic
1168308343 19:55448556-55448578 GTGTGGCGTGTGTGTGTTGTGGG - Intergenic
1168697524 19:58412774-58412796 CTTGGGGTTGTGTGTGTTTTGGG + Intronic
925305822 2:2847385-2847407 CTGGGGCCTGAGGGTGTGGGCGG + Intergenic
925731139 2:6920013-6920035 CTGGGGATTCAGTGTGGTTTGGG + Intronic
927878586 2:26674952-26674974 CTGGGGCTTGTGTGTCTGGCTGG + Intergenic
928765763 2:34643564-34643586 GTGGGGATTGAGAGTGTTCTAGG + Intergenic
929319566 2:40526351-40526373 CTGGGGCATGAGATGGTTGTAGG + Intronic
932466614 2:71928228-71928250 CTGAGGCATCAGTGTGTAGTTGG - Intergenic
933488793 2:82958256-82958278 CTGGGTCTTGTGTGTGTTTCAGG + Intergenic
934650769 2:96090142-96090164 CAGGGGCTCGAGTGTGCTCTGGG + Intergenic
934884174 2:98010096-98010118 CTGGGTCTTGATTGTGGTGGTGG - Intergenic
935795791 2:106640540-106640562 CAGGGGCTTTCGTGTGTTGTAGG - Intergenic
936114433 2:109690766-109690788 CTGGGGGTGGGGTGTGTTGGGGG + Intergenic
936772761 2:115934882-115934904 CGGGAGCTTGAGTGTTTTGGTGG + Intergenic
941304196 2:163841207-163841229 CTGGTTCTTGGGTGTGGTGTGGG + Intergenic
943904337 2:193478425-193478447 CTGGGGCTTGAGGTTGGGGTGGG + Intergenic
944754212 2:202742999-202743021 CTGGGCATTGTGTGTGGTGTTGG - Intronic
945261544 2:207848352-207848374 CTGGGGCTTGATGGTTTTTTTGG + Intronic
945974887 2:216262653-216262675 TTGGGGCTGGAGTGTGCTGGAGG + Intronic
946194371 2:218024329-218024351 CAGGGACATGAGTGTGTTGGAGG - Intergenic
946788142 2:223269980-223270002 CTTGGTGTTGACTGTGTTGTAGG - Intergenic
946861107 2:224001199-224001221 CTGGGTCTTGATTGTGGTGGTGG - Intronic
947444670 2:230154847-230154869 CTGGGGATTGAGTGCCTTGTGGG - Intergenic
948182762 2:235995777-235995799 CTGTGGCCTGAGTGTGGTGATGG + Intronic
948375860 2:237519812-237519834 CTGGGGGCTGAGTGTGGGGTTGG + Intronic
1171239923 20:23558022-23558044 CTGTGGTTTGAGAGTGTGGTTGG + Intergenic
1172166391 20:32902302-32902324 CTGGAGCTGGGCTGTGTTGTGGG + Intronic
1173073943 20:39798050-39798072 CTGAGGCCTGAGTTTGTTATTGG - Intergenic
1173960986 20:47072329-47072351 ATGGGGATTGTGTGTGTCGTGGG - Intronic
1175382825 20:58575517-58575539 CTGGGGCAAGAGTGAGTTTTGGG + Intergenic
1175879554 20:62249277-62249299 CTGGGGCCTGAGTCTGTGCTGGG - Intronic
1176030170 20:63007844-63007866 CTGAGGCTAGAGTGTGCTGAGGG + Intergenic
1176745704 21:10650473-10650495 CTGGGGCTGGAGCCTGTTCTGGG + Intergenic
1181177049 22:21043846-21043868 CTTGAGCTTGAGAGTGGTGTGGG - Intergenic
1182006957 22:26968945-26968967 CTTGGGCATGCCTGTGTTGTGGG + Intergenic
1183343924 22:37296512-37296534 CAGGGGCTTGGGAGTGGTGTGGG - Intronic
1183437994 22:37806399-37806421 GGGGGGCTTGTGTGTTTTGTTGG + Exonic
