ID: 1111911169

View in Genome Browser
Species Human (GRCh38)
Location 13:94313517-94313539
Sequence GGCTGTATACCCTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111911162_1111911169 18 Left 1111911162 13:94313476-94313498 CCTCTCTTTCAGTCCTGGCAAAG 0: 1
1: 0
2: 19
3: 17
4: 174
Right 1111911169 13:94313517-94313539 GGCTGTATACCCTGGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 220
1111911163_1111911169 5 Left 1111911163 13:94313489-94313511 CCTGGCAAAGTTGTGTTTAATTG 0: 1
1: 0
2: 0
3: 10
4: 215
Right 1111911169 13:94313517-94313539 GGCTGTATACCCTGGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111911169 Original CRISPR GGCTGTATACCCTGGGGAGA AGG Intronic
903441799 1:23393894-23393916 GGCTATAAGCCCTGCGGAGATGG + Exonic
903668263 1:25021162-25021184 GGCTGTAGGTCCTGGGGTGAGGG - Intergenic
905330281 1:37190333-37190355 GGCTGTAGAACCTGGGGTCATGG - Intergenic
906109440 1:43313123-43313145 GGCTGGAGGCCCTGGGGAGATGG - Exonic
906662529 1:47593223-47593245 CGCTGCAGACCCTGCGGAGACGG - Intergenic
909861163 1:80607278-80607300 TTCTGGATACCCTGGGGTGAAGG - Intergenic
916641027 1:166729347-166729369 GGCTCCATACCATGGGGAAAGGG + Intergenic
916894606 1:169149453-169149475 GGATGTATCCCCTAGGGATAAGG - Intronic
920457025 1:206109328-206109350 GGCTGGATTCCCTGGGGGGTGGG + Intergenic
921026780 1:211291549-211291571 GACTGTATCCCCTGCGGATATGG + Intronic
921397921 1:214688644-214688666 GGCTGGAGACCCAGGAGAGATGG + Intergenic
922561415 1:226572467-226572489 GGCTGGATGCCTCGGGGAGATGG + Intronic
923778570 1:237001372-237001394 GACTCTATTCCCTGGGGTGATGG + Intergenic
1062842727 10:683587-683609 GGGTGTTTACCCTGGAAAGACGG - Intronic
1063147439 10:3308925-3308947 GGTTTTATACCCTGGGGAATTGG - Intergenic
1063461768 10:6219364-6219386 GGGAGGATTCCCTGGGGAGATGG - Intronic
1063569308 10:7200110-7200132 GGCTGCATATCATGGGGAAAAGG - Intronic
1063980115 10:11445898-11445920 GGATGTAGACTGTGGGGAGAAGG - Intergenic
1065617874 10:27547133-27547155 GGCTGTATAACCTTGGGATGGGG - Intergenic
1066162202 10:32746179-32746201 GGATGTAGACCCTGGGCTGAAGG + Intronic
1071120193 10:82267938-82267960 GGCTGTATGCCCTGAGAAAAGGG + Intronic
1072835876 10:98711254-98711276 GGCTGTAGAGCCTGGTGAGAAGG + Intronic
1073068500 10:100778727-100778749 CCCTGTACATCCTGGGGAGAAGG - Intronic
1074545128 10:114396231-114396253 GGCTCTGTACCCTGGGAAGCTGG - Intronic
1075516124 10:123109639-123109661 GAGTGTATGCCCTGGGGTGAGGG - Intergenic
1076293106 10:129362720-129362742 GGCTGTTTCTCCCGGGGAGAGGG - Intergenic
1076533195 10:131159140-131159162 GGCAGTGTGCCCTGGGGAGAGGG + Intronic
1077051227 11:568007-568029 AGCTGGATACCGTGGGGAGGGGG - Intergenic
1077894592 11:6444116-6444138 GGCTGTATACTCCAGGGAGCAGG + Intergenic
