ID: 1111911947

View in Genome Browser
Species Human (GRCh38)
Location 13:94322758-94322780
Sequence TAGGCTCCACAAAAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111911943_1111911947 2 Left 1111911943 13:94322733-94322755 CCATATTTGTGGCAGCCTCAGGT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1111911947 13:94322758-94322780 TAGGCTCCACAAAAGCAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111911947 Original CRISPR TAGGCTCCACAAAAGCAGCA GGG Intronic
902075917 1:13785736-13785758 TGGGCTCCAGTAAAGCAGAAAGG + Intronic
908077337 1:60535069-60535091 TAGGGTCTGCAAAAGCAGCAGGG + Intergenic
908337195 1:63138818-63138840 TATGCTGAGCAAAAGCAGCAAGG + Intergenic
908552311 1:65221819-65221841 TATGGTCTTCAAAAGCAGCATGG - Intronic
911117156 1:94257781-94257803 TATGCTCTATAACAGCAGCAAGG + Intronic
912790970 1:112650318-112650340 TGAGTTCCAAAAAAGCAGCATGG - Intronic
913641766 1:120819091-120819113 TAGACTCCACAAAATCATCATGG - Intronic
914189661 1:145398110-145398132 TAGACTCCACACAATCATCATGG + Intronic
914276712 1:146131247-146131269 TAGACTCCACACAATCATCATGG + Intronic
914366099 1:146979927-146979949 TAGACTCCACACAATCATCATGG - Intronic
914486345 1:148113498-148113520 TAGACTCCACACAATCATCATGG + Intronic
914537756 1:148582202-148582224 TAGACTCCACACAATCATCATGG + Intronic
914586672 1:149068655-149068677 TAGACTCCACACAATCATCATGG + Intronic
914628169 1:149483143-149483165 TAGACTCCACACAATCATCATGG - Intergenic
917692376 1:177482613-177482635 TAGGCTTCATGAAGGCAGCAAGG - Intergenic
918149286 1:181784235-181784257 TAGATTGCACAAAAGCAGAAAGG - Intronic
918192162 1:182186082-182186104 TATTATCCTCAAAAGCAGCAGGG + Intergenic
918368724 1:183837335-183837357 TGGGCTGCACAAAAACAGAATGG + Intronic
919222275 1:194644108-194644130 CAGGCTCAATAAAAGCAGGAAGG + Intergenic
921303070 1:213769000-213769022 TAGGGACAACAAAAGCGGCAGGG + Intergenic
922774780 1:228209583-228209605 TGGGTTCCCCAAAAGCAGAACGG - Intronic
1065251701 10:23821977-23821999 TAGCCTGAACACAAGCAGCAGGG - Intronic
1065855509 10:29826997-29827019 TAGCTTCCACAAAGGCAGCCTGG - Intergenic
1066093421 10:32049213-32049235 TATGCTCCACTAAAGCAGAGAGG - Intronic
1067451961 10:46387204-46387226 TCAGCTCCACAGAAGCACCATGG - Intronic
1067585276 10:47472551-47472573 TCAGCTCCACAGAAGCACCATGG + Intronic
1067802636 10:49369660-49369682 TTGGCTGCACAACAGCAGGAAGG + Intronic
1069987181 10:72292410-72292432 TAGGCTCCAGGAAAGCAGGTGGG + Intergenic
1070897479 10:79996865-79996887 TGGGATCCACCAAGGCAGCAAGG - Intergenic
1076670390 10:132117739-132117761 TAGGGTCCTCAAAACCAACAGGG - Intronic
1078615081 11:12857285-12857307 CCGGCTGCACATAAGCAGCAAGG - Intronic
1080296515 11:30736268-30736290 AGGGCTCCATAAAAGCAGCAAGG - Intergenic
