ID: 1111915632

View in Genome Browser
Species Human (GRCh38)
Location 13:94357255-94357277
Sequence TTCCAAACCCTTAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111915628_1111915632 4 Left 1111915628 13:94357228-94357250 CCTTTCAGTTGCACCAAACTAAC 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 101
1111915629_1111915632 -9 Left 1111915629 13:94357241-94357263 CCAAACTAACTACTTTCCAAACC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 101
1111915625_1111915632 30 Left 1111915625 13:94357202-94357224 CCTGCCTCTCCAACATATGCACT 0: 1
1: 0
2: 0
3: 11
4: 204
Right 1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 101
1111915626_1111915632 26 Left 1111915626 13:94357206-94357228 CCTCTCCAACATATGCACTTTGC 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 101
1111915627_1111915632 21 Left 1111915627 13:94357211-94357233 CCAACATATGCACTTTGCCTTTC 0: 1
1: 0
2: 5
3: 17
4: 224
Right 1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111915632 Original CRISPR TTCCAAACCCTTAGTGGGTT TGG Intronic
901558475 1:10050429-10050451 CTGCAGACCCTTAGTGGTTTTGG - Intronic
902767569 1:18627616-18627638 TTCCAAACCCAAATTGGGTTTGG + Intergenic
902767570 1:18627618-18627640 TTCCAAACCCAATTTGGGTTTGG - Intergenic
908644314 1:66260752-66260774 TTCCAAACCCTTGAGGGTTTTGG + Intronic
909653952 1:78009385-78009407 TTCCAAACACATATTTGGTTTGG + Intronic
910188596 1:84572621-84572643 TACCCAATACTTAGTGGGTTAGG - Intronic
916651079 1:166835341-166835363 GTTCAGACCCTTAGTGGATTGGG - Intergenic
917059875 1:171025816-171025838 TTTTAAAACTTTAGTGGGTTTGG - Intronic
917368466 1:174260409-174260431 TTTCAAACCCTCAGTGCCTTGGG + Intronic
920091306 1:203455154-203455176 TTCCCCGCCCTTGGTGGGTTTGG - Intergenic
921152505 1:212413626-212413648 TGCCAGACCCTAGGTGGGTTAGG + Intronic
922922935 1:229323090-229323112 ATCCAAGTCCTTAGTTGGTTAGG - Exonic
923298991 1:232623141-232623163 TTCCCAGCCGTTAGTGGGTTGGG - Intergenic
924183858 1:241466368-241466390 ACCAAAACCCTTAGTGGGTAAGG + Intergenic
1067498612 10:46781725-46781747 TCCCAAAGTCTTAGAGGGTTAGG + Intergenic
1067596032 10:47558679-47558701 TCCCAAAGTCTTAGAGGGTTAGG - Intergenic
1068151916 10:53143196-53143218 TACAAAACCAATAGTGGGTTTGG - Intergenic
1073255660 10:102149385-102149407 TTCCTAACCCTTTGTGAGTGGGG + Intronic
1076310382 10:129502071-129502093 GCCCAGACCCGTAGTGGGTTTGG + Intronic
1082828706 11:57599419-57599441 TTGCAACCCATTAGTGGGTGTGG - Intronic
1089916226 11:122159479-122159501 TTCCAAACCCTGAGTGAAATGGG - Intergenic
1090764508 11:129865087-129865109 CTCCACAGCCTCAGTGGGTTGGG - Exonic
1103963649 12:124624708-124624730 TTCCCGACCCTTGGTGGGTAGGG - Intergenic
1105343079 13:19546249-19546271 TTCCCAGCCCCTATTGGGTTAGG + Intergenic
1108005954 13:45946689-45946711 TTCCAAACCATAAGTGGTTGGGG - Intergenic
1109240447 13:59880306-59880328 TCCCAAATCCCTAGTGTGTTTGG - Intronic
1110611024 13:77487948-77487970 CTCCAAACCATGAGTGGTTTGGG - Intergenic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1113576234 13:111397040-111397062 TTCTAAACTCTTAGCTGGTTGGG + Intergenic
