ID: 1111900212

View in Genome Browser
Species Human (GRCh38)
Location 13:94190505-94190527
Sequence GTCCTCAGTGTCCCTCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111900212_1111900215 2 Left 1111900212 13:94190505-94190527 CCAGATTGAGGGACACTGAGGAC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1111900215 13:94190530-94190552 ATGGCAATGAAATGGAATACAGG 0: 1
1: 0
2: 0
3: 29
4: 287
1111900212_1111900216 21 Left 1111900212 13:94190505-94190527 CCAGATTGAGGGACACTGAGGAC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1111900216 13:94190549-94190571 CAGGATCCTAGTCTTCATCCTGG 0: 1
1: 0
2: 0
3: 17
4: 144
1111900212_1111900217 22 Left 1111900212 13:94190505-94190527 CCAGATTGAGGGACACTGAGGAC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1111900217 13:94190550-94190572 AGGATCCTAGTCTTCATCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1111900212_1111900214 -6 Left 1111900212 13:94190505-94190527 CCAGATTGAGGGACACTGAGGAC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1111900214 13:94190522-94190544 GAGGACACATGGCAATGAAATGG 0: 1
1: 0
2: 5
3: 23
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111900212 Original CRISPR GTCCTCAGTGTCCCTCAATC TGG (reversed) Intronic
900824582 1:4916151-4916173 GTCTTCAGGGACCATCAATCTGG + Intergenic
901130554 1:6960295-6960317 GGCCTCATTTTCCCTCCATCTGG - Intronic
903024600 1:20418393-20418415 GTCGTGAGTGTCCTTCCATCAGG - Intergenic
906004000 1:42453620-42453642 GTCCTCTGTATCCCTCCAGCCGG - Intronic
906281880 1:44560027-44560049 GTCCTCAGTGCCCATCAGGCAGG + Intronic
908067283 1:60420547-60420569 GGCCTCAGAGTCCCTCTAACAGG + Intergenic
909831724 1:80200373-80200395 GTCCTCACTGACTCTCAGTCAGG + Intergenic
910146192 1:84083412-84083434 CTCCTCAGTGTCCTTCACTTAGG + Intronic
910157445 1:84234870-84234892 GTCTTCTGTGTCCCTCACGCTGG + Intronic
912639924 1:111335259-111335281 GTCTTCTGTGTCTCTCACTCTGG - Intergenic
912837809 1:113011648-113011670 GTCTTTAGTCTCCTTCAATCTGG - Intergenic
916149687 1:161774849-161774871 CTCATCAGTGTCCTTTAATCTGG + Intronic
916324605 1:163542763-163542785 TTTCTCAGTGTTGCTCAATCTGG + Intergenic
916746588 1:167689450-167689472 GTCCTGCTTGTTCCTCAATCTGG - Intronic
917664491 1:177211453-177211475 CTCTTCAGTGTCCTTCAATCTGG + Intronic
918398161 1:184136687-184136709 GTCTTCTGTGTCTCTCAAGCTGG + Intergenic
920881494 1:209884689-209884711 GTCCTCAGTTTCCTTTAATCAGG - Intergenic
921842071 1:219839380-219839402 GTCTTCTGTGTCGCTCAAGCTGG - Intronic
921998973 1:221454645-221454667 GGCCTCAGTGTCACTGAGTCTGG + Intergenic
922784754 1:228277366-228277388 GTCCTCCGTGTCCCCCAGCCAGG + Intronic
923338843 1:232991252-232991274 GTCCCCAGTGTCCCTCTCCCAGG - Intronic
1063618794 10:7625968-7625990 ATCCTCAGTGTTCCGCAAGCTGG - Intronic