1081078169 11:38702336-38702358 TAGGCTGAACAAGAGCAACAAGG - Intergenic
1081841558 11:46205382-46205404 CAGTCTCTACAAAAGCATCAAGG + Intergenic
1084714878 11:70867337-70867359 TTGGCTCCACACGGGCAGCAGGG + Intronic
1085995358 11:81906094-81906116 TAGGCTGCAAGAGAGCAGCAGGG - Intergenic
1086219414 11:84424274-84424296 CATGCTCCACAATATCAGCATGG - Intronic
1087914907 11:103799061-103799083 CAAGCTCCGCAAAAGAAGCAGGG + Intergenic
1090395198 11:126414207-126414229 TCGGCTCCATAAGAGCAGCCAGG - Exonic
1091224457 11:133949262-133949284 TAGGATCCAGAAAAGCAAGAGGG - Intronic
1091404774 12:202392-202414 GAGGCTGAGCAAAAGCAGCAGGG - Intronic
1093475159 12:19546897-19546919 TTGGCTGCACAAAAGCTGAACGG - Intronic
1095517290 12:43020816-43020838 AAAGCTCCACAAAGGCAGCCAGG + Intergenic
1100813166 12:98360465-98360487 TAGGCTTCACCAGAGAAGCAGGG - Intergenic
1108041321 13:46341756-46341778 AAGACACCACAAAAGAAGCAGGG + Intergenic
1110935207 13:81279130-81279152 AAGGAGCCACAAAAGCAGCCTGG + Intergenic
1111911947 13:94322758-94322780 TAGGCTCCACAAAAGCAGCAGGG + Intronic
1112727613 13:102322416-102322438 TAGGATCCCCAAAAGCCTCAGGG - Intronic
1113189121 13:107723202-107723224 CAGGAACCACAAAAGCAGCAAGG - Intronic
1116790316 14:49333282-49333304 TAGGTTCCTAAAAGGCAGCATGG - Intergenic
1116858336 14:49973597-49973619 CAGGCCCCACAAAAGCTCCATGG - Intergenic
1117059540 14:51947961-51947983 GTGGCTCCACAAAATCAGTAAGG + Intronic
1124375850 15:29128234-29128256 AAGGCTCCAGGAAAGCAGAAGGG - Intronic
1130269934 15:82440900-82440922 AAGACTCCACAAACACAGCACGG + Intergenic
1132940790 16:2507109-2507131 GAGGCTCCACAGCAGCTGCAGGG - Intronic
1133869770 16:9676035-9676057 TACCCTCCAGAAAAGCAGGAAGG + Intronic
1137518897 16:49174916-49174938 TAGGCTATACAAAAACAGGAAGG + Intergenic
1140092317 16:71848827-71848849 TAGGCTACAGAAAGGAAGCAAGG + Intronic
1149453242 17:56766495-56766517 TTGGGTCCAGAAAACCAGCAGGG + Intergenic
1156796987 18:41058019-41058041 TAGGCCACACAAATGTAGCAAGG - Intergenic
1157001991 18:43537919-43537941 AAGGGTCCACAAAAGAGGCAGGG + Intergenic
1157740413 18:50087919-50087941 TAAGAGCCACAAGAGCAGCAGGG + Intronic
1158508131 18:58064968-58064990 GAGGCTCCACTACAGCAGGAAGG - Intronic
1163900446 19:20095541-20095563 TACCCTCCAGAAAAGCAGGAAGG + Intronic
1164850940 19:31483620-31483642 GAGGCTGCACAGGAGCAGCAGGG + Intergenic
1166333052 19:42089819-42089841 TGGCCTCCACAATAGCAGGAGGG + Exonic
926009667 2:9398212-9398234 TAGAATCCACAAAACCAGCTGGG + Intronic
927476561 2:23418423-23418445 TAGGCTCCACATAGGCATCTCGG + Intronic
932589278 2:73054121-73054143 TAGGCTCCACAAACTCTGGAAGG - Intronic
932837035 2:75047389-75047411 TAGGCTCTTCAAGAGCTGCAGGG + Exonic
935860112 2:107320511-107320533 GAGGCACCACCAGAGCAGCAGGG + Intergenic