1079883423 11:25955610-25955632 TTCTGTATCCCCTGGGGAGGAGG - Intergenic
1080765780 11:35295626-35295648 GGCTGGAGAGCCTGGGGAGAGGG + Intronic
1080872763 11:36251571-36251593 GGCTTTATTGCCTGGGGAGTGGG + Intergenic
1083273812 11:61585948-61585970 GTGAGAATACCCTGGGGAGATGG + Intergenic
1083758050 11:64801931-64801953 GGCTGTAGGTCCTGGGGAAAAGG - Intronic
1084947584 11:72646973-72646995 GGCATTATAGACTGGGGAGATGG - Intronic
1085390088 11:76177819-76177841 GGATGGATGCCCTAGGGAGATGG + Intergenic
1088037442 11:105334479-105334501 GGATGGAGCCCCTGGGGAGAGGG + Intergenic
1088128112 11:106452919-106452941 GGGGTTATACCTTGGGGAGAAGG - Intergenic
1088906028 11:114156145-114156167 GGCTGCAGTCCCTGGGCAGAGGG + Intronic
1089385950 11:118068201-118068223 GGCTGTGTGCGCTGGGGAAATGG - Intergenic
1089829560 11:121314881-121314903 TGCTGTATCCCCTGGGGATGGGG - Intergenic
1091121959 11:133064554-133064576 GGCAGTCTACCGTGGGGAAAGGG - Intronic
1091353483 11:134915948-134915970 GGCCCTAGCCCCTGGGGAGAAGG - Intergenic
1091455622 12:605234-605256 GGCTGTGCATCATGGGGAGAGGG + Intronic
1092908078 12:13120431-13120453 GGCTTTATATCCTGGAGAGAGGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1095965300 12:47863483-47863505 GGCTGTCTTCTCTGCGGAGATGG + Intronic
1096180523 12:49548239-49548261 GGCTGTGCACACTTGGGAGAGGG - Intronic
1096779685 12:53984808-53984830 GCCTGTAACTCCTGGGGAGAAGG - Intergenic
1098872995 12:75837233-75837255 CGCTGTATACGCAGGTGAGATGG - Intergenic
1099107769 12:78518440-78518462 GGCTGTGTACACCAGGGAGATGG - Intergenic
1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG + Intronic
1104862953 12:131934294-131934316 CTCTGACTACCCTGGGGAGAGGG + Intronic
1104975629 12:132550783-132550805 GGCTGGATGCCATGGGGAAACGG - Intronic
1107519294 13:41163364-41163386 GCCTATATACCATGGGGAAAGGG - Intergenic
1107859354 13:44646259-44646281 GGCTGTAAACCCCCTGGAGAGGG - Intergenic
1111911169 13:94313517-94313539 GGCTGTATACCCTGGGGAGAAGG + Intronic
1113152787 13:107283200-107283222 GGCTGTATTCCTTGGGAATAGGG + Intronic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1117099492 14:52331960-52331982 GGCTGTGTACACTAGGGATAGGG + Intergenic
1118114667 14:62761886-62761908 GGATGCAGACCCTGGGGTGAAGG + Intronic
1118642930 14:67809158-67809180 GACTGTCAACCCTGGGCAGATGG + Intronic
1119195340 14:72713453-72713475 GACTGCAGACCCTGGCGAGATGG + Intronic
1119780532 14:77274060-77274082 CCCTAGATACCCTGGGGAGAAGG - Intergenic
1120242302 14:81963586-81963608 GGCTCTATATCCTAGGCAGATGG + Intergenic
1202828610 14_GL000009v2_random:3059-3081 GGCAGTACACCCTGGCGATATGG - Intergenic
1202900374 14_GL000194v1_random:33050-33072 GGCAGTACACCCTGGCGATATGG - Intergenic
1124883524 15:33662861-33662883 GGCTGTGGAGGCTGGGGAGAAGG + Exonic