1063647445 10:7899203-7899225 GTGCGCAGTCTCCCTCGATCTGG + Intronic
1070434323 10:76373886-76373908 GTACTCAGAGTCCCACATTCTGG + Intronic
1071460216 10:85886664-85886686 ATCCTCTTTGTCCCTCAACCTGG - Intronic
1072412969 10:95221800-95221822 GTCATCTTTGTCCCTCATTCTGG - Intronic
1074616967 10:115079188-115079210 GTCTTCTGTGTCCCTCATGCTGG + Intergenic
1076330945 10:129665804-129665826 CTCTTCAGTCTCCCTCAAGCTGG - Intronic
1078106138 11:8359129-8359151 TTCCTCTGTCTCCCTCAATCTGG - Intergenic
1078166337 11:8889307-8889329 GTCTTCTGTGTCCCTCATGCTGG - Intronic
1078763036 11:14266916-14266938 GTGGTCAGTCTCCCTGAATCTGG - Exonic
1080011294 11:27462157-27462179 GTCCTCAGTGTCACAAAGTCTGG + Intronic
1084056406 11:66636703-66636725 GTTCCCAGTCTCCTTCAATCTGG + Intronic
1086520038 11:87658648-87658670 GTCTTCTGCGTCCCTCAAGCTGG + Intergenic
1087095432 11:94313373-94313395 GTGCTCAGTGCTCCTCCATCAGG - Intergenic
1087568732 11:99896397-99896419 CTCTTCAGTCTCTCTCAATCTGG - Intronic
1087639538 11:100741541-100741563 GTCTTCAGGGTTCTTCAATCTGG - Intronic
1090161468 11:124499760-124499782 CTCCTCAGCTTCCCTCATTCCGG - Intergenic
1091845925 12:3656415-3656437 GTCCTGTGTGTCCCTCTTTCTGG - Intronic
1092299649 12:7234386-7234408 GTCATCTTTGTCCCTCATTCTGG - Intergenic
1094518760 12:31163123-31163145 GTCTTCTGTGTCGCTCAAGCTGG - Intergenic
1094810503 12:34133385-34133407 GTCTTCAGTGTCGCTCATGCTGG - Intergenic
1094838293 12:34332442-34332464 GCCCTCAGTGGGCATCAATCTGG - Intergenic
1095657538 12:44687361-44687383 GTCTTCTGTGTCCCTCACGCTGG + Intronic
1097233958 12:57527513-57527535 GTCCTGAGTGCCCCCCAACCTGG + Exonic
1097774277 12:63628130-63628152 GTCCTCTGTGTCGCTCATGCTGG - Intronic
1100326396 12:93543707-93543729 TTCCTCAGTACCCCTCCATCTGG + Intergenic
1101296991 12:103434437-103434459 GTCCTCTGCGTCCCTCACGCTGG - Intronic
1104578714 12:129992970-129992992 TTCCTCAGTGTTCTTCACTCTGG + Intergenic
1106019239 13:25899107-25899129 GTCTTCTGTGTCGCTCACTCTGG + Intronic
1106133146 13:26955641-26955663 GGCCTCAGGGTCCATCCATCTGG + Intergenic
1107231138 13:38112186-38112208 GTCTTCTGTGTCGCTCACTCTGG - Intergenic
1110273728 13:73619605-73619627 GACCTCAGTGGCACTGAATCAGG + Intergenic
1111900212 13:94190505-94190527 GTCCTCAGTGTCCCTCAATCTGG - Intronic
1113161158 13:107382650-107382672 CTCCTCAGTTTCCTCCAATCTGG + Intronic
1114685344 14:24525997-24526019 GTCTTCTGTGTCGCTCAAGCTGG - Intergenic
1118030617 14:61814015-61814037 GTCCTCAGTTTCTCTAAATTAGG + Intergenic
1119815776 14:77565677-77565699 CTCCTCAGTCTCCTCCAATCTGG - Intronic
1120047899 14:79828806-79828828 GTCTTGAGTCTCTCTCAATCAGG - Intronic
1120281372 14:82442906-82442928 GTCCTGAGTTTCCCTCACTCTGG + Intergenic
1126038357 15:44568167-44568189 GCCCTCAGTGTCTATCCATCTGG - Intronic