937783191 2:125863812-125863834 TAGCCACCACAAAACCTGCATGG + Intergenic
939224986 2:139353697-139353719 TAGGCTGCACACACACAGCACGG - Intergenic
939349301 2:141013555-141013577 TATGATCCACGAAAGCAACAAGG - Exonic
940742819 2:157530398-157530420 GAGTCTGCACAAAAGCACCAGGG - Exonic
941154444 2:161959032-161959054 TAGGAACCACAAAAGTAACATGG + Intronic
943537903 2:189175465-189175487 TTGGCTCCACAAAGTCATCAGGG - Intronic
946834617 2:223760626-223760648 TAGATTCCATAAAACCAGCATGG - Intronic
1174461867 20:50689001-50689023 TAGGCACCTCAGAAGCTGCAGGG + Intronic
1175524558 20:59624551-59624573 CAGGCTACACAGGAGCAGCATGG - Intronic
1178400466 21:32280649-32280671 TTGGCTCTACAAAAGTAGAAGGG - Intergenic
1179328355 21:40373361-40373383 TAGGCTCCAGAAATGCAAAAAGG + Intronic
1180183321 21:46127569-46127591 CAGGGTCCACATCAGCAGCAGGG + Intronic
1183556381 22:38530514-38530536 TTGGCTTCACAAAAGCAACAGGG + Intronic
1184810721 22:46829943-46829965 TAGGCACCATGAAAGGAGCAGGG + Intronic
949473425 3:4419780-4419802 TAGGCCTCTCAAAAGGAGCAGGG + Intronic
950380121 3:12606064-12606086 CAAGTTCCACAGAAGCAGCAAGG + Intronic
950934199 3:16822260-16822282 TGGGCTCCAAAAAGGAAGCAGGG + Intronic
951498899 3:23362172-23362194 TAGGGTCCATCAAGGCAGCAGGG + Intronic
955681344 3:61505265-61505287 TAGGCTCTCCAAAAAAAGCATGG + Intergenic
960393924 3:117112855-117112877 CAGGCTCCAAAACAGAAGCATGG - Intronic
960742683 3:120852260-120852282 GAGGCACCATAAAAGCACCATGG + Intergenic
961364590 3:126391144-126391166 TAGCCTCCACCAGAGCTGCAGGG + Intergenic
964662046 3:159131086-159131108 GAGGTACCACAAGAGCAGCATGG + Intronic
964906670 3:161726398-161726420 TACCCTCCAGAAAAGCAGGAAGG + Intergenic
967847022 3:194052257-194052279 CAGACTCCACAAAAGGAGCAAGG + Intergenic
968488791 4:878771-878793 TATGCTCCACAGAGGCACCACGG - Intronic
971052893 4:22881123-22881145 AAGAATCCACAAAAACAGCAGGG - Intergenic
971683982 4:29740865-29740887 TGGTCTCCACAAGAGCCGCAAGG - Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975967397 4:79990744-79990766 TAGAGTACACCAAAGCAGCATGG + Intronic
979184407 4:117770746-117770768 CAGGCCCCACAGAAGCATCAAGG - Intergenic
980101937 4:128550564-128550586 AAGGCTTTACAGAAGCAGCAGGG + Intergenic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
983669326 4:170217226-170217248 AAGGCTCCACACAAGCACCTGGG - Intergenic
984798507 4:183689546-183689568 TAAGCTCCACAAGGGCAGAAGGG + Intronic
985366634 4:189237744-189237766 TAGGATCCACCAAGGCAGCGAGG - Intergenic
985621814 5:959918-959940 TCGTCCTCACAAAAGCAGCAGGG + Intergenic
988400321 5:30753143-30753165 TAGGCTGGACAAAACCAGCAAGG + Intergenic
990238862 5:53797216-53797238 GAGGCTCAACAACATCAGCAAGG + Intergenic
990681261 5:58247020-58247042 TAGGCTTCAGATAAGCAGAAAGG - Intergenic
992968878 5:82034694-82034716 GAGGCGCCACAGAAACAGCAGGG - Intronic