1116566231 14:46447891-46447913 TTCCAAACCCGTAGTGCACTTGG + Intergenic
1118518727 14:66556490-66556512 TTCCATACCCTTAGTTTTTTGGG - Intronic
1119445579 14:74660776-74660798 TCCCAAACCCCTTGTGGGTGAGG + Intronic
1120926595 14:89803314-89803336 TTTCAAAACCTTAGAGTGTTGGG - Intronic
1120948172 14:90017252-90017274 TTCCAAACTCTTGTGGGGTTGGG - Intronic
1121165820 14:91797462-91797484 TTTCAAAGCCAAAGTGGGTTGGG + Intronic
1122193522 14:100067366-100067388 TTCCAAGCCCTGACTGGATTAGG + Intronic
1125110548 15:36027296-36027318 TTCCAAACCTTTCGAGTGTTTGG + Intergenic
1126267983 15:46777286-46777308 TTCCAAACAAATAGTCGGTTTGG + Intergenic
1129977938 15:79838164-79838186 TTCCCAAACCCCAGTGGGTTAGG - Intronic
1131521869 15:93122476-93122498 TTCCAAACCCATCGTAGGTTTGG + Intergenic
1135068261 16:19329932-19329954 TTGCAAACCATTAGTGGGTTGGG - Intergenic
1135597852 16:23756903-23756925 TTAGAAACCCTTAGTGGCTAAGG + Intronic
1138624877 16:58243480-58243502 TTCCAACACCTTAGTGGGAATGG + Intronic
1141643032 16:85352528-85352550 TTCCAAGCCCACAGTGGGTCTGG - Intergenic
1148787572 17:50152762-50152784 TTCCAAACCCCAACTGGGTGAGG - Intergenic
1148973630 17:51507309-51507331 TTCCAAATCTTGGGTGGGTTGGG + Intergenic
1153834326 18:8950577-8950599 TTCCACAGCCTTGGTGAGTTTGG + Intergenic
1160179141 18:76619290-76619312 TTCCAAACCTTTAAAGAGTTAGG - Intergenic
1161050445 19:2161056-2161078 ATCCACACCCTGAGTGGGTAGGG + Intronic
1166908460 19:46132921-46132943 CTCCTAATCCTTAGTGGTTTGGG - Intergenic
927666161 2:25034441-25034463 TGCCAAACCCTGAGGGGGCTCGG + Intergenic
930403263 2:50919222-50919244 TTCCAAACCCTGAGTTGTTATGG + Intronic
933327865 2:80861945-80861967 TTCCAAACCCAAAGTGGTTGGGG + Intergenic
933795872 2:85919073-85919095 TTCCAACCCCCGAGTGTGTTTGG - Intergenic
937219270 2:120332448-120332470 TCCCAAGTCCTTACTGGGTTTGG - Intergenic
938168632 2:129055809-129055831 CTCCAAACCCTGCGTGGGTTTGG - Intergenic
940398799 2:153222844-153222866 TTCCAAGCCCATAGGGGTTTGGG + Intergenic
940415158 2:153411319-153411341 TTCCAAACTCTTTGTGGGCAGGG - Intergenic
940451171 2:153839439-153839461 TTAAAAACCCTCAGTGGATTAGG - Intergenic
940460495 2:153958222-153958244 CTCCCAACTCTCAGTGGGTTGGG - Intronic
941252544 2:163184379-163184401 AACCAAATCATTAGTGGGTTGGG - Intergenic
943327416 2:186517854-186517876 TTCCACACCCTCAGTGGATGTGG + Intergenic
945565419 2:211392381-211392403 TTCCCAGCCATTATTGGGTTTGG - Intronic
948054105 2:234998518-234998540 TTCCTATCCCTTTGTGTGTTTGG + Intronic
1170481758 20:16772982-16773004 ATCCAAACCATCAGTGAGTTTGG - Intergenic
1170523587 20:17213929-17213951 TTCCAAACCCTAACTGGGCTTGG - Intergenic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1174560433 20:51427180-51427202 TTCAAAACCTGTGGTGGGTTTGG + Intronic
1181850112 22:25743789-25743811 TTCTAAAACCTGAGGGGGTTGGG + Intronic
954999855 3:54917672-54917694 TTCCAATCCCTTGGTGGATATGG + Intronic