1127057088 15:55143226-55143248 GTCTTCTGTGTCGCTCAAGCTGG - Intergenic
1127101659 15:55571968-55571990 TTCCTCTGTGTCCCTCAATAGGG + Intronic
1128200561 15:65802919-65802941 CTCCCCAGTATCCCTGAATCTGG - Intronic
1129739406 15:77982746-77982768 GTCCTCAGGGTCTCAGAATCGGG + Intergenic
1129847787 15:78775965-78775987 GGCCTCAGTGTCCCCCTCTCTGG + Intronic
1132090035 15:98940803-98940825 GTCATCAGAGTTCCTCATTCAGG + Intronic
1132632213 16:923724-923746 CTCATCAGTGGCCCCCAATCTGG + Intronic
1135967295 16:27046733-27046755 TTCCTCAGTGACCTTCAAACTGG + Intergenic
1136295573 16:29299958-29299980 GTCCTCAGGGTCCGTCCATGTGG - Intergenic
1138985035 16:62318148-62318170 CTCCTCAGTCTCCTTCCATCTGG - Intergenic
1141235220 16:82209824-82209846 GTCTTCTGTGTCGCTCACTCTGG + Intergenic
1143234885 17:5391003-5391025 GTCTACAGTGTCCCTCAGGCTGG + Intronic
1143691300 17:8568383-8568405 GTCCTCTGTGATCCTGAATCTGG + Intronic
1144667457 17:17111788-17111810 GTGCCCAGTCTCCCTCAAGCGGG + Intronic
1146475204 17:33157138-33157160 CTCCTCAGTGTCCCTCTCCCTGG + Intronic
1149575576 17:57709795-57709817 CTCATTAGTGACCCTCAATCTGG + Intergenic
1155050304 18:22141037-22141059 CTCCTCAGTCTCCTTTAATCTGG + Intergenic
1161347224 19:3774416-3774438 GTCCTCCATGTCACTAAATCAGG - Intergenic
1164133243 19:22385010-22385032 GTCTTCTGTGTCACTCAAGCTGG + Intergenic
1164587360 19:29484378-29484400 CTCCTCACTGTCCCTGAAGCAGG - Intergenic
1167645607 19:50703529-50703551 GTCCTCAGGGTGCCTCCCTCGGG + Exonic
925095599 2:1197564-1197586 GTTCTCACTGTCACTCAGTCTGG + Intronic
925431717 2:3800324-3800346 GTCTTCTGTGTCACTCACTCTGG + Intronic
926805843 2:16710205-16710227 GGCCTCAGTTCCCCTCAATTTGG - Intergenic
929928391 2:46233395-46233417 TTCCTCTGTTTCCCTCCATCTGG + Intergenic
931670717 2:64644446-64644468 GTCCTCAGCGTCCCGCCCTCAGG - Intronic
933828248 2:86183902-86183924 AACCTCAGTGTCCCTCAATAGGG - Intronic
935400961 2:102659837-102659859 GTCCTCAGTCTCCCTCGACAGGG - Intronic
936394794 2:112116842-112116864 ACCCTCATTGTCCCTCACTCAGG + Exonic
937343871 2:121110616-121110638 CTCCTCAGTCTCCTTCCATCTGG - Intergenic
937754937 2:125525693-125525715 GCTCTCAGTCTCCCTTAATCTGG - Intergenic
938921147 2:135996253-135996275 GTCCTCAGTTATCCTCCATCAGG - Intergenic
940500763 2:154490751-154490773 GACCTCAGTGTTGCACAATCAGG - Intergenic
941095441 2:161236505-161236527 GTCTTCAGTGGCCATCAATCAGG - Intergenic
947061690 2:226173407-226173429 TTCCTTAGTCTACCTCAATCCGG - Intergenic
1168773393 20:430196-430218 GGCCTCAGTGACTCTCCATCAGG + Intronic
1170752907 20:19167748-19167770 GTCTTCTGTGTCGCTCACTCTGG + Intergenic
1171281506 20:23902931-23902953 GTCTTCTGTGTCGCTCACTCTGG + Intergenic
1172592702 20:36128729-36128751 GTCCTCTCTGACCCTCAACCTGG - Intronic