993070949 5:83162848-83162870 GAGACTCCAAAATAGCAGCAGGG - Intronic
993105972 5:83601355-83601377 TAAGCTCCACCAAAGCAGAGAGG - Intergenic
993608060 5:90018766-90018788 TAGGCTCCACAAAATCTAAATGG + Intergenic
994092185 5:95819163-95819185 TAGGTTCAACAAAGGCAGAAGGG + Intronic
997666040 5:135630167-135630189 CAGGCTCCACATCAGCAGAAAGG - Intergenic
997997926 5:138601421-138601443 TAGGGTCCAGAAAACCAGCTGGG + Intergenic
1001657564 5:173363806-173363828 TAGGCACCACAGATGCAACAGGG - Intergenic
1002965041 6:1956541-1956563 TGGGCTCTACAAATTCAGCATGG + Intronic
1003363992 6:5455353-5455375 TAGTCTCCAGGGAAGCAGCAGGG + Intronic
1004276597 6:14241908-14241930 TAGCCTCTACTTAAGCAGCAGGG - Intergenic
1007260950 6:40562633-40562655 TAGCCGCCAGAGAAGCAGCAGGG + Intronic
1007991842 6:46264314-46264336 TAAGCTTTTCAAAAGCAGCAGGG + Intronic
1009957442 6:70472729-70472751 TAGTCTCCACAAAAGTGTCAGGG - Intronic
1019822777 7:3257926-3257948 AAGGCTCCACAAAGTCACCAGGG + Intergenic
1022525833 7:31036592-31036614 TAAGCTCCCTAAGAGCAGCAGGG + Intergenic
1022802858 7:33792486-33792508 TGGGCTCCACCAGAGCAGGAGGG - Intergenic
1024196388 7:47063651-47063673 TAGCCTACACAAAATCAGAATGG + Intergenic
1024365693 7:48517772-48517794 CAGACTCCATATAAGCAGCAGGG - Intronic
1026770857 7:73197630-73197652 AACGCCCCACAAACGCAGCATGG - Intergenic
1027011725 7:74751027-74751049 AACGCCCCACAAACGCAGCATGG - Intronic
1027076315 7:75195024-75195046 AACGCCCCACAAACGCAGCATGG + Intergenic
1028278903 7:88895969-88895991 TAGTCTGCACATAAGCAGTAAGG - Intronic
1031004510 7:116456684-116456706 TACCCTCCAGAAAAGCAGGAAGG - Intronic
1032501442 7:132403213-132403235 CCTGGTCCACAAAAGCAGCAGGG + Intronic
1036611819 8:10356860-10356882 AAGGCTCAAAAACAGCAGCAAGG - Intronic
1038328300 8:26588779-26588801 TGGGCACCGGAAAAGCAGCAAGG - Intronic
1048825206 8:138417402-138417424 TATACACCAAAAAAGCAGCATGG - Intronic
1049738801 8:144224590-144224612 GAGGCTCCACGGAAACAGCAAGG - Intronic
1052046212 9:23797282-23797304 AAGGCACTACAAAAACAGCACGG + Intronic
1054806327 9:69399184-69399206 TATTCTACACAAAAGCACCAAGG - Intergenic
1056007250 9:82285581-82285603 TGGGCCCCAAATAAGCAGCAGGG + Intergenic
1056064496 9:82919600-82919622 TGGTTTCCATAAAAGCAGCAGGG + Intergenic
1056860567 9:90177097-90177119 AAGGCTCCACAAAAGAGACAGGG - Intergenic
1056884864 9:90431672-90431694 TAGATATCACAAAAGCAGCATGG + Intergenic
1192359859 X:70432628-70432650 GAAGGTCCACAAAAGCAGCATGG - Exonic
1192791324 X:74384224-74384246 CAGGCTCCACATATGCAGGAAGG + Intergenic
1193024327 X:76828813-76828835 TAGGCTCAGCACAAACAGCAGGG - Intergenic
1198451944 X:136775511-136775533 AACCCTCCACAAAATCAGCATGG + Intronic
1199751326 X:150822243-150822265 TATGCTACACAAAAGAAGCCAGG + Intronic