ID: 1111900356

View in Genome Browser
Species Human (GRCh38)
Location 13:94192428-94192450
Sequence TGGAATGCCAAGAGTATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111900350_1111900356 29 Left 1111900350 13:94192376-94192398 CCATAATAGCCCAGAGTGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1111900356 13:94192428-94192450 TGGAATGCCAAGAGTATGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 138
1111900352_1111900356 20 Left 1111900352 13:94192385-94192407 CCCAGAGTGTGTGGCTCCTCATT 0: 1
1: 0
2: 3
3: 34
4: 291
Right 1111900356 13:94192428-94192450 TGGAATGCCAAGAGTATGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 138
1111900354_1111900356 4 Left 1111900354 13:94192401-94192423 CCTCATTTTTATATGTCATCAGA 0: 1
1: 0
2: 1
3: 32
4: 335
Right 1111900356 13:94192428-94192450 TGGAATGCCAAGAGTATGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 138
1111900353_1111900356 19 Left 1111900353 13:94192386-94192408 CCAGAGTGTGTGGCTCCTCATTT 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1111900356 13:94192428-94192450 TGGAATGCCAAGAGTATGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111900356 Original CRISPR TGGAATGCCAAGAGTATGTC TGG Intronic
901603475 1:10440872-10440894 TGGGATGACCAGAGTATCTCTGG - Intronic
908906831 1:69023072-69023094 TTGAATGCCTACAATATGTCAGG + Intergenic
909840463 1:80315186-80315208 TGGAAAGCCAAGAGGAACTCTGG - Intergenic
910079901 1:83329189-83329211 TTAAAAGCCAAGAATATGTCAGG + Intergenic
910348673 1:86270796-86270818 CAGACTGCCAAGAGTTTGTCAGG - Intergenic
912321598 1:108718998-108719020 TGGAATGCCAACAGAATCCCTGG + Exonic
912723617 1:112040578-112040600 AGGAATACCATGAGTGTGTCAGG + Intergenic
914950047 1:152105452-152105474 TGAAATTCCAAGACAATGTCAGG + Intergenic
915453181 1:156020878-156020900 TGGGATGCCAACGGTAAGTCCGG - Exonic
916293727 1:163193793-163193815 TGGGATGAGAAGGGTATGTCAGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
918536638 1:185582178-185582200 TGGAATCCAAAGAGGATGTGAGG + Intergenic
920641998 1:207761635-207761657 TGAAATGCCAAGAACATGTAGGG - Intronic
921203489 1:212828391-212828413 TGGGATGACAAGTGTATGCCTGG - Intergenic
1063910163 10:10821251-10821273 TGGAATTCCAAGGGAATGGCTGG + Intergenic
1064181814 10:13123383-13123405 TTGAATGCCTATTGTATGTCAGG + Intronic
1064336744 10:14450257-14450279 TGGAAGGAAAAGAGTTTGTCAGG - Intronic
1064638541 10:17392807-17392829 TGAAATGCCCACTGTATGTCTGG + Intronic
1067783227 10:49224113-49224135 TGGAAGGCCCAGAATAAGTCAGG - Intergenic
1071890969 10:90006669-90006691 TGGAATGAGAAGATTATTTCAGG + Intergenic
1073397671 10:103231327-103231349 TGGAATTCCAAGAGTATTTGTGG - Intergenic
1075981121 10:126740718-126740740 TGGAAAGGCAAGAGCCTGTCAGG + Intergenic
1077344593 11:2040367-2040389 AGGAATGCCAAGAGAAGGGCAGG - Intergenic
1079282265 11:19098052-19098074 TGGAAGAGCAAGAGTATGACTGG - Intergenic