1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG + Intergenic
1126436264 15:48641496-48641518 GGCAGTATTTGCTGGGGAGAAGG + Intronic
1128573028 15:68749503-68749525 GGCTGTTTCCTCTGGGGAGCAGG + Intergenic
1129232706 15:74205677-74205699 GGCTGCAGCCCCTGGGCAGATGG - Intronic
1129321596 15:74778015-74778037 GGCTGGAGCACCTGGGGAGATGG - Intergenic
1129876222 15:78977355-78977377 GGCTGAATCCCCTGGGGCCAGGG + Intronic
1129917617 15:79288229-79288251 GGCTATAATCCCTGGGGAGTAGG + Intergenic
1130440134 15:83945127-83945149 CTCTGTAGACCCTGGAGAGATGG - Intronic
1131582414 15:93657708-93657730 GGCTGTTTACCCTGCAGGGAAGG + Intergenic
1131582992 15:93663692-93663714 GCCTGTAAATCCTGGGAAGAGGG + Intergenic
1132585359 16:703813-703835 AGCTGGACACCCTGGGGAGTGGG + Intronic
1134375680 16:13670696-13670718 GGGTGTATACCATGAGGGGAAGG - Intergenic
1136104006 16:28015881-28015903 GGCTGTATAATCTGGGGATATGG + Intronic
1136580812 16:31149819-31149841 GCCTGGGTGCCCTGGGGAGACGG - Intronic
1141036680 16:80632783-80632805 GGATGAAGACCATGGGGAGAGGG - Intronic
1143890669 17:10099778-10099800 GAGGGTATACCTTGGGGAGAAGG - Intronic
1144637766 17:16921196-16921218 GGCTGTGGACCATGGGGAGAGGG - Intergenic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147164599 17:38586603-38586625 GGCAGTATTCCCTGGGCAGGGGG - Intronic
1148341367 17:46875395-46875417 AGCTGTGTACCCTGGTGGGAAGG - Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150183923 17:63159527-63159549 GGCTGTAGAACCTGTGGATATGG - Intronic
1150578325 17:66449982-66450004 GGAGGTATACCTTGGGGAGTGGG + Intronic
1151375451 17:73685550-73685572 GGATGTATATGTTGGGGAGAGGG + Intergenic
1152181215 17:78822918-78822940 GGCTGGAGAGCCTGGGGAGAGGG - Intronic
1152407150 17:80104389-80104411 TGCTGTCTAGACTGGGGAGAGGG - Intergenic
1152541757 17:80980122-80980144 GGCTGCTCCCCCTGGGGAGAAGG - Intergenic
1152791708 17:82283634-82283656 GGGTGGACACCCTGGGGAGGAGG - Intergenic
1152890829 17:82880826-82880848 CGCTCTGCACCCTGGGGAGACGG - Intronic
1153052217 18:909646-909668 GGCTGTATACACAGGGTAGCTGG - Exonic
1154315842 18:13302633-13302655 GAATGTATGCCCTGGTGAGAAGG + Intronic
1158981736 18:62768924-62768946 TGCTGTATTCTCTGGGGTGATGG + Intronic
1160287244 18:77555140-77555162 GGCTCTATTCTCTGGTGAGAAGG + Intergenic
1161641449 19:5426069-5426091 CACTGGATACCCTTGGGAGATGG - Intergenic
1162099201 19:8329644-8329666 GGTTTTATACCCTGGGGAACAGG - Intronic
1165063055 19:33214191-33214213 GGCAGTCTCCTCTGGGGAGAGGG - Intronic
1168292515 19:55363348-55363370 GGCTGTATCCCTGGAGGAGAAGG - Intergenic
1202644089 1_KI270706v1_random:124751-124773 GGCAGTACACCCTGGCGATATGG + Intergenic
925098607 2:1227551-1227573 GGGTGGATACCGTGGGGAAACGG - Intronic