1183493599 22:38129415-38129437 CTGGGGCTGGAGTGGGGTGAGGG - Intronic
1184195369 22:42924122-42924144 CTGGGGCCTGGGGGTCTTGTGGG - Intronic
1184521222 22:44995394-44995416 CTGGGGCTGGAGTGTGTGGGGGG + Intronic
1185269421 22:49922188-49922210 CTCGGACGTGAGTGTGTGGTTGG + Intronic
950181921 3:10919465-10919487 CTGGGGCTTGAGAGGGAGGTGGG - Intronic
950534768 3:13572408-13572430 CTGGGGCTCGAGGGTGGTGCTGG + Intronic
954580894 3:51702439-51702461 CTGGGGGCTGAGTGGGTGGTGGG + Intronic
955204272 3:56881424-56881446 CTGGGGCTTGGGGGTGGAGTAGG - Intronic
956891660 3:73620100-73620122 CTTGGGTGTGGGTGTGTTGTTGG - Intronic
959028486 3:101270359-101270381 CTGGGTGTTGAGTGTGTTTGTGG - Intronic
959817539 3:110692575-110692597 CTGGGGGTTGAGGTTGTGGTGGG - Intergenic
961538054 3:127581959-127581981 CTGGGCCTTTGATGTGTTGTCGG - Intronic
962373190 3:134838100-134838122 ATGGGGCATGAGTGTGTTGGGGG - Intronic
963023850 3:140899478-140899500 CTAGGGCTTGTGTGTGCTGAGGG - Intergenic
965567197 3:170132577-170132599 CATGGCCTTGAGTGTGTGGTGGG - Intronic
967093290 3:186153631-186153653 CTGGGGATTGACTTTGTTGGGGG + Intronic
967195911 3:187025540-187025562 CTGGGGCTGGGGTGTGTAGTGGG + Intronic
967971255 3:195001351-195001373 AAGGGGCATGAGTGTGATGTGGG + Intergenic
970661706 4:18292742-18292764 ATGGGGGTTGGGTATGTTGTTGG + Intergenic
971125626 4:23750890-23750912 AGAGGGCTTGATTGTGTTGTAGG + Intergenic
971461635 4:26904984-26905006 ATGGTGGTTGAGTGGGTTGTGGG + Intronic
975660774 4:76687011-76687033 CTGGTGCTGGAGTGTGTTGTGGG - Intronic
977845141 4:101759222-101759244 AGGTGGCTTGAGGGTGTTGTGGG - Intronic
978232367 4:106415523-106415545 CTAGGGCTGGAGTGGGTTGGTGG + Intergenic
978269189 4:106868349-106868371 CTGGGGATTGAGCGGGTTTTAGG + Intergenic
981514066 4:145588072-145588094 CTGGGGATTGAGGCTGTTGTTGG - Intergenic
982122810 4:152158727-152158749 CTCGGGCTTGAGAGTGCTGAAGG + Intergenic
982771408 4:159400522-159400544 CTGGGGCTTGAGTGTGGTTGGGG + Intergenic
983853320 4:172610539-172610561 CTGTGGCTTGAGAGTGTGCTTGG + Intronic
985648076 5:1094528-1094550 CTGGAGCTAGCGTGTGTTCTGGG - Intronic
985717820 5:1472432-1472454 CTGGGGCTTGGGTGTCTGGCAGG + Intronic
987414650 5:17649913-17649935 ATGGGCCTTGAGTTTTTTGTGGG + Intergenic
987962249 5:24824871-24824893 CTGGGGCTTCACTGTTTTATTGG + Intergenic
990369920 5:55107261-55107283 CTTGGCATTGAGTGTGTTGAAGG - Intronic
990642418 5:57802206-57802228 CTGTGGTTTGAGTGTGTGCTTGG + Intergenic
991098940 5:62770589-62770611 CTGGGGCCTGTGCGTGTTGGGGG + Intergenic
991314104 5:65280100-65280122 CTGGGGCTTCAGTTTCTTATGGG + Intronic