1083802002 11:65052263-65052285 TGGAATGACAAGCGTCTGCCTGG + Intronic
1086268250 11:85028295-85028317 TGGGCAGCCAAGAGTAGGTCGGG + Intronic
1086491189 11:87359283-87359305 TGGAATGCAAAGATGATGCCTGG - Intergenic
1086927839 11:92659810-92659832 TGGGTTGCCAAGAGCATCTCAGG + Intronic
1087595393 11:100247597-100247619 CGGGATGTCAAGAGTATATCAGG + Intronic
1088017175 11:105075019-105075041 TGGATGGCCAAGAGTATTTTTGG + Intronic
1089079877 11:115766694-115766716 AGGAACGCCAGGAGTATGTGTGG - Intergenic
1089339124 11:117745590-117745612 TGGAGTGACATGAGTCTGTCTGG - Intronic
1090183503 11:124720779-124720801 TTGAATGCCTACTGTATGTCTGG + Intergenic
1090263502 11:125339534-125339556 TGGAAAGCCAAGGGTGTGTGGGG + Intronic
1091182891 11:133622798-133622820 TGGAAAGACAAGAGTTTGCCAGG - Intergenic
1202827579 11_KI270721v1_random:95556-95578 AGGAATGCCAAGAGAAGGGCAGG - Intergenic
1092825825 12:12397609-12397631 TGGAATTACCAGACTATGTCAGG - Intronic
1092913415 12:13167896-13167918 TAGAATGCCATGAGTGAGTCAGG - Intergenic
1097961715 12:65537992-65538014 TGGAAGGACAGGAGCATGTCTGG - Intergenic
1102095178 12:110233898-110233920 TGAAAGGGAAAGAGTATGTCTGG + Intergenic
1105352210 13:19626281-19626303 TGGAAGGCAAAGAGGAAGTCAGG - Intergenic
1106959191 13:34977754-34977776 TTGAATGCCTAGTGTATGGCAGG - Intronic
1107330895 13:39298051-39298073 TGGAATGTCCAGAGTATGGGAGG + Intergenic
1107500967 13:40975262-40975284 TGGAATGGCAAGATTCTGTTAGG - Intronic
1110059845 13:71027411-71027433 TGGAATCCAAAGAGGATGTGAGG + Intergenic
1110927606 13:81174554-81174576 TTGAATGCAGAGAGCATGTCAGG + Intergenic
1111900356 13:94192428-94192450 TGGAATGCCAAGAGTATGTCTGG + Intronic
1112551095 13:100421338-100421360 TTAAATGCAAAGAGTATCTCTGG - Intronic
1112591011 13:100763067-100763089 TGGGATGCCAGGAATATTTCTGG + Intergenic
1113079248 13:106500110-106500132 TGGAAGGGCAAGAATATTTCTGG + Intronic
1114544477 14:23488461-23488483 TGGATTGACAAGAGTATGGCCGG + Intronic
1114565914 14:23632738-23632760 TGGAGTGGCCAGAGCATGTCTGG + Intronic
1117779038 14:59213421-59213443 TGCAATGCCCAGAGTATTTTGGG + Intronic
1118523034 14:66608508-66608530 TGGACTGTCAAGATTAAGTCTGG + Intronic
1118995252 14:70829841-70829863 TGGAATGGGCAGAGTATGTTAGG - Intergenic
1120138480 14:80899591-80899613 TGCAATGCCAAAAGTCAGTCAGG + Intronic
1120609842 14:86625741-86625763 TGGAATGTTAAGAGCATTTCTGG - Intergenic
1122598474 14:102909160-102909182 TGAAAGGCCCAGCGTATGTCGGG - Exonic
1126124812 15:45285686-45285708 TACAATGCCAAGATTATTTCTGG - Intergenic
1126960959 15:53993556-53993578 TGGAATGCAAAGATTATGGTTGG + Intergenic
1130964121 15:88684654-88684676 TGGAAAGTCAAGAGTGTGTAGGG + Intergenic
1131347921 15:91668253-91668275 TGGAAAGCTAAGAGAATATCTGG + Intergenic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1135578851 16:23608043-23608065 TAGACTGTCAAGAGTATGTCAGG + Intronic
1138412038 16:56848250-56848272 GGGACTGCCAAGACTTTGTCAGG - Intronic