927124319 2:19999423-19999445 GGCTGTAGAGGCTGGGGAGGTGG - Intronic
928687339 2:33762167-33762189 GGAGGGAGACCCTGGGGAGAGGG + Intergenic
929301194 2:40305251-40305273 GGCTATGAACCCTGGGGAGCAGG - Intronic
929406059 2:41642493-41642515 GAATGTATACCTTGGGGACAAGG + Intergenic
932448965 2:71797563-71797585 GCCAGTACTCCCTGGGGAGAGGG + Intergenic
932746184 2:74335445-74335467 GGAAGTACAGCCTGGGGAGAGGG - Intronic
932749910 2:74364966-74364988 GGCTGAATACCCGGGGGTAAGGG + Intronic
933719691 2:85390039-85390061 GGCTGGCTCCCCTGGGGAAATGG + Intronic
935368030 2:102315206-102315228 GGGTGTATGCCGTGGGGAAAAGG + Intronic
935667430 2:105525101-105525123 GGCTGCATGCTCTGGGGAGTTGG + Intergenic
935954538 2:108362773-108362795 GGGTGTATTCCCTGGTCAGATGG + Intergenic
935987528 2:108689148-108689170 GGCTGTGTGCCCTGGGCATATGG - Intergenic
936126354 2:109791845-109791867 GGCTGTGTGCCCTGGGCATATGG - Intergenic
936218339 2:110579623-110579645 GGCTGTGTGCCCTGGGCATATGG + Intergenic
937984765 2:127633501-127633523 GCCTGCATCCCATGGGGAGAGGG - Intronic
939354302 2:141081282-141081304 GGCTGTATCCCCTGTGGATGAGG + Intronic
939987773 2:148848907-148848929 TCCTGCAAACCCTGGGGAGAAGG - Intergenic
940190712 2:151037396-151037418 GGCTGCATTCCCAGGAGAGAAGG + Intronic
942242964 2:173980545-173980567 GGCTTGATACCTTGTGGAGAAGG + Intergenic
947324920 2:228963537-228963559 GTCTGTATACCCTTGTGAGGGGG - Intronic
947384622 2:229578630-229578652 GGCTGTATTAGCTGGGGTGAGGG - Intronic
948481870 2:238255224-238255246 GGGTGCATCTCCTGGGGAGAAGG + Intronic
948706093 2:239793324-239793346 GGATGCGTACCGTGGGGAGAAGG - Intronic
949052988 2:241907403-241907425 GCCTGTGTGCCCGGGGGAGAGGG + Intergenic
1171343860 20:24451187-24451209 GGCTGTGCACCGTGGGGAGGGGG - Intergenic
1171894056 20:30743697-30743719 GGCAGTACACCCTGGCGATATGG + Intergenic
1172821154 20:37735612-37735634 AGCTGTAGACCCTGGGGAGGAGG + Intronic
1172924574 20:38521027-38521049 GTCTGTATACTTTAGGGAGAGGG - Intronic
1172938015 20:38634529-38634551 GCCTAAATGCCCTGGGGAGAAGG + Intronic
1175336466 20:58199339-58199361 GGCTTTAGGCTCTGGGGAGAGGG + Intergenic
1175700482 20:61133266-61133288 GGCAGTATCCCCTGGTGAGCTGG + Intergenic
1175864273 20:62166249-62166271 GCCTGCAGTCCCTGGGGAGAGGG + Intronic
1175954967 20:62604561-62604583 GGCTGCAGACCTTGGGGAGGAGG - Intergenic
1176346940 21:5757369-5757391 GGCTGTATCCCATGGGTAGTAGG + Intergenic
1176353754 21:5877953-5877975 GGCTGTATCCCATGGGTAGTAGG + Intergenic
1176497887 21:7567086-7567108 GGCTGTATCCCATGGGTAGTAGG - Intergenic
1176541261 21:8155439-8155461 GGCTGTATCCCATGGGTAGTAGG + Intergenic
1176560212 21:8338484-8338506 GGCTGTATCCCATGGGTAGTAGG + Intergenic
1176607792 21:8847887-8847909 GGCAGTACACCCTGGCGATATGG - Intergenic