992270872 5:75061667-75061689 CTGGGGTTAGAGTGTGTTCAGGG + Intergenic
995664090 5:114521850-114521872 CTGCAGGTTGAGTGTGTTGCAGG + Intergenic
997263784 5:132483234-132483256 CTGGGGCTTGAGGGGGTGGTGGG + Exonic
998003374 5:138641582-138641604 CAGGGCTATGAGTGTGTTGTCGG - Intronic
999185415 5:149703709-149703731 CTGGTGCTTGAATATGCTGTGGG + Intergenic
999315621 5:150582235-150582257 GTGGGGCTTGAGTGTGCAGACGG + Intergenic
1000442373 5:161279277-161279299 CTGGGACTTCAGTGTGTGGGTGG - Intergenic
1000552185 5:162680736-162680758 CTGGGACTTGAGTAAGTTGAAGG + Intergenic
1001507130 5:172288492-172288514 CTGGGTATTGTGTGTGTTGGCGG - Intergenic
1001542700 5:172550553-172550575 CAGGGGCTCTACTGTGTTGTCGG - Intergenic
1001679926 5:173548959-173548981 GTGGGGTGTGTGTGTGTTGTGGG + Intergenic
1001809621 5:174617914-174617936 CTGGGTCTTGAGTATGTGGGTGG + Intergenic
1002644139 5:180645010-180645032 CTGGGGCTGGTGTGTGCAGTGGG + Intronic
1002864378 6:1108051-1108073 CTGGGGCCTGAGACTCTTGTGGG + Intergenic
1003841769 6:10127952-10127974 CTGGGGCTTCAGTTTGTTGATGG - Intronic
1003930657 6:10921038-10921060 CTGGGGCCTGGGTATGTTGGGGG - Intronic
1004426696 6:15511616-15511638 TTGGGGCTTGTTTGTGTTGTGGG + Intronic
1004760648 6:18662349-18662371 CCAGGGCCTGAGGGTGTTGTGGG + Intergenic
1007165642 6:39827207-39827229 CTGTGGCATGAGTTTGCTGTGGG + Intronic
1007230516 6:40344825-40344847 CTGGGGTCTGAGTGGGTTCTGGG - Intergenic
1007663749 6:43502437-43502459 CTGGGGCTTGAGGGAGATGGTGG + Intronic
1007838916 6:44699544-44699566 GTGAGGCTGGAGTGTGATGTGGG - Intergenic
1010034879 6:71313448-71313470 CCTGAGCTTGAGTGTTTTGTAGG + Intergenic
1016400215 6:143672139-143672161 CTGACACTTGAGTGTGCTGTTGG + Intronic
1016986315 6:149898294-149898316 CTGGGACTTGAGTCTGGTCTTGG - Intergenic
1017038527 6:150288718-150288740 CTGGGACTTGACTCTGTTGGTGG + Intergenic
1018549989 6:164984839-164984861 CAGGGGCTTGGGGGTGTTGGGGG - Intergenic
1018792290 6:167157749-167157771 CTGGGGCTGGAGTGTGGGCTGGG - Exonic
1019281565 7:202963-202985 CTGGGGTTTGATTGTGCTGTTGG + Intronic
1026600408 7:71772999-71773021 CTGGGGCTACTGGGTGTTGTTGG + Intergenic
1027892751 7:83997371-83997393 CTATGGCTTTAATGTGTTGTGGG + Intronic
1029118513 7:98251118-98251140 CTGGGACTTGTTTGTTTTGTAGG + Intronic
1031171298 7:118295298-118295320 CTAGGCATTGAGTGTGTTTTTGG + Intergenic
1031171627 7:118298987-118299009 CTGGGGCTTGAGATTCTGGTTGG + Intergenic
1031239553 7:119219910-119219932 CTGGGGCCTGAGTCTGTTGGGGG + Intergenic
1031909989 7:127505880-127505902 CTGGGGCTTGACTCTGATGTTGG - Intergenic