1138963946 16:62060836-62060858 TCGAATGCCCACTGTATGTCAGG - Intergenic
1142543816 17:683975-683997 TGGAATGCAGAGAGGATGTGAGG + Intronic
1146919238 17:36698835-36698857 TGGAATGCCAGGAGTAAGAAGGG + Intergenic
1152552813 17:81038297-81038319 TGGAATGCCAGGAGAATGTCAGG + Intronic
1154978096 18:21478842-21478864 TGGATTGCCAAGAGAATGAATGG + Intronic
1158130747 18:54150042-54150064 TGTAATGGCAAGAGTCTGGCAGG + Intergenic
1160232987 18:77062636-77062658 TGGATTGCTAAGAGAATGACTGG + Intronic
1162310448 19:9903729-9903751 TGGAATAGCCAGAGAATGTCTGG + Intronic
1164375469 19:27680002-27680024 TAGAATGCCTAGAGTGTGCCAGG + Intergenic
925516263 2:4686262-4686284 TGGAATGTCAAGAGTAAGACTGG + Intergenic
929862320 2:45689987-45690009 TAGAATGCACAGAGTATTTCTGG - Intronic
936919205 2:117670435-117670457 TGGAATTTCATGAGTATGACTGG - Intergenic
939594980 2:144111655-144111677 TGGCCTGCCCAGAGAATGTCTGG - Intronic
941965863 2:171300631-171300653 TGAAATGCCAAGAATATGCATGG - Intergenic
942794036 2:179794937-179794959 TGTAATGGGAAGAGTATGTGAGG + Intronic
947215753 2:227748427-227748449 GGGAATGGCAAGAGTATTTGTGG + Intergenic
948751141 2:240134014-240134036 TGGAAAGGCAAGGTTATGTCAGG + Intronic
1178095192 21:29207411-29207433 TTGAATGCCAATAGTATGCCTGG + Intronic
1183214319 22:36469292-36469314 TTGAATGCCCACAGTATGCCAGG - Intronic
949506776 3:4736271-4736293 TTCAAGGCCAAGAATATGTCAGG - Intronic
949715094 3:6920860-6920882 TACAATTCCAAGAGCATGTCTGG - Intronic
955415886 3:58690474-58690496 TGGAATGCAATGATTCTGTCAGG + Intergenic
957555692 3:81761925-81761947 AGAAAAGCCAAGAATATGTCAGG - Exonic
960545343 3:118907813-118907835 TAGAGTGCCAAGTGTATGTATGG - Intronic
961365258 3:126395417-126395439 AGAAGTGCCAAGGGTATGTCAGG + Intronic
962347288 3:134627430-134627452 TGGAATGCCAAATGTCTGTAAGG - Intronic
969899467 4:10335677-10335699 TGGGATGCTAAGAGGATGTGTGG + Intergenic
972474609 4:39438580-39438602 TGGAAAGCACATAGTATGTCAGG - Intronic
973587956 4:52411048-52411070 TGGGCTGACAAGAGTATGCCTGG - Intergenic
974879272 4:67734004-67734026 TAGAATGGCAAGAGTAAGGCAGG + Intergenic
975883890 4:78941804-78941826 TTGAGTGCTAACAGTATGTCTGG - Intergenic
975923635 4:79422871-79422893 TCAAATGCCTAGAGTATGCCTGG - Intergenic
977851141 4:101831192-101831214 TTGTATGCCCAGAGTTTGTCCGG - Intronic
981031034 4:140126198-140126220 TGGAATGCCTTGAATATGTGTGG - Intronic
983513205 4:168631082-168631104 GGGAATGCCAAGAATAAATCTGG - Intronic
983516770 4:168665614-168665636 TGGAAAGCCAAGACTCTGTGAGG + Intronic
984164012 4:176286433-176286455 TAGTCTGCCAAGAGTATGTAGGG + Intergenic
984294630 4:177838965-177838987 TGGAATGCACCGTGTATGTCAGG + Intronic
984709219 4:182870974-182870996 TGGAATGCCTAGTATATGCCAGG + Intergenic
990102414 5:52208249-52208271 TGTAATGTCAAGATTATATCTGG + Intergenic
990126297 5:52522233-52522255 TTGAATGCCTAACGTATGTCAGG - Intergenic