955039476 3:55301236-55301258 TTGAAAACTCTTAATGGGTTAGG + Intergenic
955777525 3:62449575-62449597 TTCCAAAACTCTAGTGGGTTGGG - Intronic
959096713 3:101964450-101964472 CTCCAAACAATAAGTGGGTTGGG - Intergenic
959568132 3:107853454-107853476 TTCCAAATACCTAGTGGATTAGG - Intergenic
959792393 3:110378614-110378636 TTCTAAGGCCTTACTGGGTTAGG - Intergenic
959985696 3:112568524-112568546 TTCCAACTCATCAGTGGGTTTGG + Intronic
961240673 3:125408096-125408118 TTCCATGTCCTCAGTGGGTTCGG - Intergenic
967684405 3:192402531-192402553 TTCCTAACCCTCAGTGTGGTGGG + Intronic
973933170 4:55814199-55814221 TTCCAAAGCCTTTTTGGCTTAGG - Intergenic
977976275 4:103270406-103270428 ATCCAAACCCTCAGTGGATTGGG + Intergenic
979451051 4:120871349-120871371 TTCCAGACCCTTTCTGGGTATGG + Intronic
979533162 4:121790611-121790633 ATCCATCCCCTTAGTGAGTTTGG - Intergenic
983358701 4:166699965-166699987 TTCCAAACTCTTTGTGATTTAGG - Intergenic
990299399 5:54435592-54435614 TCCCAAAGCCTCATTGGGTTGGG - Intergenic
993437164 5:87912068-87912090 TTCCAAACCCGTGGTTGTTTTGG - Intergenic
994124410 5:96153372-96153394 TTCCAGAACCTGAGTGCGTTGGG - Intergenic
994785794 5:104160890-104160912 TTCCACACCCTTAACTGGTTTGG + Intergenic
995404480 5:111779252-111779274 TTCCAACCCCTTAGGAGGTCTGG - Intronic
999011246 5:148043134-148043156 TTCCACACCCACAGTGGATTTGG + Intronic
999212810 5:149905036-149905058 TTGAAAACCCTCATTGGGTTTGG - Intronic
999634020 5:153601230-153601252 TTCCAAACTCTTTGAGGTTTTGG - Intronic
1007662944 6:43497539-43497561 TTCCAAACTCTGAGAGGCTTGGG + Intronic
1014178697 6:118359369-118359391 ATCCAGACCCTCAATGGGTTGGG + Intergenic
1015873638 6:137801384-137801406 CTCCAAACACTTGGTGGGTTTGG - Intergenic
1017020696 6:150137699-150137721 TTGCAATCCTTTAGTGGGTTAGG + Intergenic
1017075135 6:150610937-150610959 TTCCAAACCATTTGAGTGTTAGG + Intronic
1017716475 6:157217169-157217191 TGCAAAACCCCCAGTGGGTTCGG - Intergenic
1022185375 7:27962346-27962368 TTCCTAACACTTAATGGGTATGG - Intronic
1025761186 7:64395225-64395247 TTCCAAACACTCAATAGGTTTGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028910840 7:96205807-96205829 TGCCAACACCTTAGTGGGTGGGG + Intronic
1031766193 7:125780990-125781012 TTTCAAACCCCTTGTGGGATGGG + Intergenic
1035334180 7:158114959-158114981 CTCCAATCCCTTAATGGGTGAGG - Intronic
1037168413 8:15859265-15859287 TCCCAAAACTTTAGTGTGTTAGG + Intergenic
1038572476 8:28674826-28674848 TTCCCAACCCTCAGTGGTATTGG + Intronic
1041505574 8:58593964-58593986 TTCCACACCCTTGCTGGGTCAGG - Intronic
1041632716 8:60106094-60106116 TTCCAAACGCTTAAAGGGCTAGG + Intergenic
1058323542 9:103665167-103665189 TTCCAAAGCCATAGTGACTTTGG + Intergenic
1059442837 9:114319591-114319613 TTCAAAATCCTTAGTGCTTTTGG + Intergenic
1187834553 X:23418210-23418232 TTCCAAATCCTCAGTGGATGTGG - Intergenic
1196158581 X:112457537-112457559 TTCCAAGACCATACTGGGTTTGG - Intergenic
1197318645 X:125000644-125000666 TTCTAAACCCTGAGTGAGTCTGG + Intergenic
1200944186 Y:8816075-8816097 TTTTAAACCCTTTGTGGTTTAGG + Intergenic