1032803065 7:135331946-135331968 CTGTGGCTTGGGTGGTTTGTTGG - Intergenic
1034725334 7:153330591-153330613 CTGGGGCTTGTGTGTGTGTTGGG + Intergenic
1034949247 7:155285901-155285923 ATGGGGCATGAGTGTTTGGTGGG - Intergenic
1039640926 8:39219790-39219812 CTGTGGCTTGAGTGTATGGTTGG + Intronic
1040329779 8:46379930-46379952 ATGGGGCTGCAGGGTGTTGTGGG + Intergenic
1040338994 8:46430413-46430435 ACGGGGCTTCAGTGTGGTGTGGG + Intergenic
1041327990 8:56689443-56689465 ATGGGGGTTGAGTGTGTGCTAGG + Intergenic
1041988364 8:63954420-63954442 CTGGGGCTCCAGGGTGTCGTGGG - Intergenic
1043679472 8:83004060-83004082 CTGGGGCTTGTGTGACTTGCTGG - Intergenic
1044768236 8:95600065-95600087 CTGTGGCCTGAGAGTGTGGTTGG - Intergenic
1045656982 8:104397459-104397481 CTGGGACATGACTGTGTTTTGGG + Intronic
1048497689 8:134948685-134948707 CTTGGGCTTGAGTGATTTGGGGG - Intergenic
1049081538 8:140446962-140446984 CTGGAGCTGGAGTGTGCTGGTGG - Intronic
1049614474 8:143570132-143570154 CAGGGGCATGAGGGTGGTGTTGG - Intronic
1050703562 9:8368756-8368778 CTGGGTCTTCAGTCTGTTGATGG - Intronic
1050972650 9:11896521-11896543 CTGTGGTTTGAGAGTGTAGTTGG + Intergenic
1051198948 9:14596465-14596487 ATGCTGCTTGTGTGTGTTGTTGG + Intergenic
1051313023 9:15796854-15796876 CTGGTGCTTGAGTCTGCTATAGG - Intronic
1055497161 9:76867184-76867206 CGGGGGGTTGATGGTGTTGTGGG - Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056931797 9:90883771-90883793 CTGGGGAGTGGGTGTGATGTGGG - Intronic
1057020695 9:91695206-91695228 CTGTAGCTTGAATGTGGTGTTGG - Intronic
1057161015 9:92888231-92888253 CTGGGGCTTGAAACTGCTGTTGG - Intergenic
1058748589 9:108016614-108016636 CTGGGGCATGAGAGTGTGGAAGG + Intergenic
1059466604 9:114472619-114472641 CTGACGCTCTAGTGTGTTGTGGG - Intronic
1062058061 9:134479076-134479098 CGGGGGCCTGAGTGTGTTTTGGG + Intergenic
1062221410 9:135418061-135418083 CAGGTGATTGAGTGTGTTGGTGG + Intergenic
1062245234 9:135562651-135562673 CTGGGGCTGCACTGTGTGGTTGG - Intronic
1189316521 X:40060910-40060932 CTGGGGCATGATTGTGTGGGTGG - Intronic
1190026026 X:46923938-46923960 CTGGGTCTTGAGTGTGTCCTTGG + Intronic
1191720054 X:64221889-64221911 CTTGGCCTTTAGTGTCTTGTTGG - Intergenic
1195814915 X:108874176-108874198 CTGTAGCTTGAGTATGTGGTAGG - Intergenic
1196018845 X:110967905-110967927 CTGTATCTTGACTGTGTTGTTGG - Intronic
1199461847 X:148093849-148093871 CTGGGGCATGTGTGTCTTGCAGG - Intergenic
1200165587 X:154032978-154033000 CCGGGCCTTGGGTGTGTTTTTGG + Intronic
1200362243 X:155620734-155620756 CTGTATCTTGATTGTGTTGTTGG + Intronic
1201623647 Y:15988589-15988611 CTGGGTCATGAGTGTGTTTCAGG - Intergenic