990514532 5:56519270-56519292 TGGAGGGCAATGAGTATGTCTGG - Intronic
992672856 5:79076927-79076949 TGGAATGCCAACATAATGCCTGG - Intronic
993300569 5:86204430-86204452 TGGAATGCCCTGAGTAGTTCTGG - Intergenic
1001570267 5:172726108-172726130 AGGAATGCCAAGAGGATGTGAGG - Intergenic
1002760177 6:195798-195820 TGGACTGCCAAGTGTGTTTCTGG - Intergenic
1003706398 6:8535960-8535982 TTGAATGCCAAGGGTATGCCCGG + Intergenic
1004307268 6:14512377-14512399 ATGAATGCCAAGGGAATGTCAGG - Intergenic
1004871771 6:19912442-19912464 TGCAATGCAAAGATCATGTCTGG + Intergenic
1006968483 6:38014658-38014680 TGGAGTGCACAGAGTATATCTGG + Intronic
1009864445 6:69378827-69378849 TGGAAAGCCACCTGTATGTCTGG - Intronic
1014798551 6:125751775-125751797 TGAAATAAGAAGAGTATGTCAGG - Intronic
1016087053 6:139927273-139927295 TGCACTGCCAAGACCATGTCTGG + Intergenic
1026703120 7:72665256-72665278 TGGAATGCCAACATGATGGCTGG + Intronic
1027297664 7:76794468-76794490 TTAAAAGCCAAGAATATGTCAGG + Intergenic
1027543966 7:79503023-79503045 TGAAATGCTAAGAGCAAGTCTGG - Intergenic
1028317345 7:89419938-89419960 TGAAAGGCCAAGGGAATGTCTGG + Intergenic
1028764991 7:94544509-94544531 TGGAATCTATAGAGTATGTCAGG + Exonic
1033375173 7:140753697-140753719 AGGAGTGCCAAGAGAATATCTGG - Intronic
1033665382 7:143436158-143436180 TGGAATGACAAGAGGAGCTCAGG - Intergenic
1038962845 8:32540659-32540681 TTGAATGCCTAGAATATGTTTGG - Intronic
1042204246 8:66312492-66312514 TGGAATGGCAAGAGGATCTAAGG - Intergenic
1042668063 8:71229275-71229297 TGGGTTGCAGAGAGTATGTCAGG - Intronic
1044362521 8:91304854-91304876 TGGCATGCCTAGAGAATGACAGG - Intronic
1046039537 8:108885657-108885679 TGAAATGCCCAGAGTATTTAGGG - Intergenic
1049699373 8:144001779-144001801 TGTAATTCCAACAGTTTGTCAGG + Intronic
1056613657 9:88142345-88142367 TGGTATGCCAAGAGTGTCTGGGG - Intergenic
1060428992 9:123532154-123532176 TCCAATGCCATCAGTATGTCAGG - Intronic
1062492719 9:136814958-136814980 GGGAAAGCCAAGAGGATGGCTGG - Intronic
1203342361 Un_KI270442v1:1722-1744 TGGAATACAATGAGTATGGCAGG + Intergenic
1186035930 X:5423620-5423642 TGGAATTCCAAGATCAAGTCGGG - Intergenic
1188215412 X:27470595-27470617 GGGAATTCAAAGAGTATGTGTGG + Intergenic
1188429020 X:30084177-30084199 TAGAATGCAAAGAGGATGCCAGG + Intergenic
1191230084 X:58086905-58086927 TAGAATGCCTAGGGTAGGTCAGG - Intergenic
1191233406 X:58115327-58115349 TAGAATGCCAAAGGTAGGTCAGG - Intergenic
1191233493 X:58115951-58115973 TGGAATGCCTGGAGTAGGCCTGG - Intergenic
1191240938 X:58189562-58189584 TAGAATGCCTGGAGTATGCCAGG - Intergenic
1191245662 X:58226304-58226326 TAGAATGCCAAGGGTCTGCCAGG - Intergenic
1191247336 X:58238269-58238291 TAGAATGCCTAGGGTATGGCAGG - Intergenic
1196021817 X:110998911-110998933 TGGTATGCCAGGAGTGTGGCAGG - Intronic
1197461635 X:126749953-126749975 TGGAATGCCAAATGTATCTATGG + Intergenic
1199030621 X:142994732-142994754 TGGAAGGCCAGGTGTATGTGAGG + Intergenic