1176619748 21:9047828-9047850 GGCAGTACACCCTGGCGATATGG - Intergenic
1180988485 22:19919533-19919555 TGCTGCCTACCTTGGGGAGAAGG + Exonic
1181430901 22:22881139-22881161 GGCTGTCTGTCCTGGGGACACGG - Intronic
1182103067 22:27670988-27671010 GGCTGTTTGTCCTGGGGAGGAGG + Intergenic
1183386157 22:37515954-37515976 GGCGGTAGGCCCTGGGGAGATGG - Exonic
1183511033 22:38235133-38235155 GGCAGGCTCCCCTGGGGAGATGG - Intronic
1203246203 22_KI270733v1_random:71858-71880 GGCTGTATCCCATGGGTAGTAGG + Intergenic
950791201 3:15473831-15473853 TGCTTTTCACCCTGGGGAGAGGG - Intronic
952205751 3:31180692-31180714 GGGTGTGTGCCCGGGGGAGATGG + Intergenic
952216577 3:31284114-31284136 GGCTGTATACTCTGGTAAGCAGG - Intergenic
955020855 3:55119777-55119799 AGCTGAATGCCCTTGGGAGATGG - Intergenic
956567227 3:70652410-70652432 GGCTGTTTATCCTAGAGAGAGGG - Intergenic
960266298 3:115624646-115624668 GGCTGTAAAACCTGGGCAGTGGG - Intronic
963854435 3:150239115-150239137 AGCTGGAGACCTTGGGGAGATGG + Intergenic
964802136 3:160568113-160568135 GGCTGTATACACCCAGGAGAAGG + Intergenic
967335182 3:188336666-188336688 GGCTGTATGCCACAGGGAGAGGG + Intronic
968582646 4:1402196-1402218 GCCTGTTTTCCCCGGGGAGAAGG - Intergenic
969476686 4:7426143-7426165 GGCTGTAGACCCAGAGGAGAAGG + Intronic
972189679 4:36574862-36574884 GGCTGTATTACCTGGCCAGATGG - Intergenic
976465488 4:85363581-85363603 GAATGTTTACCCTAGGGAGAGGG - Intergenic
978331718 4:107620658-107620680 GGATGTTTGCCCTGGGGAGGGGG - Intronic
980174965 4:129333430-129333452 GCCTGGATACTCTGTGGAGAGGG + Intergenic
980706239 4:136499435-136499457 GGGTGTATATGCTGGGGATAGGG - Intergenic
985672082 5:1212291-1212313 GTCCACATACCCTGGGGAGAGGG - Exonic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
989578423 5:43010201-43010223 GGCTGTTTATGCTGGGAAGATGG - Intergenic
992000632 5:72432617-72432639 GTCTGTATAGGCTGGGGAGGTGG + Intergenic
992363085 5:76062679-76062701 GGCTGTCTACCCTGGTGACTTGG + Intergenic
998459267 5:142297363-142297385 GGCTGTATAACATGGAGGGAGGG + Intergenic
999213551 5:149912415-149912437 GGCTGTCTATCCTGGGCACAAGG + Intronic
1001841057 5:174877153-174877175 GGCTGTGTGACCTGGGGAGAAGG - Intergenic
1003280941 6:4690802-4690824 GGCTGGGTATCCTGGGGAAATGG - Intergenic
1004525648 6:16404822-16404844 GTCGGTACAGCCTGGGGAGAGGG + Intronic
1004869906 6:19894382-19894404 AGCAGTATCCCCTGGGGAGCTGG + Intergenic
1005224509 6:23626217-23626239 AGCAATATACCCTGGGGAAAGGG - Intergenic
1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG + Intergenic
1007394344 6:41569166-41569188 ATCTGTCTACCCTGAGGAGAAGG + Intronic
1015069896 6:129079391-129079413 GGATGTATCCCCTGAGGATAAGG + Intronic
1017678871 6:156843530-156843552 GGATGTTTACCCTGGGGCTATGG + Intronic