1174263576 20:49315105-49315127 AACCTCAGTGTCCCTCAGTAGGG - Intergenic
1177324474 21:19566848-19566870 CTCCTCAGTCTCCCTGATTCTGG + Intergenic
1183459501 22:37941316-37941338 GATCTCAGTTTCCCTCACTCAGG + Exonic
1183509553 22:38226955-38226977 ATCCTCTCTGTCCCTCCATCCGG - Intronic
1184177303 22:42795702-42795724 GTCCTCAGGGTCTCAGAATCAGG - Intergenic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
950000018 3:9649546-9649568 CCCCTCAGTGTGCCTCAAGCGGG - Exonic
950496258 3:13336176-13336198 ATCCCCACTGTCCCTGAATCAGG + Intronic
953065174 3:39462593-39462615 TTCCTCACTGTTCCTGAATCAGG - Intergenic
953181303 3:40597542-40597564 TTCCTCAGAGGGCCTCAATCAGG - Intergenic
956560039 3:70565195-70565217 TTCCTCAGGGTCCCACAGTCAGG + Intergenic
958829975 3:99074600-99074622 GTCTTCTGTGTCGCTCACTCTGG + Intergenic
960880243 3:122336947-122336969 CTCCTCAGTCTCCTACAATCTGG - Intronic
961009632 3:123427042-123427064 GTCCCTAATGTCCCCCAATCAGG - Intronic
961183155 3:124891887-124891909 GGCCTCACTGTCCCCCAAGCTGG - Intronic
965597942 3:170426058-170426080 GTCCTCAGGGTCACTGAATGGGG + Intronic
967850650 3:194080284-194080306 GGCCTCAGTTTCCCTAAATGAGG + Intergenic
971411516 4:26378073-26378095 GTCCTTAGTCTCCTTTAATCTGG + Intronic
973631672 4:52825852-52825874 GGCCTCAATGTCCCCCATTCTGG - Intergenic
973899062 4:55448361-55448383 GTCTACAGTGTTCCTCAATGAGG + Intronic
974046925 4:56906520-56906542 GACCTCTGTTTCCCTCTATCTGG - Intergenic
978060220 4:104327560-104327582 GTCTTCTGTGTCCCTCACGCTGG + Intergenic
982184238 4:152779900-152779922 GGCCTCTCTCTCCCTCAATCCGG - Intronic
982770893 4:159396386-159396408 TTCCTCAGTCTCTCTCAACCAGG - Intergenic
985761018 5:1748810-1748832 GTTCTCAGTGTCCCTCATTCTGG - Intergenic
986041463 5:3997949-3997971 GCCCTCAGAGTCCCTCTAGCTGG + Intergenic
989610069 5:43282371-43282393 GTCCTCAGTATCTCATAATCAGG + Intergenic
993259246 5:85638499-85638521 GTCTTCTGTGTCGCTCACTCTGG - Intergenic
994492505 5:100464229-100464251 GTCTTCTGTGTCGCTCAAGCTGG + Intergenic
995309881 5:110698523-110698545 GTCCTGTGTGTCCCTGAATCTGG - Intronic
995509809 5:112897026-112897048 GTCCTCAATGTCTTTCAATTGGG + Intronic
998105303 5:139464986-139465008 CTCTTCAGTCTCCTTCAATCCGG + Intergenic
1002417981 5:179130631-179130653 GACCTGAGTGTCACCCAATCAGG - Intronic
1003270218 6:4601857-4601879 GTCCCCAGTGTACCTCACCCTGG - Intergenic
1004389550 6:15198584-15198606 CTCCTCAGTCTCCCTCATGCTGG - Intergenic
1004889334 6:20084234-20084256 CTCCTCAGTCTCCTTCAACCTGG + Intergenic
1005128033 6:22471135-22471157 TTCCTCAGCGTCCCTCACTGTGG + Intergenic
1005258267 6:24028141-24028163 GTGCTCAGAATCCCTCAACCTGG + Intergenic
1011024210 6:82848742-82848764 GTCTTCATTGACCCACAATCAGG - Intergenic
1012151306 6:95758435-95758457 GTCTTCTGTGTCGCTCAAGCTGG - Intergenic
1012211921 6:96530148-96530170 GTCCTTAGTCACCTTCAATCTGG + Intronic
1014973995 6:127855882-127855904 CTCCTCACTGTCCTTCCATCAGG - Intronic
1015522131 6:134142095-134142117 GTCTTGAGTATCCTTCAATCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018234798 6:161713656-161713678 GACCTCACTGTCCATCACTCTGG + Intronic
1018551443 6:165002773-165002795 GTGCACAGTGTCCCTCCATTGGG + Intergenic
1018810405 6:167294430-167294452 GTCCTCAGTGTCCCCCAGGCTGG - Intronic
1025207088 7:57000181-57000203 GCGCTCAGTGTCCTTCAGTCTGG + Intergenic
1025595209 7:62914915-62914937 GTCTTCTGTGTCCCTCACACTGG + Intergenic
1029710042 7:102294556-102294578 GTGGTCAGTGTCACTCACTCAGG + Intronic
1030342256 7:108393660-108393682 GTCTTCTGTGTCGCTCAAGCTGG + Intronic
1032436381 7:131904385-131904407 GACCTCAGTGGCACTGAATCAGG - Intergenic
1035279405 7:157767919-157767941 GTCCTTAATGTCCCTCAAGCGGG - Intronic
1037631703 8:20663478-20663500 GTCCTCAGTGCCTCACTATCTGG + Intergenic
1037892270 8:22629654-22629676 GGCCCCAGTGGCTCTCAATCAGG + Intronic
1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG + Intergenic
1040622489 8:49105570-49105592 GTCCTCAGTTCCCCTGCATCTGG + Intergenic
1041459663 8:58097986-58098008 GTCCTGACTGTCCCCCAGTCAGG + Intronic
1041881639 8:62758225-62758247 TTCCTCAGTCTCCTTTAATCTGG - Intronic
1042534296 8:69843349-69843371 GTCTTCTGTGTCGCTCAAGCTGG - Intergenic
1042792979 8:72629273-72629295 GACATCAGTGCCTCTCAATCAGG - Intronic
1043990943 8:86753631-86753653 CTCTTCAGTGTCTTTCAATCTGG + Intergenic
1045407716 8:101883479-101883501 GTCCTCCCTGTGCCTCATTCTGG - Intronic
1051057758 9:13008134-13008156 GTCCTGTGTGTGCCTCAATCAGG - Intergenic
1051327424 9:15988488-15988510 GTCTTCTGTGTCACTCAAGCTGG - Intronic
1053203639 9:36169035-36169057 GGCCTCAGTTTCCCTCAAAATGG + Intergenic
1057216226 9:93230337-93230359 GGCCTCAGTGCCCCTCAGCCGGG + Intronic
1058416366 9:104793119-104793141 CTCCTCTGTGACCCTCAACCAGG + Intronic
1059426516 9:114224378-114224400 GTCCTCACTGTCCCTGAGTGAGG + Intronic
1203370708 Un_KI270442v1:302046-302068 ATCTTCAGTGTCGCTCATTCTGG - Intergenic
1187210356 X:17224473-17224495 GTCCTCAGTATCCCACAGACGGG + Intergenic
1190292343 X:49001246-49001268 ATTCTCAGTGTCCCTCACACAGG + Intronic
1191003591 X:55687113-55687135 GTCCTCTGTGTCACTCACGCTGG + Intergenic
1192400726 X:70832298-70832320 GTCTTCAGTCTCCTTCAATCTGG - Intronic
1192544959 X:72005579-72005601 CTCCACAGTGGCCCTCAACCAGG - Intergenic
1193399550 X:81026884-81026906 GTCTTCTGTGTCGCTCACTCTGG - Intergenic
1198615616 X:138455894-138455916 GTCTTCTGTGTCACTCAAGCTGG - Intergenic
1198757281 X:139995093-139995115 GTCTTCTGTGTCGCTCACTCTGG + Intergenic
1200762803 Y:7055396-7055418 GTCCTCAGTGTCCTGGCATCTGG - Intronic