1019447588 7:1079466-1079488 AACTGTCTACGCTGGGGAGACGG + Intronic
1019975948 7:4581688-4581710 AGCTGGAGACCCTGGGGTGATGG + Intergenic
1023405065 7:39825109-39825131 GGATGTATCCCCTGTGGATAAGG - Intergenic
1025058635 7:55785456-55785478 GCCTGTGAACCCTGGTGAGAAGG + Intergenic
1026006185 7:66602053-66602075 GCCTGTGCACCCTGGTGAGAAGG + Intergenic
1026392158 7:69912421-69912443 GGCTGTATGCTCTGAGGAGCCGG - Intronic
1027234832 7:76292008-76292030 TGCTCTATACCCTGGGGAAAGGG + Intergenic
1028480816 7:91302774-91302796 GGCTGTATAACATGGGGTGGGGG - Intergenic
1029156703 7:98522373-98522395 AAATGTATACCCTGGGAAGAAGG - Intergenic
1029503737 7:100949759-100949781 GGCTGTAAGGCCTGGGGAGGGGG + Intronic
1031116659 7:117676204-117676226 GGCTGTAAACTCAAGGGAGAGGG + Intronic
1032186960 7:129734963-129734985 GGCTGTGGATCCTGGGGAAAGGG + Intronic
1032252405 7:130269688-130269710 GGCTGTCTCCCCTGGGGTGGTGG - Exonic
1033651882 7:143350197-143350219 GGCTCTGTCCCCTGGGAAGAAGG + Intronic
1035851393 8:2922431-2922453 GGCTGTATCCTCTGGAGAAAAGG - Intergenic
1041318190 8:56585573-56585595 GGCTATTTTCACTGGGGAGAAGG - Intergenic
1042698813 8:71587862-71587884 GGCAGTGTTGCCTGGGGAGAAGG + Intronic
1046490983 8:114952893-114952915 GGATGTACACCCTGGGCTGAAGG + Intergenic
1048909959 8:139125802-139125824 GGTTGATTACCCTGGGGAAATGG + Intergenic
1054354590 9:64049082-64049104 GGCAGTACACCCTGGCGATATGG - Intergenic
1054768803 9:69065911-69065933 GGTTGTGTACCCTGTGGAGGTGG + Intronic
1056330221 9:85515052-85515074 GGCTCTATATGCTGGTGAGATGG - Intergenic
1057100944 9:92359350-92359372 GCCTGTAAACCCTGGGGAAGAGG - Intronic
1060244270 9:121930960-121930982 GGCTGTACACAGTGAGGAGATGG + Intronic
1061382513 9:130266681-130266703 GCCTGTCTTCCCTGGGGAAAGGG + Intergenic
1061388579 9:130304766-130304788 GGCAGTCTCCCCTGGGGACACGG - Intronic
1061871198 9:133521679-133521701 GACTGTTTACCTTGGGGACAGGG + Intronic
1062338308 9:136082201-136082223 GGGTGAAGACCCTGGGGAGACGG - Intronic
1203742928 Un_GL000218v1:18206-18228 GGCAGTACACCCTGGCGATATGG - Intergenic
1203462537 Un_GL000220v1:54930-54952 GGCTGTATCCCATGGGTAGTAGG + Intergenic
1186326629 X:8484734-8484756 GCCTGTATACACTGCAGAGATGG - Intergenic
1189929788 X:45996698-45996720 GGTTCTGTGCCCTGGGGAGAGGG - Intergenic
1192863678 X:75107406-75107428 GGCTGTACAACCTGGGGTGAGGG - Intronic
1192941698 X:75919883-75919905 GTCTGTATGCCCTGTAGAGAAGG - Intergenic
1193930304 X:87544181-87544203 GGCTGTATACCTTGTGGCCAGGG + Intronic
1194905118 X:99566326-99566348 GGCAATAAACCCTGGGGAGGGGG + Intergenic
1199287259 X:146067390-146067412 GGCTGTATCCCTTAGGGAGTAGG + Intergenic
1199898992 X:152154426-152154448 GGCTCAATACCATGGAGAGAGGG - Intergenic
1201156458 Y:11135675-11135697 GGCAGTACACCCTGGCGATATGG - Intergenic